Genomic and Metabolomic Insights into Metabolites of a Streptomyces Isolate Associated with Chromodoris quadricolor, a Red Sea Nudibranch
Abstract
1. Introduction
2. Results and Discussion
2.1. Whole-Genome Sequencing and Genomic Analysis
2.2. Secondary Metabolite Profiling and Genome Mining
2.3. Metabolomics Analysis
2.4. Correlating the Metabolome and the Genome
3. Materials and Methods
3.1. Streptomyces Cultivation and Whole-Genome Sequencing
3.2. Bioinformatics Analysis and Ecological Statistics
3.3. UHPLC HRMS Analysis
3.4. Molecular Networking and Spectrum Annotation
3.5. Large-Scale Bacterial Metabolite Extraction
3.5.1. Semi-Preparative UHPLC Sample Preparation of Molecules of Interest
3.5.2. Purification and NMR Analysis of Molecules of Interest
3.6. Screening for Ribosomally Synthesized and Post-Translationally Modified Peptides (RiPPs) Gene Clusters Expression by PCR
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BGCs | Biosynthetic gene clusters. |
| GNPS | Global natural products social molecular networking project. |
| HPLC-HRMS/MS | High-resolution tandem mass spectrometry. |
| MS | Mass spectrometry. |
| NRPS | Non-ribosomal peptide synthetase. |
| PKS | Polyketide synthase. |
| RiPPs | Ribosomally synthesized and post-translationally modified peptides. |
| UHPLC-HRMS/MS | Ultra-high-performance liquid chromatography–high-resolution mass spectrometry. |
References
- Teta, R.; Marteinsson, V.T.; Longeon, A.; Klonowski, A.M.; Groben, R.; Bourguet-Kondracki, M.-L.; Costantino, V.; Mangoni, A. Thermoactinoamide A, an Antibiotic Lipophilic Cyclopeptide from the Icelandic Thermophilic Bacterium Thermoactinomyces vulgaris. J. Nat. Prod. 2017, 80, 2530–2535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atanasov, A.G.; Zotchev, S.B.; Dirsch, V.M.; Orhan, I.E.; Banach, M.; Rollinger, J.M.; Barreca, D.; Weckwerth, W.; Bauer, R.; Bayer, E.A.; et al. Natural products in drug discovery: Advances and opportunities. Nat. Rev. Drug Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbas, A.; Barkhouse, A.; Hackenberger, D.; Wright, G.D. Antibiotic resistance: A key microbial survival mechanism that threatens public health. Cell Host Microbe 2024, 32, 837–851. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.K.; Hussein, S.; Qurbani, K.; Ibrahim, R.H.; Fareeq, A.; Mahmood, K.A.; Mohamed, M.G. Antimicrobial resistance: Impacts, challenges, and future prospects. J. Med. Surg. Public Health 2024, 2, 100081. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, I.; Asgher, M.; Sher, F.; Hussain, S.M.; Nazish, N.; Joshi, N.; Sharma, A.; Parra-Saldívar, R.; Bilal, M.; Iqbal, H.M.N. Exploring Marine as a Rich Source of Bioactive Peptides: Challenges and Opportunities from Marine Pharmacology. Mar. Drugs 2022, 20, 208. [Google Scholar] [CrossRef] [Scilit]
- Blunt, J.W.; Carroll, A.R.; Copp, B.R.; Davis, R.A.; Keyzers, R.A.; Prinsep, M.R. Marine natural products. Nat. Prod. Rep. 2018, 35, 8–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wahidullah, S.; Guo, Y.W.; Fakhr, I.M.; Mollo, E. Chemical diversity in opisthobranch molluscs from scarcely investigated Indo-Pacific areas. Prog. Mol. Subcell Biol. 2006, 43, 175–198. [Google Scholar]
- Dean, L.J.; Prinsep, M.R. The chemistry and chemical ecology of nudibranchs. Nat. Prod. Rep. 2017, 34, 1359–1390. [Google Scholar] [CrossRef] [Scilit]
- Karuso, P. Bioorganic Marine Chemistry, Berlin, Heidelberg, 1987. In Chemical Ecology of the Nudibranchs; Scheuer, P.J., Ed.; Springer: Berlin/Heidelberg, Germany, 1987; pp. 31–60. [Google Scholar]
- Abdelrahman, S.M.; Patin, N.V.; Hanora, A.; Aboseidah, A.; Desoky, S.; Desoky, S.G.; Stewart, F.J.; Lopanik, N.B. The natural product biosynthetic potential of Red Sea nudibranch microbiomes. PeerJ 2021, 9, e10525. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, C.T.; Dhakal, D.; Pham, V.T.T.; Nguyen, H.T.; Sohng, J.-K. Recent Advances in Strategies for Activation and Discovery/Characterization of Cryptic Biosynthetic Gene Clusters in Streptomyces. Microorganisms 2020, 8, 616. [Google Scholar] [CrossRef] [Scilit]
- Sharma, V.; Kaur, R.; Salwan, R. Streptomyces: Host for refactoring of diverse bioactive secondary metabolites. 3 Biotech 2021, 11, 340. [Google Scholar] [CrossRef] [Scilit]
- Sarmiento-Tovar, A.A.; Silva, L.; Sánchez-Suárez, J.; Diaz, L. Streptomyces-Derived Bioactive Pigments: Ecofriendly Source of Bioactive Compounds. Coatings 2022, 12, 1858. [Google Scholar] [CrossRef] [Scilit]
- Alam, K.; Mazumder, A.; Sikdar, S.; Zhao, Y.M.; Hao, J.; Song, C.; Wang, Y.; Sarkar, R.; Islam, S.; Zhang, Y.; et al. Streptomyces: The biofactory of secondary metabolites. Front. Microbiol. 2022, 13, 968053. [Google Scholar] [CrossRef] [Scilit]
- Harir, M.; Bendif, H.; Bellahcene, M.; Fortas, Z.; Pogni, R. Streptomyces Secondary Metabolites. In Basic Biology and Applications of Actinobacteria; Enany, S., Ed.; IntechOpen: London, UK, 2018; pp. 99–122. [Google Scholar]
- Klebe, G. Screening Technologies for Lead Structure Discovery. In Drug Design: From Structure and Mode-of-Action to Rational Design Concepts; Klebe, G., Ed.; Springer: Berlin/Heidelberg, Germany, 2024; pp. 95–113. [Google Scholar]
- Crimmin, S.; Grab, S.; Greenwood, N.; Jordon, Z.; Quirin, S.; Tournier, N. The Complexity of Compliance in Sample Management: A Review of Key Issues Impacting Small-Molecule and Biological Sample Management in Early Drug Discovery. SLAS Technol. 2019, 24, 269–281. [Google Scholar] [CrossRef] [Scilit]
- Kind, T.; Fiehn, O. Strategies for dereplication of natural compounds using high-resolution tandem mass spectrometry. Phytochem. Lett. 2017, 21, 313–319. [Google Scholar] [CrossRef] [Scilit]
- Mohimani, H.; Gurevich, A.; Mikheenko, A.; Garg, N.; Nothias, L.F.; Ninomiya, A.; Takada, K.; Dorrestein, P.C.; Pevzner, P.A. Dereplication of peptidic natural products through database search of mass spectra. Nat. Chem. Biol. 2017, 13, 30–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohimani, H.; Gurevich, A.; Shlemov, A.; Mikheenko, A.; Korobeynikov, A.; Cao, L.; Shcherbin, E.; Nothias, L.F.; Dorrestein, P.C.; Pevzner, P.A. Dereplication of microbial metabolites through database search of mass spectra. Nat. Commun. 2018, 9, 4035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schorn, M.A.; Alanjary, M.M.; Aguinaldo, K.; Korobeynikov, A.; Podell, S.; Patin, N.; Lincecum, T.; Jensen, P.R.; Ziemert, N.; Moore, B.S. Sequencing rare marine actinomycete genomes reveals high density of unique natural product biosynthetic gene clusters. Microbiology 2016, 162, 2075–2086. [Google Scholar] [CrossRef] [Scilit]
- Carroll, A.R.; Copp, B.R.; Davis, R.A.; Keyzers, R.A.; Prinsep, M.R. Marine natural products. Nat. Prod. Rep. 2019, 36, 122–173. [Google Scholar] [CrossRef] [Scilit]
- Avalon, N.E.; Murray, A.E.; Baker, B.J. Integrated Metabolomic-Genomic Workflows Accelerate Microbial Natural Product Discovery. Anal. Chem. 2022, 94, 11959–11966. [Google Scholar] [CrossRef] [Scilit]
- Abdelrahman, S.M.; Dosoky, N.S.; Hanora, A.M.; Lopanik, N.B. Metabolomic Profiling and Molecular Networking of Nudibranch-Associated Streptomyces sp. SCSIO 001680. Molecules 2022, 27, 4542. [Google Scholar] [CrossRef] [Scilit]
- Slama, N.; Mankai, H.; Ayed, A.; Mezhoud, K.; Rauch, C.; Lazim, H.; Barkallah, I.; Gtari, M.; Limam, F. Streptomyces tunisiensis sp. nov. a novel Streptomyces species with antibacterial activity. Antonie Van Leeuwenhoek 2014, 105, 377–387. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, W.M.; Olama, Z.A.; Abou-elela, G.M.; Ramadan, H.S.; Hegazy, G.E.; El Badan, D.E.S. Exploring the antimicrobial, antiviral, antioxidant, and antitumor potentials of marine Streptomyces tunisiensis W4MT573222 pigment isolated from Abu-Qir sediments, Egypt. Microb. Cell Factories 2023, 22, 94. [Google Scholar]
- Slama, N.; Mankai, H.; Limam, F. Streptomyces tunisiensis DSM 42037 mediated bioconversion of ferulic acid released from barley bran. World J. Microbiol. Biotechnol. 2021, 37, 70. [Google Scholar] [CrossRef] [Scilit]
- Heel, A.J.V.; Jong, A.D.; Montalbán-López, M.; Kok, J.; Kuipers, O.P. BAGEL3: Automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic Acids Res. 2013, 41, W448–W453. [Google Scholar] [CrossRef] [Scilit]
- Erba, E.; Bergamaschi, D.; Ronzoni, S.; Faretta, M.; Taverna, S.; Bonfanti, M.; Catapano, C.V.; Faircloth, G.; Jimeno, J.; D’Incalci, M. Mode of action of thiocoraline, a natural marine compound with anti-tumour activity. Br. J. Cancer 1999, 80, 971–980. [Google Scholar] [CrossRef] [Scilit]
- Hartkoorn, R.C.; Sala, C.; Neres, J.; Pojer, F.; Magnet, S.; Mukherjee, R.; Uplekar, S.; Boy-Röttger, S.; Altmann, K.H.; Cole, S.T. Towards a new tuberculosis drug: Pyridomycin—nature’s isoniazid. EMBO Mol. Med. 2012, 4, 1032–1042. [Google Scholar]
- Kiefer, A.; Bader, C.D.; Held, J.; Esser, A.; Rybniker, J.; Empting, M.; Müller, R.; Kazmaier, U. Synthesis of New Cyclomarin Derivatives and Their Biological Evaluation towards Mycobacterium Tuberculosis and Plasmodium Falciparum. Chemistry 2019, 25, 8894–8902. [Google Scholar]
- Alvarez-Mico, X.; Jensen, P.R.; Fenical, W.; Hughes, C.C. Chlorizidine, a cytotoxic 5H-pyrrolo[2,1-a]isoindol-5-one-containing alkaloid from a marine Streptomyces sp. Org. Lett. 2013, 15, 988–991. [Google Scholar]
- Igarashi, M.; Tsuchida, T.; Kinoshita, N.; Kamijima, M.; Sawa, R.; Sawa, T.; Naganawa, H.; Hamada, M.; Takeuchi, T.; Yamazaki, K.; et al. Cremimycin, a novel 19-membered macrocyclic lactam antibiotic, from Streptomyces sp. J. Antibiot. 1998, 51, 123–129. [Google Scholar]
- Wang, M.; Carver, J.J.; Phelan, V.V.; Sanchez, L.M.; Garg, N.; Peng, Y.; Nguyen, D.D.; Watrous, J.; Kapono, C.A.; Luzzatto-Knaan, T.; et al. Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking. Nat. Biotechnol. 2016, 34, 828–837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kameyama, T.; Takahashi, A.; Kurasawa, S.; Ishizuka, M.; Okami, Y.; Takeuchi, T.; Umezawa, H. Bisucaberin, a new siderophore, sensitizing tumor cells to macrophage-mediated cytolysis. I. Taxonomy of the producing organism, isolation and biological properties. J. Antibiot. 1987, 40, 1664–1670. [Google Scholar] [CrossRef] [Scilit]
- Konetschny-Rapp, S.; Jung, G.; Raymond, K.N.; Meiwes, J.; Zaehner, H. Solution thermodynamics of the ferric complexes of new desferrioxamine siderophores obtained by directed fermentation. J. Am. Chem. Soc. 1992, 114, 2224–2230. [Google Scholar] [CrossRef] [Scilit]
- Meiwes, J.; Fiedler, H.P.; Zähner, H.; Konetschny-Rapp, S.; Jung, G. Production of desferrioxamine E and new analogues by directed fermentation and feeding fermentation. Appl. Microbiol. Biotechnol. 1990, 32, 505–510. [Google Scholar] [CrossRef] [Scilit]
- Jarmusch, S.A.; Lagos-Susaeta, D.; Diab, E.; Salazar, O.; Asenjo, J.A.; Ebel, R.; Jaspars, M. Iron-meditated fungal starvation by lupine rhizosphere-associated and extremotolerant Streptomyces sp. S29 desferrioxamine production. Mol. Omics 2021, 17, 95–107. [Google Scholar] [CrossRef] [Scilit]
- García, P.A.; de Oliveira, A.B.; Batista, R. Occurrence, biological activities and synthesis of kaurane diterpenes and their glycosides. Molecules 2007, 12, 455–483. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Sun, B.; Wang, M.; Hu, X.; Gao, X.; Xu, S.; Xu, Y.; Xu, J.; Hua, H.; Li, D. Bioactive enmein-type 6,7-seco-ent-kaurane diterpenoids: Natural products, synthetic derivatives and apoptosis related mechanism. Arch. Pharm. Res. 2018, 41, 1051–1061. [Google Scholar]
- Becerril, A.; Álvarez, S.; Braña, A.F.; Rico, S.; Díaz, M.; Santamaría, R.I.; Salas, J.A.; Méndez, C. Uncovering production of specialized metabolites by Streptomyces argillaceus: Activation of cryptic biosynthesis gene clusters using nutritional and genetic approaches. PLoS ONE 2018, 13, e0198145. [Google Scholar]
- Wang, W.; Qiu, Z.; Tan, H.; Cao, L. Siderophore production by actinobacteria. Biometals 2014, 27, 623–631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khasheii, B.; Mahmoodi, P.; Mohammadzadeh, A. Siderophores: Importance in bacterial pathogenesis and applications in medicine and industry. Microbiol. Res. 2021, 250, 126790. [Google Scholar] [CrossRef] [Scilit]
- Shao, M.; Ma, J.; Li, Q.; Ju, J. Identification of the Anti-Infective Aborycin Biosynthetic Gene Cluster from Deep-Sea-Derived Streptomyces sp. SCSIO ZS0098 Enables Production in a Heterologous Host. Mar. Drugs 2019, 17, 127. [Google Scholar] [CrossRef] [Scilit]
- Available online: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ (accessed on 30 August 2025).
- Nurk, S.; Bankevich, A.; Antipov, D.; Gurevich, A.A.; Korobeynikov, A.; Lapidus, A.; Prjibelski, A.D.; Pyshkin, A.; Sirotkin, A.; Sirotkin, Y.; et al. Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. J. Comput. Biol. 2013, 20, 714–737. [Google Scholar] [CrossRef] [Scilit]
- Gurevich, A.; Saveliev, V.; Vyahhi, N.; Tesler, G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics 2013, 29, 1072–1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez-R, L.M.; Gunturu, S.; Harvey, W.T.; Rosselló-Mora, R.; Tiedje, J.M.; Cole, J.R.; Konstantinidis, K.T. The Microbial Genomes Atlas (MiGA) webserver: Taxonomic and gene diversity analysis of Archaea and Bacteria at the whole genome level. Nucleic Acids Res. 2018, 46, W282–W288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmanzalawi, M.; Fujisawa, T.; Mori, H.; Nakamura, Y.; Tanizawa, Y. DFAST_QC: Quality assessment and taxonomic identification tool for prokaryotic Genomes. BMC Bioinform. 2025, 26, 3. [Google Scholar] [CrossRef] [Scilit]
- Chalita, M.; Kim, Y.O.; Park, S.; Oh, H.-S.; Cho, J.H.; Moon, J.; Baek, N.; Moon, C.; Lee, K.; Yang, J.; et al. EzBioCloud: A genome-driven database and platform for microbiome identification and discovery. Int. J. Syst. Evol. Microbiol. 2024, 74, 006421. [Google Scholar] [CrossRef] [Scilit]
- Meier-Kolthoff, J.P.; Carbasse, J.S.; Peinado-Olarte, R.L.; Göker, M. TYGS and LPSN: A database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2022, 50, D801–D807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit]
- Blin, K.; Kim, H.U.; Medema, M.H.; Weber, T. Recent development of antiSMASH and other computational approaches to mine secondary metabolite biosynthetic gene clusters. Brief Bioinform. 2019, 20, 1103–1113. [Google Scholar]
- Pluskal, T.; Castillo, S.; Villar-Briones, A.; Oresic, M. MZmine 2: Modular Framework for Processing, Visualizing, and Analyzing Mass Spectrometry-Based Molecular Profile Data. BMC Bioinform. 2010, 11, 395. [Google Scholar] [CrossRef] [Scilit]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome. Res. 2003, 13, 2498–2504. [Google Scholar] [PubMed]






| Target Gene | Primer | Sequences | Approximate Amplicon Length (bp) | References |
|---|---|---|---|---|
| Node 6 | 577F | CTCTGGTCGCCCTCTTGAAG | 389 | This study |
| 966R | GCAGGTCGAGACTGATCCTG | |||
| 128F | CATGACCTCACAGCCCATCA | 227 | ||
| 355R | CCGCTGATCAGGTCGTACTC | |||
| Node 54 | 2F | GTCATCCCTCATGGCATATG | 298 | This study |
| 300R | GTCGACGGAACACCAGAAG | |||
| 90F | CATCGCTGAACTGTGTGACG | 459 | ||
| 549R | CAATCCGGAACTGTTCTGCC | |||
| Node 71 | 287F | GGTTCTCCATGGCTGTCTCC | 440 | This study |
| 727R | GAATCGGTTCCTTCCTGCTC | |||
| 1615F | GCGGGATCCTCACTCATCAG | 190 | ||
| 1805R | GACTACTACAGCCTGGGTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelrahman, S.M.; Pratte, Z.A.; El Samak, M.; Dosoky, N.S.; Hanora, A.M.S.; Stewart, F.J.; Lopanik, N.B. Genomic and Metabolomic Insights into Metabolites of a Streptomyces Isolate Associated with Chromodoris quadricolor, a Red Sea Nudibranch. Mar. Drugs 2025, 23, 404. https://doi.org/10.3390/md23100404
Abdelrahman SM, Pratte ZA, El Samak M, Dosoky NS, Hanora AMS, Stewart FJ, Lopanik NB. Genomic and Metabolomic Insights into Metabolites of a Streptomyces Isolate Associated with Chromodoris quadricolor, a Red Sea Nudibranch. Marine Drugs. 2025; 23(10):404. https://doi.org/10.3390/md23100404
Chicago/Turabian StyleAbdelrahman, Samar M., Zoe A. Pratte, Manar El Samak, Noura S. Dosoky, Amro M. S. Hanora, Frank J. Stewart, and Nicole B. Lopanik. 2025. "Genomic and Metabolomic Insights into Metabolites of a Streptomyces Isolate Associated with Chromodoris quadricolor, a Red Sea Nudibranch" Marine Drugs 23, no. 10: 404. https://doi.org/10.3390/md23100404
APA StyleAbdelrahman, S. M., Pratte, Z. A., El Samak, M., Dosoky, N. S., Hanora, A. M. S., Stewart, F. J., & Lopanik, N. B. (2025). Genomic and Metabolomic Insights into Metabolites of a Streptomyces Isolate Associated with Chromodoris quadricolor, a Red Sea Nudibranch. Marine Drugs, 23(10), 404. https://doi.org/10.3390/md23100404

