Next Article in Journal
Mechanisms of Antitumor Invasion and Metastasis of the Marine Fungal Derivative Epi-Aszonalenin A in HT1080 Cells
Previous Article in Journal
Bibliometric Review of the Literature on Cone Snail Peptide Toxins from 2000 to 2022
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Marine Drugs
Volume 21
Issue 3
10.3390/md21030155
marinedrugs-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Possible Role of Docosahexaenoic Acid in Response to Diarrhetic Shellfish Toxins in the Mussel Perna viridis

by
Kuan-Kuan Yuan
,
Zi-Min Chen
,
Ya-Xin Liu
,
Hong-Ye Li
and
Wei-Dong Yang
*
Key Laboratory of Aquatic Eutrophication and Control of Harmful Algal Blooms of Guangdong Higher Education Institute, College of Life Science and Technology, Jinan University, Guangzhou 510632, China
*
Author to whom correspondence should be addressed.
Mar. Drugs 2023, 21(3), 155; https://doi.org/10.3390/md21030155
Submission received: 4 February 2023 / Revised: 18 February 2023 / Accepted: 24 February 2023 / Published: 25 February 2023
(This article belongs to the Section Marine Toxins)
Browse Figures
Versions Notes

Abstract

:
Marine bivalves are rich in docosahexaenoic acid (DHA), a polyunsaturated fatty acid known to be beneficial for human health; however, the potential role of DHA in protecting shellfish from the toxicity of diarrhetic shellfish toxins (DSTs) remains poorly understood. Here, we aimed to study the effect of DHA on the response of the bivalve, Perna viridis, to DSTs by using LC-MS/MS, RT-qPCR, and histological examination. In this study, we observed that the DHA content decreased significantly with esterification of DSTs in the digestive gland of the mussel P. viridis after 96 h of exposure to Prorocentrum lima, a DST-producing dinoflagellate. The addition of DHA significantly increased the esterification level of DSTs and increased the expression of Nrf2 signaling pathway-related genes and enzyme activities, alleviating the damage of DSTs to digestive glands. These results suggested that DHA may mediate the esterification of DSTs and activation of the Nrf2 signaling pathway in P. viridis to protect mussels from the toxic effects of DSTs. This study may provide new insights regarding the response of bivalves to DSTs and lay the foundation for uncovering the role of DHA in environmental adaptation of bivalves.

Graphical Abstract

1. Introduction

Among the widely distributed marine biotoxins, diarrhetic shellfish toxins (DSTs) are commonly associated with diarrhetic shellfish poisoning events worldwide [1,2,3]. DSTs belong to a group of polyether lipid-soluble compounds, which mainly include okadaic acid (OA) and dinophysistoxin (DTX) analogues [4,5]. They are produced by some marine dinoflagellate species of the genera Prorocentrum and Dinophysis [6]. As specific inhibitors of serine/threonine protein phosphatases, these toxins can cause severe mucosal damage in the intestine, disrupt DNA structure and cytoskeleton, and exert negative immunological and neurological effects [7,8,9]. The predominant route of human exposure to DSTs is via the consumption of contaminated filter-feeding shellfish, which can lead to gastrointestinal disturbance and diarrhetic poisoning [10,11]. Studies have shown that compared to other organisms, bivalves exhibit tolerance to DSTs to a certain extent, and the toxicity of DSTs to bivalves decreases with exposure time [12,13,14,15].
In bivalve mollusks, the digestive gland is the main organ that accumulates DSTs, which are transformed during digestion [16]. Studies have shown that free forms of DSTs (OA, DTX1, DTX2) produced by marine microalgae can be esterified with fatty acids of different carbon chain lengths to form 7-O-acyl derivatives, known as dinophysistoxin-3 (DTX3) [17,18,19]. DTX3 is less toxic due to its low affinity for the target protein [8], which may also contribute to the tolerance of bivalves to DSTs.
Studies have demonstrated that DSTs can trigger oxidative stress in bivalve shellfish [13,14,15]. Nuclear factor E2-related factor (Nrf2) is as an essential transcription factor that prevents exogenously-induced oxidative damage by regulating the expression of antioxidant proteins [20]. Several studies have suggested that the target genes of the Nrf2/ARE signaling pathway, such as glutathione-S-transferases (GSTs), ABC transporters, and glutathione peroxidase (GPx), and glutathione reductase (GR), are involved in metabolic detoxification of DSTs in bivalves [12,21,22,23,24,25]. Nevertheless, the regulatory mechanism associated with the Nrf2/ARE signaling pathway in bivalves after exposure to DSTs remains largely unclear.
Marine bivalves are rich in omega-3 long chain polyunsaturated fatty acids (LC-PUFA), and their diet mostly contains marine phytoplankton species, which are the main producers of omega-3 LC-PUFA [26]. Although many invertebrates can produce omega-3 LC-PUFA, bivalves generally have limited ability to do so [27]. Docosahexaenoic acid (DHA) is a major omega-3 LC-PUFA with antioxidant activity, which is mainly because of its high level of unsaturation. It can be easily per-oxidized to form J3-isoprostane, and it directly reacts with Keap1, a negative regulator of Nrf2, initiating the dissociation of Keap1 from Cullin3, thereby activating the Nrf2/ARE signaling pathway [28]. However, the role of DHA in bivalves remains unclear. So far, only a few studies have reported that supplementation of diet with DHA improves the daily growth rate and survival of bivalves [29,30,31]. To the best of our knowledge, it is not known whether DHA contributes to tolerance of bivalves to DSTs.
The mussel Perna viridis has been used in toxicological investigations due to its tolerance to environmental changes [32,33]. The dinoflagellate P. lima, a common DST-producing algae, has been widely used in DST-related toxicology research [34]. To investigate the potential role of DHA in protecting shellfish from the harmful effects of DSTs, we assessed the effect of DHA on the accumulation and esterification of DSTs, and observed the changes in metabolic detoxification, antioxidant gene expression, and damage to digestive gland tissues in the P. lima-exposed P. viridis after the addition of DHA. This study will improve our understanding regarding the role of DHA in inducing tolerance to DSTs in bivalve mollusks.

2. Results

2.1. Changes in Accumulation and Esterification of DTSs after Exposure to P. lima

During the experiment, the mussels in each group grew well without mortality, indicating that P. viridis was highly tolerant to DSTs. In the P. lima-exposed group, the levels of total OA (OA+OA ester) and DTX1 (DXT1+DXT1 ester) were slightly higher than those of the free forms of OA and DTX1 after 6 h of exposure, although the difference was not statistically significant. However, the levels of total OA and DTX1 were significantly higher than those of free OA and DTX1 (p < 0.05) at 96 h (Figure 1), indicating that DSTs underwent esterification in P. viridis, which increased with exposure time.

2.2. Changes in Fatty Acid Levels in the Digestive Gland after Exposure to P. lima

As shown in Figure 2, the levels of fatty acids in the digestive gland did not change significantly compared to that in the control group after 6 h of exposure to P. lima (Figure 2A). However, the levels of some PUFA, including eicosapentaenoic acid (EPA) and DHA, were significantly altered after 96 h. The level of EPA C20:5 (n−3) increased significantly, while DHA content decreased sharply (from 11.5 to 3 mg/g) (p < 0.05) (Figure 2B). The DHA content correlated with the extent of DST esterification, suggesting that DHA might be involved in the esterification of DSTs.

2.3. Changes in Nrf2/ARE Signaling Pathway in the Digestive Gland after Exposure to P. lima

As shown in Figure 3, Nrf2 was significantly upregulated (p < 0.01), as was the expression of its downstream genes, Gst and Gr (p < 0.05), while the level of the Gpx transcript decreased (p < 0.01) after 96 h of exposure to P. lima. Sod expression did not change significantly. After exposure to P. lima, the activity of GR increased at 96 h (p < 0.05), GPx activity decreased at 96 h (p < 0.05), whereas SOD activity (p < 0.01) decreased at 6 h and 96 h, and MDA level increased significantly (p < 0.05) at 96 h in the digestive gland. These results suggested that P. lima exposure induced oxidative stress and activated the Nrf2 signaling pathway in mussels.

2.4. Changes in the Esterification Level of DSTs after Addition of DHA

The levels of the free and ester forms of OA and DTX1 in the P. lima-exposed mussels after DHA addition are shown in Figure 4A,B, and the esterification ratios of DSTs are shown in Figure 4C. The esterified OA and DTX1 levels and esterification ratios of OA and DTX1 in all DHA-treated groups (10 µM, 20 µM, 50 µM) were significantly higher than those in the control group (0 µM) (p < 0.05) after 96 h of exposure to P. lima. In particular, the lowest concentration of DHA (10 µM) significantly decreased the accumulation of free OA (from 40.03 to 22.07 ng/g) and DTX1 (from 62.37 to 35.46 ng/g), but increased the accumulation of total DTX1 (Figure 4D).

2.5. DHA Reduced Damage Caused by DSTs in the Digestive Gland

The histological alterations in the digestive gland were evaluated using a semi-quantitative histopathological index. After exposure to P. lima, the digestive gland of P. viridis was severely damaged, mainly characterized by regressing tubule and common dilation of the tubule lumen. This might be attributed to severe atrophy of the epithelium, thinner layers of the epithelial cell, extensive hemocyte infiltration in the damaged tissue, and frequent lipofuscin aggregation around the epithelial cells. Furthermore, some digestive tubules developed deformation or even necrosis (Figure 5A). In the 10 µM DHA group, tubule atrophy was significantly alleviated, as the thickness of the epithelial cells increased significantly, the tubule lumen narrowed and was almost occluded, and hemocyte infiltration was limited to sporadic distribution, although tubular necrosis was still observed (Figure 5B). The HPI per reaction pattern in the digestive gland tissues is shown in Figure 5C. Tubular alterations were the observed reaction pattern with the highest HPI, and the addition of DHA significantly reduced the high indices induced by DSTs. Regarding intertubular morphology, DHA appeared to reduce HPI, although it was not statistically significant.

2.6. DHA Activated the Nrf2/ARE Signaling Pathway

As shown in Figure 6A, Nrf2 and Keap1 expression was significantly higher in the presence of DHA (10 µM) than in the absence of DHA (p < 0.01) after exposure to P. lima. Gst (p < 0.01), Gr (p < 0.01), and Sod (p < 0.01) were significantly upregulated, and the activities of GR (p < 0.05), GPx (p < 0.05), and SOD (p < 0.01) increased significantly (Figure 6B), whereas the level of MDA (p < 0.05) decreased significantly in the presence of DHA (10 µM) (Figure 6C). These results indicated that DHA may enhance antioxidant capacity by activating the Nrf2 signaling pathway.

3. Discussion

Bivalves are filter-feeding mollusks that can accumulate phytotoxins by filtering toxic algae. Our previous studies have demonstrated that the mussel, P. viridis, a typical environmental organism, has developed a cytoprotective mechanism to attenuate the detrimental effects of DSTs [21,25,35,36,37]. Recently, several studies have found that DSTs are esterified in bivalves, which can reduce their toxicity and possibly contribute to DST tolerance [17,18,19,38,39]. However, mussels are suggested to have a relatively weak esterification capacity to DSTs compared with other shellfish such as clams [40,41], which obfuscates the role of esterification in the tolerance of mussel to DSTs. It remains unclear whether esterification plays a key role in the tolerance of P. viridis to DSTs. In line with our previous results [42], here we also found that the concentration of total DSTs (DSTs + DST ester) was significantly higher than that of free DSTs in the digestive gland of the mussel 96 h after exposure to P. lima (Figure 1), indicating the presence of esterified DSTs in the mussel.
DHA is one of the most important omega-3 fatty acids mainly found in seafood, such as fish, shellfish, and fish oils. The marine bivalve lipids are a source of high-quality lipids beneficial for human health and have been considered a sustainable future source of natural omega-3 PUFAs [26,43]. However, although DHA is abundant in marine bivalves, studies on the function of DHA in bivalves are limited [29,44]. Recently, Qiu et al. (2020) found that the fatty acid content in the mussel, Mytilus galloprovincialis, decreased progressively with the accumulation and esterification of DSTs, and that the content of PUFA, especially DHA, decreased, suggesting that DHA may be the main fatty acid involved in DST esterification [39]. In the current study, the content of DHA decreased significantly with the esterification of DSTs in the digestive gland of the P. lima-exposed mussel. The addition of different concentrations of DHA significantly increased the content of esterified OA and DTX1, and 10 µM DHA even reduced the content of free DSTs. These results suggested that DHA might be one of the fatty acids essential for the esterification of DSTs. The increase in EPA and stearidonic acid (SDA) contents may be due to the higher EPA and SDA content in the P. lima strain CCMP 2579 (Figure S2). It may also be that DHA as a substrate participates in esterification of DSTs, resulting in the compensatory synthesis of EPA and SDA as important precursors in the endogenous synthesis of polyunsaturated fatty acids [27,45].
The Nrf2/ARE signaling pathway is a critical mediator of oxidative response and plays an important protective role against oxidative damage [20]. In this study, we observed that the expression of Nrf2 and its downstream target genes, Gst and Gr, were upregulated, indicating the activation of the Nrf2 signaling pathway after exposure to P. lima. Similar to our previous results [35], Gpx was downregulated after exposure to P. lima, which appears to contradict the activation of the Nrf2 signaling pathway. Several studies have shown that activation of NR1J nuclear receptor groups (including HR96) may lead to increased expression and activity of antioxidant enzymes such as GPx [46]. However, whether there is any crosstalk between nuclear receptor and the Nrf2 signaling pathway remain unknown. Correspondingly, GR activity increased, but the activities of GPx and SOD significantly decreased and MDA level increased, indicating that the activation of Nrf2 pathway was not sufficient to reverse the oxidative stress caused by DSTs. These are consistent with our previous findings [25,35,37]. However, the underlying molecular mechanism via which DSTs induced the Nrf2 signaling pathway remains unclear. Previously, we have shown that the DSTs activated the JNK signaling pathway, which was a typical PP1/PP2A phosphatase inhibitor; thus, we speculated that it might activate the Nrf2 signaling pathway via phosphorylation. However, owing to the differences in Nrf2 phosphorylation sites between mussels and mammals, we were not able to observe changes in Nrf2 phosphorylation levels using the only commercially available S40 phosphorylation antibody [25]. Therefore, the activation of the Nrf2 signaling pathway cannot be solely attributed to the action of DSTs as phosphatase inhibitors.
DHA has been demonstrated to be per-oxidized to produce J3-isoprostane, which can activate the Nrf2 signaling pathway [28]. DHA supplementation in HepG2 culture medium can significantly increase the expression and activity of SOD, CAT, and GPx, and reduce the level of reactive oxygen species [47]. Magalhães et al. (2022) found that dietary DHA could increase the activities of SOD and GR in the liver of gilthead sea bream [48]. To reveal the possible roles of DHA in shellfish tolerance to DSTs, we observed the changes in metabolic detoxification, antioxidant gene expression, and damage to digestive gland tissues in the P. lima-exposed P. viridis after addition of 10 µM DHA. We found that Nrf2 and its downstream genes Gst, Gr, Gpx, and Sod were significantly upregulated in the 10 µM DHA group compared to that in the P. lima-exposed group without DHA, and that the activity of the antioxidant enzyme increased significantly, while MDA level decreased. These results suggested that DHA may be per-oxidized in the digestive gland after exposure to P. lima, thereby activating the Nrf2/ARE signaling pathway.
Histopathology of bivalves is a widely recognized tool used in studies on environmental toxicology and the most direct way to visualize the physiological changes in organisms exposed to various toxic substances [49,50]. The histological alterations induced by DSTs mainly manifested as tubule atrophy, hemocyte infiltration, digestive cell reduction, and epithelial cell atrophy, as reported by Neves et al. [51]. Similar morphological changes were observed in the digestive gland tissues of the P. lima-exposed P. viridis. However, after the addition of 10 µM DHA, the extent of atrophy of the degenerated tubules reduced, as was evident from the widening of the epithelial cell layer, narrowing of the tubule lumen, and reduction in hemocyte infiltration, suggesting that DHA could reduce the damage caused by DSTs to mussels. The recovery of the damage to digestive gland tissues after adding DHA was consistent with the esterification of DSTs and activation of the Nrf2 signaling pathway, suggesting that DHA might reduce the toxicity of DSTs to shellfish by activating the Nrf2 signaling pathway and promoting esterification. However, how DHA activates the Nrf2 signaling pathway and promotes the esterification of DSTs in bivalves, and the fatty acid profile of esterified DSTs in P. viridis is still unclear and deserves further study. On the other hand, the present study only observed the response of shellfish exposed to DSTs 96 h after 2 h of DHA addition, which helps to understand the role of DHA in the esterification of DSTs and the mechanism of shellfish tolerance to DSTs. However, it is not clear whether adding DHA after DST exposure can alleviate the damage caused by toxins to shellfish. This is of great significance for the disposal of shellfish after the occurrence of DSTs contamination, which is worthy of further study and implications should be discussed in the broadest context possible. Future research directions may also be highlighted.

4. Materials and Methods

4.1. Animal Maintenance and Algae

The mussel P. viridis was purchased from a local seafood market in Guangzhou, which collected them from Zhanjiang, China. The individual mussels selected were 9.5 ± 1 cm long, the morphology as shown in Figure S1, and their soft body weight was 7.9 ± 1 g; they were transported to our laboratory immediately after purchase. Subsequently, each mussel was cleaned with natural seawater and maintained in some aquariums (6 L) with filtered natural seawater (18 ± 1 °C, 12 h light/12 h dark cycle). They were fed Tetraselmis subcordiformis (1 × 107 cells/L). The natural seawater and algae were changed each day. After acclimation for at least 7 days, the individuals in good condition were selected for subsequent experiments.
The chlorophyte T. subcordiformis was purchased from the Institute of Aquatic Biology, Chinese Academy of Sciences. The DST-producing dinoflagellate, P. lima (CCMP 2579), which produced OA and DTX1 [52], was purchased from the National Center for Marine Algae and Microbiology (NCMA), and its fatty acid profiles are shown in Figure S2. The two algae were batch cultured in an artificial climate incubator (20 ± 1 °C, 60 µmol/ (m2 s), 12 h/12 h photoperiod), and f/2 silicon-free medium filtered through 0.22 µm filters.

4.2. Experimental Design

As DSTs primarily accumulate in the digestive gland, DST esterification, fatty acid levels, and antioxidant enzyme activities in the digestive gland tissues of the P. lima-exposed P. viridis with or without DHA were studied. The subsequent experiments were divided into two parts as shown in Figure 7.
Part I: Response of P. viridis to P. lima exposure. In total, 72 P. viridis individuals were equally and randomly divided into two groups. The P. lima-exposed group was provided with T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L), whereas the control group was provided only with T. subcordiformis (1 × 107 cells/L). The seawater and microalgae were renewed regularly each day. The digestive gland tissues were collected after 6 h and 96 h of exposure. For minimizing errors due to individual differences, the tissues of six mussel individuals from the same group were pooled as one sample. Finally, three biological replicates were considered at each sampling time point for DST detection, fatty acid extraction, RNA extraction, and enzyme activity assay.
Part II: Effect of DHA in alleviating the toxicity of DSTs in P. viridis. In total, 72 P. viridis individuals were equally and randomly divided into four groups: three DAH-added groups and one control. In the DHA-added groups, DHA (>99 % purity, MedChemExpress, Monmouth Junction, NJ, USA) was dissolved in dimethyl-sulfoxide (DMSO) and added to the tanks to different final concentrations (10, 20, and 50 µM). The control group was administered equal volume of DMSO (0.008% final concentration). After DHA or DMSO supplementation for 2 h, all the mussels were provided T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L). The seawater was renewed daily at the same time and DMSO, DHA, and new microalgae were added as mentioned above. All the digestive gland tissues were collected after 96 h of exposure to P. lima. For minimizing individual differences, the tissues of six mussel individuals from the same group were pooled as one sample. Each group contained three biological replicates.

4.3. Toxin Analysis

Extraction and detection of DSTs were performed as described previously [39]. Briefly, a 1.0 g wet sample was homogenized with 3 mL of methanol (HPLC grade). After repeated extraction, the collected supernatant (10 mL) was dried under nitrogen and subsequently dissolved in 1 mL methanol for analyzing the free form of DSTs. Regarding esterified DSTs, 0.5 mL of methanolic extract was subjected to alkaline hydrolysis using 0.1 mL of 1.25 M sodium hydroxide at 76 °C for 40 min, followed by the addition of 1.25 M of hydrochloric acid (0.1 mL) for neutralization. The concentrations of the esterified DSTs were calculated by subtracting the value of the free-form DSTs from that of the total DSTs.
Liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS, AB Sciex, Foster city, CA, USA) was performed on an AB Sciex equipped with a Turbospray ionization source QTRAP 4500 mass spectrometer (MS; AB Sciex Pte. Ltd., Singapore city, Singapore). A Poroshell 120 EC-C18 column (4.6 × 50 mm, 2.7 µm, Agilent Technologies, Wilmington, DE, USA) was used for separation of OA and DTX1 using a ternary mobile phase consisting of a 0.2% formic acid solution in water (solvent A), 100% acetonitrile (solvent B), and 10 mM ammonium acetate solution in water (solvent C). Multi-reaction monitoring mode (MRM) for negative ionization was used to detect OA and DTX1. As described in our previous study [42], the standards of OA (LC Laboratories, Woburn, MA, USA) and DTX1 (NRC, CAN), were diluted, and standard curves of chromatographic peak area (y) for OA and DTX1 against the toxin concentration (x) were established.

4.4. Analysis of Fatty Acids

Lipids were extracted from pre-lyophilized samples, and fatty acid composition was analyzed as fatty acid methyl esters using gas chromatography–mass spectrometry (GC-MS) [53]. N-nonadecyl ester (10 mg/mL) (purity ≥ 98, purchased from Macklin Biochemical Co., Ltd., Shanghai, China) was added as the internal standard. GC-MS/MS analysis was performed using an Agilent Technologies 7000C GC-MS with a HP-5MS column (30 m × 0.25 mm, 0.25 µm, Agilent Technologies). The column temperature was initially maintained at 65 °C for 3 min, and then increased at 10 °C/min to 165 °C, at 1 °C/min to 180 °C, at 15 °C/min to 270 °C, and at 285 °C for 3 min. The MS was performed in electron impact mode with a scan range of m/z 50–500 for the pseudo molecular ions at 70 eV.

4.5. RNA Extraction and Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

The total RNA was extracted using the total RNA kit I (50) (R6934-01, Omega, Norcross, GA, USA). A NanoDrop 2000/2000c spectrophotometer was used to evaluate the concentration of RNA (Implen, Munich, Germany). HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01, Vazyme, Nanjing, China) was used to reverse transcribe the cDNA from 1 µg total RNA. The PCR reaction mixture (20 µL) contained 0.2 µL of each primer, 2 µL of cDNA, 7.2 µL of ddH2O and 10 µL of AceQ® qPCR SYBR® Green Master Mix (Q111-03, Vazyme, Nanjing, China). PCR was performed using the CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA), and the PCR procedures were as follows: 95 °C for 30 s, 39 cycles of 95 °C for 10 s, and 60 °C for 30 s.
The genes encoding for ubiquitin A-52 (Uba52) and ribosomal protein L37 (Rpl37) were used as reference genes from among five genes, namely, those encoding elongation factor 1 alpha (Ef1α), ribosomal protein L3 (Rpl3), ribosomal protein L13-like (Rpl13), Uba52, and Rpl37. geNorm [54], NormFinder [55], and BestKepper [56] were used for analysis. The expression of Nrf2, Keap1, glutathione-S-transferases (Gst), glutathione reductase (Gr), superoxide dismutase (Sod), and glutathione peroxidase (Gpx) was evaluated using the normalized relative quantities (NRQ) formula [57]. All primers for qPCR were designed using Primer 6.0 (Table 1).

4.6. Detection of Oxidative Stress Biomarkers

The level of malondialdehyde (MDA) was measured using the lipid peroxidation MDA assay kit (Beyotime, Shanghai, China). SOD activity was measured using a commercial total SOD assay kit (NanJing JianCheng Bioengineering Institute, Nanjing, China). GR activity was measured using a commercial glutathione reductase (GR) assay kit (Beyotime) and GPx activity was detected using a commercial glutathione peroxidase (GPx) assay kit (Beyotime). The bicinchoninic acid protein assay kit (Beyotime) was used to determine protein content. All assays were performed according to the manufacturers’ instructions. A multi-mode microplate reader (Tecan Sunrise, Männedorf, Switzerland) was used to determine the absorbance in the experiments.

4.7. Histological Examination

Histological examination was performed as mentioned previously [52]. The digestive glands were carefully excised and immediately immersed in Boone’s fixative for at least 48 h. The paraffin-embedded tissues were sectioned at a 4 µm thickness using a manual rotary slicer (Leica RM2235, Lecia Microsystems Nussloch Gmbh, Heidelberger, Germany). After deparaffinization in xylene, rehydration using a gradient ethanol solution (100 % for 5 min, 90 % for 2 min, 70 % for 2 min), and subsequent staining with hematoxylin and eosin, the sections were sealed using neutral balsam. Finally, each stained slice was photographed using Pannoramic MIDI slide scanner (3DHISTECH, Budapest, Hungary) and analyzed using the Case-Viewer software (3DHISTECH, Budapest, Hungary). The scoring methods developed and modified by Bernet et al. (1999), Costa et al. (2013), and Joshyd et al. (2022) were used to assess the histopathological condition indices (HPI) in bivalves [49,58,59].

4.8. Statistical Analysis

All values were expressed as mean ± standard deviation (SD). Statistical analyses were performed using the SPSS Statistics 25.0 software (SPSS Inc., Chicago, IL, USA). The t-test and Welch’s t test were employed to determine the differences in mRNA level, fatty acid content, enzyme activity, and HPI between different groups. The difference in DSTs content between different groups was determined by one-way ANOVA followed by Duncan’s multiple range test with significant differences at p = 0.05.

5. Conclusions

In this study, we demonstrated the esterification of DSTs and found that the DHA content decreased significantly with DST esterification in the digestive gland of P. viridis after 96 h of exposure to P. lima. The addition of DHA significantly enhanced the esterification of DSTs and further increased the expression of Nrf2 signaling pathway-related genes and enzyme activity, ultimately alleviating the damage caused by DSTs. These results suggested that DHA may mitigate the toxic effects of DSTs by mediating the esterification of DSTs and activation of Nrf2 signaling pathway in P. viridis. Our findings provide new insights regarding the role of DHA against toxins in bivalves. However, how DHA activates the Nrf2 signaling pathway and promotes the esterification of DSTs in bivalves is still unclear and deserves further study.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/md21030155/s1, Figure S1: The morphology of Perna viridis in the experiment. Figure S2: Relative abundance (%) of fatty acids in Prorocentrum lima strain CCMP 2579.

Author Contributions

Conceptualization, W.-D.Y.; data curation, K.-K.Y.; formal analysis, K.-K.Y.; investigation, K.-K.Y.; methodology, Z.-M.C. and Y.-X.L.; project administration, H.-Y.L. and W.-D.Y.; supervision, W.-D.Y.; visualization, K.-K.Y.; writing—original draft, K.-K.Y.; writing—review and editing, H.-Y.L. and W.-D.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (42076143, 41776120).

Institutional Review Board Statement

Ethical review and approval were waived for this study, due to the lack of Institutional Review Board on bivalves.

Data Availability Statement

The data in this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Reguera, B.; Velo-Suárez, L.; Raine, R.; Park, M.G. Harmful Dinophysis species: A review. Harmful Algae 2012, 14, 87–106. [Google Scholar] [CrossRef]
  2. Chen, T.; Xu, X.; Wei, J.; Chen, J.; Miu, R.; Huang, L.; Zhou, X.; Fu, Y.; Yan, R.; Wang, Z.; et al. Food-borne disease outbreak of diarrhetic shellfish poisoning due to toxic mussel consumption: The first recorded outbreak in China. PLoS ONE 2013, 8, e65049. [Google Scholar] [CrossRef] [Green Version]
  3. Taylor, M.; McIntyre, L.; Ritson, M.; Stone, J.; Bronson, R.; Bitzikos, O.; Rourke, W.; Galanis, E.; Team, O. Outbreak of diarrhetic shellfish poisoning associated with mussels, British Columbia, Canada. Mar. Drugs 2013, 11, 1669–1676. [Google Scholar] [CrossRef] [Green Version]
  4. Sellner, K.G.; Doucette, G.J.; Kirkpatrick, G.J. H Harmful algal blooms: Causes, impacts and detection. J. Ind. Microbiol. Biotechnol. 2003, 30, 383–406. [Google Scholar] [CrossRef]
  5. Buratti, S.; Franzellitti, S.; Poletti, R.; Ceredi, A.; Montanari, G.; Capuzzo, A.; Fabbri, E. Bioaccumulation of algal toxins and changes in physiological parameters in Mediterranean mussels from the North Adriatic Sea (Italy). Environ. Toxicol. 2013, 28, 451–470. [Google Scholar] [CrossRef]
  6. Reguera, B.; Riobo, P.; Rodriguez, F.; Diaz, P.A.; Pizarro, G.; Paz, B.; Franco, J.M.; Blanco, J. Dinophysis toxins: Causative organisms, distribution and fate in shellfish. Mar. Drugs 2014, 12, 394–461. [Google Scholar] [CrossRef]
  7. Takai, A.; Murata, M.; Torigoe, K.; Isobe, M.; Mieskes, G.; Yasumoto, T. Inhibitory effect of okadaic acid derivatives on protein phosphatases. A study on structure-affinity relationship. Biochem. J. 1992, 284, 539–544. [Google Scholar] [CrossRef] [PubMed]
  8. European Food Safety Authority (EFSA). Opinion of the scientific panel on contaminants in the food chain on a request from the European Commission on marine biotoxins in shellfish–okadaic acid and analoguesn. EFSA J. 2008, 589, 1–62. [Google Scholar] [CrossRef]
  9. Valdiglesias, V.; Prego-Faraldo, M.V.; Pasaro, E.; Mendez, J.; Laffon, B. Okadaic acid: More than a diarrheic toxin. Mar. Drugs 2013, 11, 4328–4349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Kamat, P.K.; Rai, S.; Nath, C. Okadaic acid induced neurotoxicity: An emerging tool to study Alzheimer’s disease pathology. Neurotoxicology 2013, 37, 163–172. [Google Scholar] [CrossRef] [PubMed]
  11. Ma, J.; Li, J.; Hao, Y.; Nie, Y.; Li, Z.; Qian, M.; Liang, Q.; Yu, J.; Zeng, M.; Wu, K. Differentiated tumor immune microenvironment of Epstein–Barr virus-associated and negative gastric cancer: Implication in prognosis and immunotherapy. Oncotarget 2017, 8, 67094–67103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Svensson, S.; Särngren, A.; Förlin, L. Mussel blood cells, resistant to the cytotoxic effects of okadaic acid, do not express cell membrane p-glycoprotein activity (multixenobiotic resistance). Aquat. Toxicol. 2003, 65, 27–37. [Google Scholar] [CrossRef] [PubMed]
  13. Prado-Alvarez, M.; Florez-Barros, F.; Sexto-Iglesias, A.; Mendez, J.; Fernandez-Tajes, J. Effects of okadaic acid on haemocytes from Mytilus galloprovincialis: A comparison between field and laboratory studies. Mar. Environ. Res. 2012, 81, 90–93. [Google Scholar] [CrossRef] [PubMed]
  14. Prego-Faraldo, M.V.; Valdiglesias, V.; Laffon, B.; Mendez, J.; Eirin-Lopez, J.M. Early genotoxic and cytotoxic effects of the toxic dinoflagellate Prorocentrum lima in the mussel Mytilus galloprovincialis. Toxins 2016, 8, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Prado-Alvarez, M.; Florez-Barros, F.; Mendez, J.; Fernandez-Tajes, J. Effect of okadaic acid on carpet shell clam (Ruditapes decussatus) haemocytes by in vitro exposure and harmful algal bloom simulation assays. Cell Biol. Toxicol. 2013, 29, 189–197. [Google Scholar] [CrossRef] [PubMed]
  16. Blanco, J. Accumulation of dinophysis toxins in bivalve molluscs. Toxins 2018, 10, 453. [Google Scholar] [CrossRef] [Green Version]
  17. Yanagi, T.; Murata, M.; Torigoe, K.; Yasumoto, T. Biological activities of semisynthetic analogs of dinophysistoxin-3, the major diarrhetic shellfish toxin. Agric. Bioi. Chem. 1989, 53, 525–529. [Google Scholar] [CrossRef]
  18. Suzuki, T.; Ota, H.; Yamasaki, M. Direct evidence of transformation of dinophysistoxin-1 to 7-O-acyl-dinophysistoxin-1 (dinophysistoxin-3) in the scallop Patinopecten yessoensis. Toxicon 1999, 37, 187–198. [Google Scholar] [CrossRef]
  19. Rossignoli, A.E.; Fernandez, D.; Regueiro, J.; Marino, C.; Blanco, J. Esterification of okadaic acid in the mussel Mytilus galloprovincialis. Toxicon 2011, 57, 712–720. [Google Scholar] [CrossRef]
  20. Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
  21. Huang, L.; Wang, J.; Chen, W.-C.; Li, H.-Y.; Liu, J.-S.; Jiang, T.; Yang, W.-D. P-glycoprotein expression in Perna viridis after exposure to Prorocentrum lima, a dinoflagellate producing DSP toxins. Fish Shellfish Immunol. 2014, 39, 254–262. [Google Scholar] [CrossRef] [PubMed]
  22. Vidal, A.; Ruiz, Y.; Suárez, P.; Martinez, A.A.; Rossignoli, A.; Blanco, J.; Garcia, O.; San Juan, F. Accumulation of Okadaic Acid and Detoxifying Enzymes in the Digestive Gland of Mytilus galloprovincialis during exposure to DSP. In Molluscan Shellfish Safety; Springer: Berlin/Heidelberg, Germany, 2014; pp. 217–225. [Google Scholar] [CrossRef]
  23. Zou, Y.; Wei, X.M.; Weng, H.W.; Li, H.Y.; Liu, J.S.; Yang, W.D. Expression profile of eight glutathione S-transferase genes in Crassostrea ariakensis after exposure to DSP toxins producing dinoflagellate Prorocentrum lima. Toxicon 2015, 105, 45–55. [Google Scholar] [CrossRef] [PubMed]
  24. Chi, C.; Giri, S.S.; Jun, J.W.; Kim, S.W.; Kim, H.J.; Kang, J.W.; Park, S.C. Detoxification- and immune-related transcriptomic analysis of gills from bay scallops (Argopectenirradians) in response to algal toxin okadaic acid. Toxins 2018, 10, 308. [Google Scholar] [CrossRef] [Green Version]
  25. Lv, J.J.; Yuan, K.K.; Lu, M.Y.; He, Z.B.; Li, H.Y.; Yang, W.D. Responses of JNK signaling pathway to the toxic dinoflagellate Prorocentrum lima in the mussel Perna viridis. Ecotoxicol. Environ. Saf. 2021, 227, 112905. [Google Scholar] [CrossRef]
  26. Tan, K.; Ma, H.; Li, S.; Zheng, H. Bivalves as future source of sustainable natural omega-3 polyunsaturated fatty acids. Food Chem. 2020, 311, 125907. [Google Scholar] [CrossRef] [PubMed]
  27. Tan, K.; Zheng, H. Endogenous LC-PUFA biosynthesis capability in commercially important mollusks. Crit. Rev. Food Sci. Nutr. 2020, 62, 2836–2844. [Google Scholar] [CrossRef]
  28. Gao, L.; Wang, J.; Sekhar, K.R.; Yin, H.; Yared, N.F.; Schneider, S.N.; Sasi, S.; Dalton, T.P.; Anderson, M.E.; Chan, J.Y.; et al. Novel n-3 fatty acid oxidation products activate Nrf2 by destabilizing the association between Keap1 and Cullin3. J. Biol. Chem. 2007, 282, 2529–2537. [Google Scholar] [CrossRef] [Green Version]
  29. Hendriks, I.E.; van Duren, L.A.; Herman, P.M.J. Effect of dietary polyunsaturated fatty acids on reproductive output and larval growth of bivalves. J. Exp. Mar. Biol. Ecol. 2003, 296, 199–213. [Google Scholar] [CrossRef]
  30. Nevejan, N.; Saez, I.; Gajardo, G.; Sorgeloos, P. Supplementation of EPA and DHA emulsions to a Dunaliella tertiolecta diet: Effect on growth and lipid composition of scallop larvae, Argopecten purpuratus (Lamarck, 1819). Aquaculture 2003, 217, 613–632. [Google Scholar] [CrossRef]
  31. Sühnel, S.; Lagreze, F.; Zanette, G.; Magalhães, A.R.M.; Ferreira, J.F. Effect of the fatty acid EPA and DHA in the conditioning of the scallop Nodipecten nodosus (Linné, 1758). Aquaculture 2012, 330–333, 167–171. [Google Scholar] [CrossRef]
  32. Shahbazi, A.; Zakaria, M.P.; Yap, C.K.; Tan, S.G.; Surif, S.; Mohamed, C.A.R.; Sakari, M.; Bakhtiari, A.R.; Bahry, P.S.; Chandru, K.; et al. Use of different tissues of Perna viridis as biomonitors of polycyclic aromatic hydrocarbons (PAHs) in the coastal waters of Peninsular Malaysia. Environ. Forensics 2010, 11, 248–263. [Google Scholar] [CrossRef]
  33. Yap, C.K.; Shahbazi, A.; Zakaria, M.P. Concentrations of heavy metals (Cu, Cd, Zn and Ni) and PAHs in Perna viridis collected from seaport and non-seaport waters in the Straits of Johore. Bull. Environ. Contam. Toxicol. 2012, 89, 1205–1210. [Google Scholar] [CrossRef] [PubMed]
  34. Prego-Faraldo, M.V.; Martinez, L.; Mendez, J. RNA-Seq analysis for assessing the early response to DSP toxins in Mytilus galloprovincialis digestive gland and gill. Toxins 2018, 10, 417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. He, Z.B.; Duan, G.F.; Liang, C.Y.; Li, H.Y.; Liu, J.S.; Yang, W.D. Up-regulation of Nrf2-dependent antioxidant defenses in Perna viridis after exposed to Prorocentrum lima. Fish Shellfish Immunol. 2019, 90, 173–179. [Google Scholar] [CrossRef] [PubMed]
  36. Wei, X.M.; Lu, M.Y.; Duan, G.F.; Li, H.Y.; Liu, J.S.; Yang, W.D. Responses of CYP450 in the mussel Perna viridis after short-term exposure to the DSP toxins-producing dinoflagellate Prorocentrum lima. Ecotoxicol. Environ. Saf. 2019, 176, 178–185. [Google Scholar] [CrossRef] [PubMed]
  37. Dou, M.; Jiao, Y.H.; Zheng, J.W.; Zhang, G.; Li, H.Y.; Liu, J.S.; Yang, W.D. De novo transcriptome analysis of the mussel Perna viridis after exposure to the toxic dinoflagellate Prorocentrum lima. Ecotoxicol. Environ. Saf. 2020, 192, 110265. [Google Scholar] [CrossRef] [PubMed]
  38. Konoki, K.; Onoda, T.; Watanabe, R.; Cho, Y.; Kaga, S.; Suzuki, T.; Yotsu-Yamashita, M. In vitro acylation of okadaic acid in the presence of various bivalves’ extracts. Mar. Drugs 2013, 11, 300–315. [Google Scholar] [CrossRef] [Green Version]
  39. Qiu, J.; Ji, Y.; Fang, Y.; Zhao, M.; Wang, S.; Ai, Q.; Li, A. Response of fatty acids and lipid metabolism enzymes during accumulation, depuration and esterification of diarrhetic shellfish toxins in mussels (Mytilus galloprovincialis). Ecotoxicol. Environ. Saf. 2020, 206, 111223. [Google Scholar] [CrossRef]
  40. Blanco, J.; Arevalo, F.; Correa, J.; Morono, A. Lipophilic toxins in Galicia (NW Spain) between 2014 and 2017: Incidence on the main molluscan species and analysis of the monitoring efficiency. Toxins 2019, 11, 612. [Google Scholar] [CrossRef] [Green Version]
  41. Vale, P. Detailed profiles of 7-O-acyl esters in plankton and shellfish from the Portuguese coast. J. Chromatogr. A 2006, 1128, 181–188. [Google Scholar] [CrossRef]
  42. Lv, J.J.; Yuan, K.K.; Lu, G.X.; Li, H.Y.; Kwok, H.F.; Yang, W.D. Responses of ABCB and ABCC transporters to the toxic dinoflagellate Prorocentrum lima in the mussel Perna viridis. Aquat. Toxicol. 2022, 254, 106368. [Google Scholar] [CrossRef] [PubMed]
  43. Tan, K.; Zhang, H.; Li, S.; Ma, H.; Zheng, H. Lipid nutritional quality of marine and freshwater bivalves and their aquaculture potential. Crit. Rev. Food Sci. Nutr. 2021, 62, 6990–7014. [Google Scholar] [CrossRef] [PubMed]
  44. Knauer, J.; Southgate, P.C. Growth and fatty acid composition of Pacific oyster (Crassostrea gigas) spat fed a microalga and microcapsules containing varying amounts of eicosapentaenoic and docosahexaenoic acid. J. Shellfish Res. 1997, 16, 447–454. [Google Scholar]
  45. Prasad, P.; Anjali, P.; Sreedhar, R.V. Plant-based stearidonic acid as sustainable source of omega-3 fatty acid with functional outcomes on human health. Crit. Rev. Food Sci. Nutr. 2021, 61, 1725–1737. [Google Scholar] [CrossRef]
  46. Pes, K.; Friese, A.; Cox, C.J.; Laizé, V.; Fernández, I. Biochemical and molecular responses of the Mediterranean mussel (Mytilus galloprovincialis) to short-term exposure to three commonly prescribed drugs. Mar. Environ. Res. 2021, 168, 105309. [Google Scholar] [CrossRef] [PubMed]
  47. Li, G.; Li, Y.; Xiao, B.; Cui, D.; Lin, Y.; Zeng, J.; Li, J.; Cao, M.-J.; Liu, J. Antioxidant activity of docosahexaenoic acid (DHA) and its regulatory roles in mitochondria. J. Agric. Food Chem. 2021, 69, 1647–1655. [Google Scholar] [CrossRef]
  48. Magalhães, R.; Martins, N.; Fontinha, F.; Couto, A.; Serra, C.R.; Santos, R.A.; Olsen, R.E.; Peres, H.; Oliva-Teles, A. Effects of dietary ARA, DHA, and carbohydrates levels on gilthead sea bream liver and intestine oxidative stress, tissue histomorphology, and gut microbiota. Aquaculture 2022, 552, 738014. [Google Scholar] [CrossRef]
  49. Costa, P.M.; Carreira, S.; Costa, M.H.; Caeiro, S. Development of histopathological indices in a commercial marine bivalve (Ruditapes decussatus) to determine environmental quality. Aquat. Toxicol. 2013, 126, 442–454. [Google Scholar] [CrossRef]
  50. De Jesús Romero-Geraldo, R.; Garcia-Lagunas, N.; Hernandez-Saavedra, N.Y. Crassostrea gigas exposure to the dinoflagellate Prorocentrum lima: Histological and gene expression effects on the digestive gland. Mar. Environ. Res. 2016, 120, 93–102. [Google Scholar] [CrossRef]
  51. Neves, R.A.F.; Santiago, T.C.; Carvalho, W.F.; Silva, E.D.S.; da Silva, P.M.; Nascimento, S.M. Impacts of the toxic benthic dinoflagellate Prorocentrum lima on the brown mussel Perna perna: Shell-valve closure response, immunology, and histopathology. Mar. Environ. Res. 2019, 146, 35–45. [Google Scholar] [CrossRef]
  52. Ye, M.H.; Li, D.W.; Cai, Q.D.; Jiao, Y.H.; Liu, Y.; Li, H.Y.; Yang, W.D. Toxic responses of different shellfish species after exposure to Prorocentrum lima, a DSP toxins producing dinoflagellate. Toxins 2022, 14, 461. [Google Scholar] [CrossRef]
  53. Li, D.W.; Cen, S.Y.; Liu, Y.H.; Balamurugan, S.; Zheng, X.Y.; Alimujiang, A.; Yang, W.D.; Liu, J.S.; Li, H.Y. A type 2 diacylglycerol acyltransferase accelerates the triacylglycerol biosynthesis in heterokont oleaginous microalga Nannochloropsis oceanica. J. Biotechnol. 2016, 229, 65–71. [Google Scholar] [CrossRef]
  54. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [Green Version]
  55. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Green Version]
  56. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  57. Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Green Version]
  58. Bernet, D.; Schmidt, H.; Meier, W.; Burkhardt-Holm, P.; Wahli, T. Histopathology in fish: Proposal for a protocol to assess aquatic pollution. J. Fish Dis. 1999, 22, 25–34. [Google Scholar] [CrossRef] [Green Version]
  59. Joshy, A.; Sharma, S.R.K.; Mini, K.G.; Gangadharan, S.; Pranav, P. Histopathological evaluation of bivalves from the southwest coast of India as an indicator of environmental quality. Aquat. Toxicol. 2022, 243, 106076. [Google Scholar] [CrossRef]
Marinedrugs 21 00155 g001 550
Figure 1. Accumulation of OA and DTX1 in the digestive gland of the mussel P. viridis after exposure to P. lima (in ng/g wet weight). (A) OA. (B) DTX1. Control, fed with T. subcordiformis (1 × 107 cells/L); P. lima, fed with T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L). Data are presented as mean ± SD (n = 3). Different letters indicate significant differences (Duncan’s t-test, p < 0.05).
Figure 1. Accumulation of OA and DTX1 in the digestive gland of the mussel P. viridis after exposure to P. lima (in ng/g wet weight). (A) OA. (B) DTX1. Control, fed with T. subcordiformis (1 × 107 cells/L); P. lima, fed with T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L). Data are presented as mean ± SD (n = 3). Different letters indicate significant differences (Duncan’s t-test, p < 0.05).
Marinedrugs 21 00155 g001
Marinedrugs 21 00155 g002 550
Figure 2. Fatty acid concentration (in mg/g dry weight) in the digestive gland of the P. lima-exposed mussels at 6 h (A) and 96 h (B). SFA, MUFA, and PUFA represent saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids, respectively. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05. **p < 0.01).
Figure 2. Fatty acid concentration (in mg/g dry weight) in the digestive gland of the P. lima-exposed mussels at 6 h (A) and 96 h (B). SFA, MUFA, and PUFA represent saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids, respectively. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05. **p < 0.01).
Marinedrugs 21 00155 g002
Marinedrugs 21 00155 g003 550
Figure 3. Changes in gene expression, antioxidant enzyme activity and MDA level in the digestive gland of the mussel P. viridis after exposure to P. lima. (A) Nrf2 expression. (B) Keap1 expression. (C) Gst expression. (D) Gr expression. (E) Gpx expression. (F) Sod expression. (G) GR activity. (H) GPx activity. (I) SOD activity. (J) MDA level. Control, fed with T. subcordiformis (1 × 107 cells/L); P. lima, fed with T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L); Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05, ** p < 0.01, ns represents non-significance).
Figure 3. Changes in gene expression, antioxidant enzyme activity and MDA level in the digestive gland of the mussel P. viridis after exposure to P. lima. (A) Nrf2 expression. (B) Keap1 expression. (C) Gst expression. (D) Gr expression. (E) Gpx expression. (F) Sod expression. (G) GR activity. (H) GPx activity. (I) SOD activity. (J) MDA level. Control, fed with T. subcordiformis (1 × 107 cells/L); P. lima, fed with T. subcordiformis (1 × 107 cells/L) and P. lima (2 × 106 cells/L); Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05, ** p < 0.01, ns represents non-significance).
Marinedrugs 21 00155 g003
Marinedrugs 21 00155 g004 550
Figure 4. Changes in esterification level of DSTs after addition of DHA. (A) Contents of OA. (B) Contents of DTX1. (C) Esterification ratio of DSTs (%). (D) The total content of DSTs. Data are presented as mean ± SD (n = 3). Different letters indicate significant differences (Duncan’s t-test, p < 0.05).
Figure 4. Changes in esterification level of DSTs after addition of DHA. (A) Contents of OA. (B) Contents of DTX1. (C) Esterification ratio of DSTs (%). (D) The total content of DSTs. Data are presented as mean ± SD (n = 3). Different letters indicate significant differences (Duncan’s t-test, p < 0.05).
Marinedrugs 21 00155 g004
Marinedrugs 21 00155 g005 550
Figure 5. Histological sections of digestive glands of P. viridis (HE staining). (A) Digestive glands of the P. lima-exposed mussels after the addition of DMSO. Digestive tubules (dt) were composed by a single layer of orderly arranged ciliated eosinophilic epithelial cells (ec). Note the thinned epithelial cell (ec) layer and dilated tubular lumen (tl) during the disintegrating phase of the regressing tubule (rt), which is characterized by “shedding” of the epithelial cells into the tubule lumen (tl) and degradation. There was extensive hemocyte infiltration (hm) in the damaged diverticulum, lipofuscin aggregates (If) near the damaged tubules, and necrotic (nt) in some tubules. Scale bars: 50 μm. (B) Digestive glands of the P. lima-exposed mussels after the addition of DHA (10 µM). Regressing tubules (rt) may be in the reconstituting phase, with widened epithelial cell (ec) layer and narrow or almost occlusive tubule lumen (tl). There was limited hemocyte infiltration (hm) in the damaged diverticulum. Scale bars: 50 μm. (C) Histopathological condition indices of the P. lima-exposed mussels after the addition of 10 µM DHA. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, **p < 0.01, ns represents non-significance).
Figure 5. Histological sections of digestive glands of P. viridis (HE staining). (A) Digestive glands of the P. lima-exposed mussels after the addition of DMSO. Digestive tubules (dt) were composed by a single layer of orderly arranged ciliated eosinophilic epithelial cells (ec). Note the thinned epithelial cell (ec) layer and dilated tubular lumen (tl) during the disintegrating phase of the regressing tubule (rt), which is characterized by “shedding” of the epithelial cells into the tubule lumen (tl) and degradation. There was extensive hemocyte infiltration (hm) in the damaged diverticulum, lipofuscin aggregates (If) near the damaged tubules, and necrotic (nt) in some tubules. Scale bars: 50 μm. (B) Digestive glands of the P. lima-exposed mussels after the addition of DHA (10 µM). Regressing tubules (rt) may be in the reconstituting phase, with widened epithelial cell (ec) layer and narrow or almost occlusive tubule lumen (tl). There was limited hemocyte infiltration (hm) in the damaged diverticulum. Scale bars: 50 μm. (C) Histopathological condition indices of the P. lima-exposed mussels after the addition of 10 µM DHA. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, **p < 0.01, ns represents non-significance).
Marinedrugs 21 00155 g005
Marinedrugs 21 00155 g006 550
Figure 6. Changes in gene expression, antioxidant enzyme activity and MDA level in the digestive gland of the P. lima-exposed mussels after the addition of 10 µM DHA. (A) Alterations in expression of Nrf2, Keap1, Gst, Gr, Gpx, and Sod revealed by RT-qPCR. (B) Activities of GR, GPx, and SOD. (C) MDA level. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05, ** p < 0.01).
Figure 6. Changes in gene expression, antioxidant enzyme activity and MDA level in the digestive gland of the P. lima-exposed mussels after the addition of 10 µM DHA. (A) Alterations in expression of Nrf2, Keap1, Gst, Gr, Gpx, and Sod revealed by RT-qPCR. (B) Activities of GR, GPx, and SOD. (C) MDA level. Data are presented as mean ± SD (n = 3). Significant differences compared to control are represented by asterisks (t-test, * p < 0.05, ** p < 0.01).
Marinedrugs 21 00155 g006
Marinedrugs 21 00155 g007 550
Figure 7. Experimental design. (Part I): Response of P. viridis to exposure of P. lima; (Part II): Effect of DHA in alleviating the toxicity of DSTs in P. viridis.
Figure 7. Experimental design. (Part I): Response of P. viridis to exposure of P. lima; (Part II): Effect of DHA in alleviating the toxicity of DSTs in P. viridis.
Marinedrugs 21 00155 g007
Table
Table 1. Primer for qPCR.
Table 1. Primer for qPCR.
Gene NamePrimer Sequence (5′-3′)Amplicon Size (bp)
Ef1αF:CACTCCGTCTTCCACTCCA131
R:CCTCTGGCATTGACTCGTG
Rpl3F:GGTGGCACTATCTCCCAGAA98
R:GCCATCTGGACGTTACACCT
Uba52F:TTACATTTGGTCCTGCGTCTC135
R:CAGTTGGTAGCCCTTTGATGA
Rpl13F:TAAAGACTGGCAACGCTATGT155
R:TCACAACTGGTCGGAGAAG
Rpl37F:GTCGCAATAAGACGCACACGTTG179
R:GTGCCTCATTCGACCAGTTCCG
Nrf2F:TCAACCTGGACAGGAACCCA90
R:TATCGCGACAGTGTGGACCT
Keap1F:TATCGCTCCAATGAACACGG173
R:AAGCACTTCTGGGGCTACGC
GstF:GTTGGCTCGAAATTAAGTATGGC108
R:AAACTCCTCCAGTATTTTCTGGTCT
GrF:TTACTCCAGTTGCCATAGCAGCAG113
R:TGGATGTGAGAACACCACAGTAGC
GpxF:CAACGACCCCCAGATTCAGA80
R:TCTAGAGTCGGTAGGAGCCAT
SodF:GCAACATTCCTTCAGCACCT154
R:CCTTGTTCCAAAAGCCTAATTG
Ef1α, Elongation factor 1 alpha; Rpl3, Ribosomal protein L3; Rpl13, Ribosomal protein L13-like; Rpl37, Ribosomal protein L37; Uba52, Ubiquitin A-52; Nrf2, Nuclear factor erythroid 2-related factor 2; Keap1, Kelch-like ECH-associated protein-1; Gst, Glutathione S-transferase; Gpx, Glutathione peroxidase; Gr, Glutathione reductase; Sod, Superoxide dismutase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, K.-K.; Chen, Z.-M.; Liu, Y.-X.; Li, H.-Y.; Yang, W.-D. Possible Role of Docosahexaenoic Acid in Response to Diarrhetic Shellfish Toxins in the Mussel Perna viridis. Mar. Drugs 2023, 21, 155. https://doi.org/10.3390/md21030155

AMA Style

Yuan K-K, Chen Z-M, Liu Y-X, Li H-Y, Yang W-D. Possible Role of Docosahexaenoic Acid in Response to Diarrhetic Shellfish Toxins in the Mussel Perna viridis. Marine Drugs. 2023; 21(3):155. https://doi.org/10.3390/md21030155

Chicago/Turabian Style

Yuan, Kuan-Kuan, Zi-Min Chen, Ya-Xin Liu, Hong-Ye Li, and Wei-Dong Yang. 2023. "Possible Role of Docosahexaenoic Acid in Response to Diarrhetic Shellfish Toxins in the Mussel Perna viridis" Marine Drugs 21, no. 3: 155. https://doi.org/10.3390/md21030155

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop