Heme Oxygenase-1 Is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane
Abstract
:1. Introduction
2. Result
2.1. Expression Profile of HO-1 after Knock-Down
2.2. Determination of Antioxidative Parameters
2.3. Expression of Antioxidant-Related Genes
2.4. Expression of Apoptosis- and Autophagy-Related Genes
2.5. Hepatopancreatic Histology
2.6. Detection of Hepatopancreatic Apoptosis
3. Materials and Methods
3.1. OFO and Experimental Diets
3.2. Construction of an Oxidative Stress Model
3.3. RNAi Assay
3.4. Sample Collection
3.5. Histological Analysis
3.6. TUNEL Apoptosis Detection
3.7. Measurement of Biochemical Parameters
3.8. Determination of mRNA Expression
3.9. Statistical Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Yang, S.; Luo, J.; Huang, Y.; Yuan, Y.; Cai, S. Effect of sub-lethal ammonia and nitrite stress on autophagy and apoptosis in hepatopancreas of Pacific whiteleg shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2022, 130, 72–78. [Google Scholar] [CrossRef]
- Gao, W.; Tian, L.; Huang, T.; Yao, M.; Xu, Q.; Guo, T.L. Molecular cloning and expression of the calreticulin gene of the Pacific white shrimp, Litopenaeus vannamei, in response to acute hypo-osmotic stress. Aquaculture 2016, 454, 265–271. [Google Scholar] [CrossRef]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxidative Med. Cell. Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef]
- Liu, K.; Liu, H.; Chi, S.; Dong, X.; Yang, Q.; Tan, B. Effects of different dietary lipid sources on growth performance, body composition and lipid metabolism-related enzymes and genes of juvenile golden pompano. Trachinotus ovatus. Aquac. Res. 2018, 49, 717–725. [Google Scholar] [CrossRef]
- Yin, P.; Xie, S.; Liu, Z.; Huo, Y.; Guo, T.; Fang, H.; Zhang, Y.; Liu, Y.; Niu, J.; Tian, L. Effects of dietary oxidized fish oil on growth performance, antioxidant defense system, apoptosis and mitochondrial function of juvenile largemouth bass (Micropterus salmoides). Aquaculture 2018, 500, 347–358. [Google Scholar] [CrossRef]
- Řehulka, J. Effect of hydrolytically changed and oxidized fat in dry pellets on the health of rainbow trout, Oncorhynchus mykiss (Richardson). Aquac. Res. 1990, 21, 419–434. [Google Scholar] [CrossRef]
- Xie, J.; He, X.; Fang, H.; Liao, S.; Liu, Y.; Tian, L.; Niu, J. Identification of heme oxygenase-1 from golden pompano (Trachinotus ovatus) and response of Nrf2/HO-1 signaling pathway to copper-induced oxidative stress. Chemosphere 2020, 253, 126654. [Google Scholar] [CrossRef]
- Dulak, J.; Deshane, J.; Jozkowicz, A.; Agarwal, A. Heme oxygenase-1 and carbon monoxide in vascular pathobiology: Focus on angiogenesis. Circulation 2008, 117, 231–241. [Google Scholar] [CrossRef]
- Agarwal, A.; Nick, H.S. Renal response to tissue injury: Lessons from heme oxygenase-1 GeneAblation and expression. J. Am. Soc. Nephrol. JASN 2000, 11, 965–973. [Google Scholar] [CrossRef]
- Wiesel, P.; Patel, A.P.; DiFonzo, N.; Marria, P.B.; Sim, C.U.; Pellacani, A.; Maemura, K.; LeBlanc, B.W.; Marino, K.; Doerschuk, C.M.; et al. Endotoxin-induced mortality is related to increased oxidative stress and end-organ dysfunction, not refractory hypotension, in heme oxygenase-1-deficient mice. Circulation 2000, 102, 3015–3022. [Google Scholar] [CrossRef]
- Tzaneva, V.; Perry, S.F. Heme oxygenase-1 (HO-1) mediated respiratory responses to hypoxia in the goldfish, Carassius auratus. Respir. Physiol. Neurobiol. 2014, 199, 1–8. [Google Scholar] [CrossRef]
- Akbari, E.; Namazian, M. Sulforaphane: A natural product against reactive oxygen species. Comput. Theor. Chem. 2020, 1183, 112850. [Google Scholar] [CrossRef]
- Tang, L.; Ren, X.; Han, Y.; Chen, L.; Meng, X.; Zhang, C.; Chu, H.; Kong, L.; Ma, H. Sulforaphane attenuates apoptosis of hippocampal neurons induced by high glucose via regulating endoplasmic reticulum. Neurochem. Int. 2020, 136, 104728. [Google Scholar] [CrossRef]
- Yang, S.; Huang, Y.; Chen, B.; Liu, H.; Huang, Y.; Cai, S.; Jian, J. Protective effects of sulphoraphane on oxidative damage caused by ammonia in Litopenaeus vannamei. Aquac. Res. 2021, 53, 1197–1204. [Google Scholar] [CrossRef]
- Peng, N.; Jin, L.; He, A.; Deng, C.; Wang, X. Effect of sulphoraphane on newborn mouse cardiomyocytes undergoing ischaemia/reperfusion injury. Pharm. Biol. 2019, 57, 753–759. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, J.; Yang, C.; Dong, B.; Fu, Y.; Wang, Y.; Gong, M.; Liu, T.; Qiu, P.; Xie, W.; et al. Sulforaphane attenuates microglia-mediated neuronal damage by down-regulating the ROS/autophagy/NLRP3 signal axis in fibrillar Aβ-activated microglia. Brain Res. 2023, 1801, 148206. [Google Scholar] [CrossRef]
- Yang, S.P.; Liu, H.L.; Wang, C.G.; Yang, P.; Sun, C.B.; Chan, S.M. Effect of oxidized fish oil on growth performance and oxidative stress of Litopenaeus vannamei. Aquac. Nutr. 2015, 21, 121–127. [Google Scholar] [CrossRef]
- Huang, Y.; Li, Q.; Yang, S.; Yuan, Y.; Zhang, Z.; Jiang, B.; Lv, J.; Zhong, J.; Jian, J. Identification and Characterization of Heme Oxygenase-1 from Litopenaeus vannamei Involved in Antioxidant and Anti-Apoptosis under Ammonia Stress. Fishes 2022, 7, 356. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Fontagné-Dicharry, S.; Lataillade, E.; Surget, A.; Larroquet, L.; Cluzeaud, M.; Kaushik, S. Antioxidant defense system is altered by dietary oxidized lipid in first-feeding rainbow trout (Oncorhynchus mykiss). Aquaculture 2014, 424–425, 220–227. [Google Scholar] [CrossRef]
- Tocher, D.R.; Mourente, G.; Eecken, A.V.d.; Evjemo, J.O.; Diaz, E.; Wille, M.; Bell, J.G.; Olsen, Y. Comparative study of antioxidant defence mechanisms in marine fish fed variable levels of oxidised oil and vitamin E. Aquac. Int. 2003, 11, 195–216. [Google Scholar] [CrossRef]
- Chen, S.; Zhuang, Z.; Yin, P.; Chen, X.; Zhang, Y.; Tian, L.; Niu, J.; Liu, Y. Changes in growth performance, haematological parameters, hepatopancreas histopathology and antioxidant status of pacific white shrimp (Litopenaeus vannamei) fed oxidized fish oil: Regulation by dietary myo-inositol. Fish Shellfish Immunol. 2019, 88, 53–64. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Holmgren, A. Thioredoxin system in cell death progression. Antioxid. Redox Signal. 2012, 17, 1738–1747. [Google Scholar] [CrossRef] [PubMed]
- Tsipis, A.; Athanassiadou, M.A.; Agrogiannis, G.; Athanassiadou, P.; Athanassopoulos, G.; Kavantzas, N. Hypoxia-inducible factors HIF1-α and HSP70 and the response to hypoxic stress in myocardial ischemia. J. Mol. Cell. Cardiol. 2022, 173, 68. [Google Scholar] [CrossRef]
- Ma, C.; Guo, Z.; Zhang, F.; Su, J. Molecular identification, expression and function analysis of peroxidasin in Chilo suppressalis. Insect Sci. 2019, 27, 1173–1185. [Google Scholar] [CrossRef]
- Zhu, Z.; Wilson, A.T.; Mathahs, M.M.; Wen, F.; Brown, K.E.; Luxon, B.A.; Schmidt, W.N. Heme oxygenase-1 suppresses hepatitis C virus replication and increases resistance of hepatocytes to oxidant injury. Hepatology 2008, 48, 1430–1439. [Google Scholar] [CrossRef]
- Farag, M.R.; Elhady, W.M.; Ahmed, S.Y.A.; Taha, H.S.A.; Alagawany, M. Astragalus polysaccharides alleviate tilmicosin-induced toxicity in rats by inhibiting oxidative damage and modulating the expressions of HSP70, NF-kB and Nrf2/HO-1 pathway. Res. Vet. Sci. 2019, 124, 137–148. [Google Scholar] [CrossRef]
- Luo, J.; Chen, Y.; Huang, Y.; Feng, J.; Yuan, Y.; Jian, J.; Cai, S.; Yang, S. A novel C-type lectin for Litopenaeus vannamei involved in the innate immune response against Vibrio infection. Fish Shellfish Immunol. 2023, 135, 108621. [Google Scholar] [CrossRef]
- Sun, M.-S.; Jin, H.; Sun, X.; Huang, S.; Zhang, F.-L.; Guo, Z.-N.; Yang, Y. Free Radical Damage in Ischemia-Reperfusion Injury: An Obstacle in Acute Ischemic Stroke after Revascularization Therapy. Oxidative Med. Cell. Longev. 2018, 2018, 3804979. [Google Scholar] [CrossRef]
- Abaquita, L.T.A.; Damulewicz, M.; Tylko, G.; Pyza, E. The dual role of heme oxygenase in regulating apoptosis in the nervous system of Drosophila melanogaster. Front. Physiol. 2023, 14, 1060175. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, K.; Li, C.; Li, L.; Wang, G. Heme oxygenase 1 regulates apoptosis induced by heat stress in bovine ovarian granulosa cells via the ERK1/2 pathway. J. Cell. Physiol. 2019, 234, 3961–3972. [Google Scholar] [CrossRef]
- Zhang, H.; Zhou, X.; Wong, M.H.Y.; Man, K.Y.; Pin, W.K.; Yeung, J.H.K.; Kwan, Y.W.; Leung, G.P.H.; Hoi, P.M.; Lee, S.M.Y.; et al. Sichuan pepper attenuates H2O2-induced apoptosis via antioxidant activity and up-regulating heme oxygenase-1 gene expression in primary rat hepatocytes. J. Food Biochem. 2017, 41, e12403. [Google Scholar] [CrossRef]
- Wu, B.; Teng, D.; Sun, X.; Li, J.; Li, J.; Zhang, G.; Cai, J. Cobalt-protoporphyrin enhances heme oxygenase 1 expression and attenuates liver ischemia/reperfusion injury by inhibiting apoptosis. Mol. Med. Rep. 2018, 17, 4567–4572. [Google Scholar] [CrossRef]
- Engedal, N.; Proikas-Cezanne, T.C.; Albertini, M.; Žerovnik, E.; Lane, J. Transautophagy: Research and Translation of Autophagy Knowledge 2020. Oxidative Med. Cell. Longev. 2022, 2022, 9792132. [Google Scholar] [CrossRef] [PubMed]
- Surolia, R.; Karki, S.; Kim, H.; Yu, Z.; Kulkarni, T.; Mirov, S.B.; Carter, A.B.; Rowe, S.M.; Matalon, S.; Thannickal, V.J.; et al. Heme oxygenase-1-mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 2015, 309, L280–L292. [Google Scholar] [CrossRef]
- Meng, X.; Yuan, Y.; Shen, F.; Li, C. Heme oxygenase-1 ameliorates hypoxia/reoxygenation via suppressing apoptosis and enhancing autophagy and cell proliferation though Sirt3 signaling pathway in H9c2 cells. Naunyn-Schmiedeberg's Arch. Pharmacol. 2019, 392, 189–198. [Google Scholar] [CrossRef]
- Bautista, M.N.; Lavilla-Pitogo, C.R.; Subosa, P.F.; Begino, E.T. Aflatoxin B1 contamination of shrimp feeds and its effect on growth and hepatopancreas of pre-adult Penaeus monodon. J. Sci. Food Agric. 1994, 65, 5–11. [Google Scholar] [CrossRef]
- Yu, Y.; Liu, Y.; Yin, P.; Zhou, W.; Tian, L.; Liu, Y.; Xu, D.; Niu, J. Astaxanthin Attenuates Fish Oil-Related Hepatotoxicity and Oxidative Insult in Juvenile Pacific White Shrimp (Litopenaeus vannamei). Mar. Drugs 2020, 18, 218. [Google Scholar] [CrossRef]
- Lee, D.-S.; Ko, W.; Song, B.-K.; Son, I.; Kim, D.-W.; Kang, D.-G.; Lee, H.-S.; Oh, H.; Jang, J.-H.; Kim, Y.-C.; et al. The herbal extract KCHO-1 exerts a neuroprotective effect by ameliorating oxidative stress via heme oxygenase-1 upregulation. Mol. Med. Rep. 2016, 13, 4911–4919. [Google Scholar] [CrossRef]








| Primer Name | Sequence (5′–3′) | GenBank Accession Number | Product Length |
|---|---|---|---|
| qHO-1-F | GCATGGCAGTGACCGAGATTGA | XM_027376282.1 | 108 |
| qHO-1-R | GTCGCTGCTTCGTCTCCTCATC | ||
| qCAT-F | TCAGCGTTTGGTGGAGAA | AY518322.1 | 147 |
| qCAT-R | GCCTGGCTCATCTTTATC | ||
| qNrf2-F | GATGAGAAGCGAGCCAGAGCG | XM_027367068.1 | 142 |
| qNrf2-R | GCCGTCGGATGTCTCGGATAA | ||
| qHSP70-F | GCGTACTGCCTGTGAGCG | AY645906 | 108 |
| qHSP70-R | CGGGTGATGGAGGTGTAGAAA | ||
| qGST-F | AAGATAACGCAGAGCAAGG | AY573381.2 | 146 |
| qGST-R | TCGTAGGTGACGGTAAAGA | ||
| qGPX-F | AGGGACTTCCACCAGATG | XM_027372127.1 | 117 |
| qGPX-R | CAACAACTCCCCTTCGGTA | ||
| qSOD-F | CTGGTTCCGTTGCTTGGC | DQ005531 | 122 |
| qSOD-R | CGCTCATTCACGTTCTCCC | ||
| qTrx-F | TTAACGAGGCTGGAAACA | XM_027377405.1 | 116 |
| qTrx-R | AACGACATCGCTCATAGA | ||
| qHIF-1α-F | GGAGGCCTACAAGACACTGC | FJ807918.1 | 152 |
| qHIF-1α-R | TGAGACACACGACGTACTGC | ||
| qprx2-F | AATGACCGCGTTGAGGAGTT | XM_027353910.1 | 134 |
| qprx2-R | AGTGGGATCTTCAGCTTGCC | ||
| qATG3-F | CGCTGCCAAGACCAAACCATA | MH797018.1 | 105 |
| qATG3-R | TGCTCACTGCGATACTCCATT | ||
| qATG5-F | GGAACCTCACTGCCCACTTT | MH797023.1 | 127 |
| qATG5-R | TGCCCTCTGTGCTTCAAACC | ||
| qcaspase2-F | TAAAGTTCCCTCACGACAA | XM_027358707.1 | 278 |
| qcaspase2-R | GCTCATCACCATCCCTAAT | ||
| qcaspase3-F | AACCAAGGCATCCCTGTCA | XM_027378310.1 | 190 |
| qcaspase3-R | GGGTTTATTCTGAAGTTGTGGG | ||
| qEF1α-F | GTATTGGAACAGTGCCCGTG | XM_027373349.1 | 143 |
| qEF1α-R | ACCAGGGACAGCCTCAGTAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, J.; Huang, Y.; Chen, Y.; Yuan, Y.; Li, G.; Cai, S.; Jian, J.; Yang, S. Heme Oxygenase-1 Is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane. Mar. Drugs 2023, 21, 548. https://doi.org/10.3390/md21100548
Luo J, Huang Y, Chen Y, Yuan Y, Li G, Cai S, Jian J, Yang S. Heme Oxygenase-1 Is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane. Marine Drugs. 2023; 21(10):548. https://doi.org/10.3390/md21100548
Chicago/Turabian StyleLuo, Junliang, Yongxiong Huang, Yanghui Chen, Yunhao Yuan, Guojian Li, Shuanghu Cai, Jichang Jian, and Shiping Yang. 2023. "Heme Oxygenase-1 Is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane" Marine Drugs 21, no. 10: 548. https://doi.org/10.3390/md21100548
APA StyleLuo, J., Huang, Y., Chen, Y., Yuan, Y., Li, G., Cai, S., Jian, J., & Yang, S. (2023). Heme Oxygenase-1 Is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane. Marine Drugs, 21(10), 548. https://doi.org/10.3390/md21100548
