Enhancement and Mechanism of Ergosterol Biosynthesis in Termite Ball Fungus Athelia termitophila by Methyl Jasmonate
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Strains and Media Formulation
2.2. Prepare the Liquid Strain and Revitalize the Strain
2.3. TMB Mycelium Collection and Biomass Determination
2.4. Mycelial Ergosterol Extraction and Determination and Analysis
2.5. Effect of Different Concentrations of MJ and SA on Ergosterol-Producing Synthesis by TMB
2.6. Effect of Various Co-Solvents on Ergosterol Levels in TMB After Dissolving MJ
2.7. Effect of Different Addition Times on the Ergosterol Content of TMB
2.8. Impact of Induction Time Variation on the Ergosterol Content of TMB
2.9. Measurement of Gene Transcription Levels by qRT-PCR
2.10. Organization and Analysis of Data
3. Results
3.1. Effects of Varying Inducer Concentrations on TMB’s Ergosterol Components and Mycelium Biomass
3.2. Effect of MJ Solubilization by Different Solvents on Mycelial Growth and Ergosterol
3.3. Effects of Different Incubation Times on Mycelial Growth and Ergosterol Compound Content of TMB
3.4. Effect of MJ Addition at Different Times on Ergosterol Composition During Fermentation of TMB
3.5. Expression of Related Genes Under Different Concentrations of MJ Treatments
3.6. Analysis of Ergosterol Content and Gene Correlation Under MJ Treatment
3.7. Effect of Key Genes and Time Dynamics Under MJ Treatment Conditions
3.8. Clustered Expression Analysis of Genes Related to Different Periods in Response to MJ
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kurowska, M.M.; Daszkowska-Golec, A.; Gajecka, M.; Kościelniak, P.; Bierza, W.; Szarejko, I. Methyl Jasmonate Affects Photosynthesis Efficiency, Expression of HvTIP Genes and Nitrogen Homeostasis in Barley. Int. J. Mol. Sci. 2020, 21, 4335. [Google Scholar] [CrossRef] [PubMed]
- Matsuura, K. Termite-egg mimicry by a sclerotium-forming fungus. Proc. R. Soc. B Biol. Sci. 2006, 273, 1203–1209. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J. Rejuvenation preservation and determination of active substances of Termitococcus spp. Master’s Thesis, Northwest University, Xi’an, China, 2020. [Google Scholar]
- Vassilev, N.; Eichler-Löbermann, B.; Flor-Peregrin, E.; Martos, V.; Reyes, A.; Vassileva, M. Production of a potential liquid plant bio-stimulant by immobilized Piriformospora indica in repeated-batch fermentation process. AMB Express 2017, 7, 106. [Google Scholar] [CrossRef] [PubMed]
- Ozenirler, S.; Erkan, G.; Gülbahar, O.; Bostankolu, O.; Ozbaş Demırel, O.; Bilgihan, A.; Akyol, G. Serum levels of advanced oxidation protein products, malonyldialdehyde, and total radical trapping antioxidant parameter in patients with chronic hepatitis C. Turk. J. Gastroenterol. 2011, 22 1, 47–53. [Google Scholar] [CrossRef]
- Fedderwitz, F.; Nordlander, G.; Ninkovic, V.; Björklund, N. Effects of jasmonate-induced resistance in conifer plants on the feeding behaviour of a bark-chewing insect, Hylobius abietis. J. Pest Sci. 2016, 89, 97–105. [Google Scholar] [CrossRef]
- Wang, X.; Sun, J.; Wang, S.; Sun, T.; Zou, L. Salicylic acid promotes terpenoid synthesis in the fungi Sanghuangporus baumii. Microb. Biotechnol. 2023, 16, 1360–1372. [Google Scholar] [CrossRef] [PubMed]
- Cheong, J.-J.; Choi, Y.D. Methyl jasmonate as a vital substance in plants. Trends Genet. 2003, 19, 409–413. [Google Scholar] [CrossRef]
- Ye, J.; Mao, D.; Cheng, S.; Zhang, X.; Tan, J.; Zheng, J.; Xu, F. Comparative transcriptome analysis reveals the potential stimulatory mechanism of terpene trilactone biosynthesis by exogenous salicylic acid in Ginkgo biloba. Ind. Crops Prod. 2020, 145, 112104. [Google Scholar] [CrossRef]
- Hu, Y.-H.; Yu, Y.-T.; Piao, C.-H.; Liu, J.-M.; Yu, H.-S. Methyl jasmonate- and salicylic acid-induced d-chiro-inositol production in suspension cultures of buckwheat (Fagopyrum esculentum). Plant Cell Tissue Organ Cult. (PCTOC) 2011, 106, 419–424. [Google Scholar] [CrossRef]
- Ren, A.; Qin, L.; Shi, L.; Dong, X.; Mu, D.S.; Li, Y.X.; Zhao, M.W. Methyl jasmonate induces ganoderic acid biosynthesis in the basidiomycetous fungus Ganoderma lucidum. Bioresour. Technol. 2010, 101, 6785–6790. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Tan, Y.; Sun, Z.; Ren, A.; Zhu, J.; Zhao, M. Exogenous Salicylic Acid (SA) Promotes the Accumulation of Biomass and Flavonoid Content in Phellinus igniarius (Agaricomycetes). Int. J. Med. Mushrooms 2019, 21 10, 955–963. [Google Scholar] [CrossRef]
- Fan, X.Z.; Yao, F.; Yin, Z.M. Exogenous induction of ergosterol synthesis in Agaricus blazei. Mod. Food Sci. Technol. 2021, 037, 65–72. [Google Scholar] [CrossRef]
- Kong, P.; Hong, C. Evaluation of 1021Bp, a close relative of Pseudomonas eucalypticola, for potential of plant growth promotion, fungal pathogen suppression and boxwood blight control. BMC Microbiol. 2024, 24, 346. [Google Scholar] [CrossRef] [PubMed]
- Knoch, H.; Ulbrich, M.H.; Mittag, J.J.; Buske, J.; Garidel, P.; Heerklotz, H. Complex Micellization Behavior of the Polysorbates Tween 20 and Tween 80. Mol Pharm 2021, 18, 3147–3157. [Google Scholar] [CrossRef]
- Chou, D.K.; Krishnamurthy, R.; Randolph, T.W.; Carpenter, J.F.; Manning, M.C. Effects of Tween 20® and Tween 80® on the Stability of Albutropin During Agitation. J. Pharm. Sci. 2005, 94, 1368–1381. [Google Scholar] [CrossRef]
- Merdivan, S.; Lindequist, U. Ergosterol Peroxide: A Mushroom-Derived Compound with Promising Biological Activities-A Review. Int. J. Med. Mushrooms 2017, 19, 93–105. [Google Scholar] [CrossRef]
- Klemptner, R.L.; Sherwood, J.S.; Tugizimana, F.; Dubery, I.A.; Piater, L.A. Ergosterol, an orphan fungal microbe-associated molecular pattern (MAMP). Mol. Plant Pathol. 2014, 15, 747–761. [Google Scholar] [CrossRef]
- Lasunción, M.A.; Martín-Sánchez, C.; Canfrán-Duque, A.; Busto, R. Post-lanosterol biosynthesis of cholesterol and cancer. Curr. Opin. Pharmacol. 2012, 12, 717–723. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Lin, W.; Ma, X.; Lu, Q.; Ma, X.; Bian, G.; Jiang, L. The protein kinase Hal5p is the high-copy suppressor of lithium-sensitive mutations of genes involved in the sporulation and meiosis as well as the ergosterol biosynthesis in Saccharomyces cerevisiae. Genomics 2010, 95, 290–298. [Google Scholar] [CrossRef]
- Hu, Z.; He, B.; Ma, L.; Sun, Y.; Niu, Y.; Zeng, B. Recent Advances in Ergosterol Biosynthesis and Regulation Mechanisms in Saccharomyces cerevisiae. Indian J. Microbiol. 2017, 57, 270–277. [Google Scholar] [CrossRef] [PubMed]
- Sokolov, S.S.; Trushina, N.I.; Severin, F.F.; Knorre, D.A. Ergosterol Turnover in Yeast: An Interplay between Biosynthesis and Transport. Biochemistry 2019, 84, 346–357. [Google Scholar] [CrossRef]
- Oliaro-Bosso, S.; Balliano, G.; Viola, F.; Ferrante, T. Difference in the late ergosterol biosynthesis between yeast spheroplasts and intact cells. Acta Biochim. Pol. 2016, 63, 371–375. [Google Scholar] [CrossRef]
- Sayari, M.; van der Nest, M.A.; Steenkamp, E.T.; Rahimlou, S.; Hammerbacher, A.; Wingfield, B.D. Characterization of the Ergosterol Biosynthesis Pathway in Ceratocystidaceae. J. Fungi 2021, 7, 237. [Google Scholar] [CrossRef]
- Dinday, S.; Ghosh, S. Recent advances in triterpenoid pathway elucidation and engineering. Biotechnol. Adv. 2023, 68, 108214. [Google Scholar] [CrossRef]
- Xu, W.; Yao, J.; Liu, L.; Ma, X.; Li, W.; Sun, X.; Wang, Y. Improving squalene production by enhancing the NADPH/NADP+ ratio, modifying the isoprenoid-feeding module and blocking the menaquinone pathway in Escherichia coli. Biotechnol. Biofuels 2019, 12, 68. [Google Scholar] [CrossRef]
- Micera, M.; Botto, A.; Geddo, F.; Antoniotti, S.; Bertea, C.M.; Levi, R.; Gallo, M.P.; Querio, G. Squalene: More than a Step toward Sterols. Antioxidants 2020, 9, 688. [Google Scholar] [CrossRef] [PubMed]
- Matsuura, K.; Yashiro, T.; Shimizu, K.; Tatsumi, S.; Tamura, T. Cuckoo Fungus Mimics Termite Eggs by Producing the Cellulose-Digesting Enzyme β-Glucosidase. Curr. Biol. 2009, 19, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Wu, D.; Wang, Y.Y.; Yang, Y.; Feng, J.; Li, W.; Chen, W.-C.; Zhang, J.S. Optimization of liquid fermentation process of ergosterol produced by Hericium erinaceus. Mycosystema 2021, 40, 2159–2170. [Google Scholar] [CrossRef]
- Udvardi, M.K.; Czechowski, T.; Scheible, W.-R. Eleven Golden Rules of Quantitative RT-PCR. Plant Cell 2008, 20, 1736–1737. [Google Scholar] [CrossRef] [PubMed]
- Geng, D.; Jiang, M.; Dong, H.; Wang, R.; Lu, H.; Liu, W.; Guo, L.; Huang, L.; Xiao, W. MeJA regulates the accumulation of baicalein and other 4′-hydroxyflavones during the hollowed root development in Scutellaria baicalensis. Front. Plant Sci. 2023, 13, 1067847. [Google Scholar] [CrossRef]
- Dettman, R.W.; Liu, J.; Wang, Q.; Sun, M.; Zhu, L.; Yang, M.; Zhao, Y. Selection of Reference Genes for Quantitative Real-Time PCR Normalization in Panax ginseng at Different Stages of Growth and in Different Organs. PLoS ONE 2014, 9, e112177. [Google Scholar] [CrossRef]
- Wang, M.; Lu, S. Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng. Front. Plant Sci. 2015, 6, 1259. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Li, L.; Wang, K.; Zhao, M.; Li, S.; Jiang, Y.; Zhu, L.; Chen, J.; Wang, Y.; Sun, C.; et al. Selection and validation of reference genes desirable for gene expression analysis by qRT-PCR in MeJA-treated ginseng hairy roots. PLoS ONE 2019, 14, e0226168. [Google Scholar] [CrossRef]








| Primer Name | Sequence (5′-3′) |
|---|---|
| SE-132-F | CGGTCGTGCTCGTGAAGGG |
| SE-132-R | GGAGGATGTGCGTCGTTATATGC |
| FPS-187-F | CATCGGCAAACAAACTGGCA |
| FPS-187-R | GAGAACAAGGAAGGCACCGA |
| IDI-138-F | GTGACACCCAATGAGAACGAA |
| IDI-138-R | CCACCAGCCGAACAGGAA |
| PMK-200-F | CGGATGATGCTTGCTGATGT |
| PMK-200-R | GCTGTGAGCGTGTAAGTGCC |
| HMGS-153-F | GTCTTCGATGGAGTGTCTAAGGG |
| HMGS-153-R | ACCGATAGATTTTGGGTCGATGT |
| 32 HMGR-127-F | ACCAACCAACAACGGCGA |
| 32 HMGR-127-R | GCCCTTCACACCGAGCAT |
| 33 HMGR-200-F | CTTGGCTCGCCGTGTTTC |
| 33 HMGR-200-R | TTACTGCTCTTCATTTCGCCTATT |
| MVD-191-F | TATGGTTGAACGGCAAGGTAGA |
| MVD-191-R | TGATGCGGAAGATGCGAGA |
| SS-182-F | TGGATACCATTGAGGACGACA |
| SS-182-R | TGGAGAAAGGCGGTTGACT |
| AACT-221-F | CTATCAAGGGCAAGAAGGGTG |
| AACT-221-R | GGAGATGACTTTGGCAAGAGGTT |
| 18S rna-164-F | ACATCCGCCATCCATTCC |
| 18S rna-164-R | TCGCTGCCCATCACCATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, Y.-G.; Khan, Z.; Hu, F.-C.; Su, X.-H.; Xing, L.-X. Enhancement and Mechanism of Ergosterol Biosynthesis in Termite Ball Fungus Athelia termitophila by Methyl Jasmonate. Curr. Issues Mol. Biol. 2025, 47, 149. https://doi.org/10.3390/cimb47030149
Fang Y-G, Khan Z, Hu F-C, Su X-H, Xing L-X. Enhancement and Mechanism of Ergosterol Biosynthesis in Termite Ball Fungus Athelia termitophila by Methyl Jasmonate. Current Issues in Molecular Biology. 2025; 47(3):149. https://doi.org/10.3390/cimb47030149
Chicago/Turabian StyleFang, Yong-Gang, Zahid Khan, Fang-Cheng Hu, Xiao-Hong Su, and Lian-Xi Xing. 2025. "Enhancement and Mechanism of Ergosterol Biosynthesis in Termite Ball Fungus Athelia termitophila by Methyl Jasmonate" Current Issues in Molecular Biology 47, no. 3: 149. https://doi.org/10.3390/cimb47030149
APA StyleFang, Y.-G., Khan, Z., Hu, F.-C., Su, X.-H., & Xing, L.-X. (2025). Enhancement and Mechanism of Ergosterol Biosynthesis in Termite Ball Fungus Athelia termitophila by Methyl Jasmonate. Current Issues in Molecular Biology, 47(3), 149. https://doi.org/10.3390/cimb47030149

