Construction and Validation of CRISPR/Cas Vectors for Editing the PDS Gene in Banana (Musa spp.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Identification of the PDS Gene in Banana and Design of gRNAs
2.3. Construction of CRISPR/Cas9 Vectors
2.4. Transformation and Validation of CRISPR/Cas Constructs/Vectors in Escherichia coli and Assembly by Gibson Assembly
2.5. Transformation/Transfection and Validation in Agrobacterium
2.6. Confirmation of the Integration of CRISPR/Cas Constructs
2.7. Delivery of the CRISPR/Cas9 Plasmid to Prata-Anã Cells in Suspension
3. Results
3.1. Design of the gRNAs
3.2. Construction of CRISPR/Cas Vectors
3.3. Standardization of Protocol for Processing and Digestion of Parts
3.4. Quantification of Vector Parts and Assembly by Gibson Assembly
3.5. Transformation and Confirmation of Constructs in Agrobacterium Tumefaciens
3.6. Delivery of the CRISPR/Cas9 Plasmid in Banana cv. Prata-Anã
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- FAOSTAT. Food and Agriculture Organization of the United Nations. Available online: http://www.fao.org/faostat/en/#home (accessed on 6 February 2024).
- Nascimento, F.D.S.; Sousa, Y.M.; Rocha, A.D.J.; Ferreira, C.F.; Haddad, F.; Amorim, E.P. Sources of black sigatoka resistance in wild banana diploids. Rev. Bras. Frutic. 2020, 42, e-038. [Google Scholar] [CrossRef]
- Rocha, A.D.J.; Soares, J.M.D.S.; Nascimento, F.D.S.; Santos, A.S.; Amorim, V.B.D.O.; Ferreira, C.F.; Haddad, F.; Santos-Serejo, J.A.D.; Amorim, E.P. Improvements in the resistance of the banana species to fusarium wilt: A systematic review of methods and perspectives. J. Fungi 2021, 7, 249. [Google Scholar] [CrossRef] [PubMed]
- Soares, J.M.S.; Rocha, A.J.; Nascimento, F.S.; Santos, A.S.; Miller, R.N.G.; Ferreira, C.F.; Haddad, F.; Amorim, V.B.O.; Amorim, E.P. Genetic improvement for resistance to black sigatoka in bananas: A systematic review. Front. Plant Sci. 2021, 12, 657916. [Google Scholar] [CrossRef] [PubMed]
- Blomme, G.; Dita, M.; Jacobsen, K.S.; Pérez Vicente, L.; Molina, A.; Ocimati, W.; Poussier, S.; Prior, P. Bacterial diseases of bananas and enset: Current state of knowledge and integrated approaches toward sustainable management. Front. Plant Sci. 2017, 8, 1290. [Google Scholar] [CrossRef]
- Dita, M.; Barquero, M.; Heck, D.; Mizubuti, E.S.G.; Staver, C.P. Fusarium wilt of banana: Current knowledge on epidemiology and research needs toward sustainable disease management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef]
- Tinzaara, W.; Mutambuka, M.; Oyesigye, E.; Blomme, G.; Dita, M.; Gold, C.S.; Rouard, M.; Karamura, E. Banana wilt diseases: Current status and future research strategies for their management. Int. J. Pest Manag. 2024, 70, 290–309. [Google Scholar] [CrossRef]
- Nansamba, M.; Sibiya, J.; Tumuhimbise, R.; Ocimati, W.; Kikulwe, E.; Karamura, D.; Karamura, E. Assessing drought effects on banana production and on-farm coping strategies by farmers—A study in the cattle corridor of Uganda. Clim. Change 2022, 173, 21. [Google Scholar] [CrossRef]
- Zekai, E.; Açar, E.; Dönmez, D.; Şimşek, Ö.; Aka Kaçar, Y. In Vitro drought stress and drought-related gene expression in banana. Mol. Biol. Rep. 2022, 49, 5577–5583. [Google Scholar] [CrossRef]
- Amorim, E.P.; Serejo, J.A.; Dos, S.; Amorim, V.B.O.; Silva, S.O. Melhoramento genético. In O agronegócio da Banana, 1st ed.; Ferreira, C.F., Silva, S.O., Amorim, E.P., Santos-Serejo, J.A., Eds.; Embrapa: Brasília, Brazil, 2016; pp. 171–200. [Google Scholar]
- Prado, G.S.; Pinheiro, T.T.; De Faria, J.C.; Vianello, R. Genome Editing via Non-Homologous End-Joining (NHEJ) and Ribonucleoproteins (RNP); Embrapa: Brasília, Brazil, 2021; pp. 47–48. [Google Scholar]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef]
- Kaur, N.; Alok, A.; Shivani; Kaur, N.; Pandey, P.; Awasthi, P.; Tiwari, S. CRISPR/Cas9-mediated efficient editing in Phytoene Desaturase (PDS) demonstrates precise manipulation in banana Cv. Rasthali genome. Funct. Integr. Genom. 2018, 18, 89–99. [Google Scholar] [CrossRef]
- Naim, F.; Dugdale, B.; Kleidon, J.; Brinin, A.; Shand, K.; Waterhouse, P.; Dale, J. Gene editing the Phytoene Desaturase alleles of Cavendish banana using CRISPR/Cas9. Transgenic Res. 2018, 27, 451–460. [Google Scholar] [CrossRef] [PubMed]
- Ntui, V.O.; Tripathi, J.N.; Tripathi, L. Robust CRISPR/Cas9 Mediated genome editing tool for banana and plantain (Musa Spp.). Curr. Plant Biol. 2020, 21, 100128. [Google Scholar] [CrossRef]
- Tripathi, J.N.; Ntui, V.O.; Ron, M.; Muiruri, S.K.; Britt, A.; Tripathi, L. CRISPR/Cas9 editing of endogenous banana streak virus in the B genome of Musa spp. overcomes a major challenge in banana breeding. Commun. Biol. 2019, 2, 46. [Google Scholar] [CrossRef] [PubMed]
- Molinari, H.; Vieira, L.; Silva, N.; Prado, G.; Lopes Filho, J.H. Tecnologia CRISPR na Genômica de Plantas: Biotecnologia Aplicada à Agricultura; Embrapa Agroenergia: Brasília, Brazil, 2020. [Google Scholar]
- Liu, X.; Xie, C.; Si, H.; Yang, J. CRISPR/Cas9-mediated genome editing in plants. Methods 2017, 121–122, 94–102. [Google Scholar] [CrossRef]
- Hussain, B.; Lucas, S.J.; Budak, H. CRISPR/Cas9 in plants: At play in the genome and at work for crop improvement. Brief. Funct. Genom. 2018, 17, 319–328. [Google Scholar] [CrossRef]
- Chen, K.; Wang, Y.; Zhang, R.; Zhang, H.; Gao, C. CRISPR/Cas genome editing and precision plant breeding in agriculture. Annu. Rev. Plant Biol. 2019, 70, 667–697. [Google Scholar] [CrossRef]
- Montecillo, J.A.V.; Chu, L.L.; Bae, H. CRISPR-Cas9 system for plant genome editing: Current approaches and emerging developments. Agronomy 2020, 10, 1033. [Google Scholar] [CrossRef]
- Tripathi, L.; Ntui, V.O.; Tripathi, J.N. Application of genetic modification and genome editing for developing climate-smart banana. Food Energy Secur. 2019, 8, e00168. [Google Scholar] [CrossRef]
- Morais-Lino, L.S.; Santos-Serejo, J.A.D.; Silva, S.D.O.E.; Santana, J.R.F.D.; Kobayashi, A.K. Cell suspension culture and plant regeneration of a Brazilian plantain, Cultivar Terra. Pesq. Agropec. Bras. 2008, 43, 1325–1330. [Google Scholar] [CrossRef]
- Nascimento, F.d.S.; Mascarenhas, M.S.; Boaventura, S.C.; de Souza, C.C.H.; de Souza Ramos, A.P.; de Jesus Rocha, A.; da Silva Soares, J.M.; Diniz, L.E.C.; de Oliveira Mendes, T.A.; Ferreira, C.F.; et al. Phytoene Desaturase (PDS) gene-derived markers identify “A” and “B” genomes in banana (Musa spp.). Horticulturae 2024, 10, 294. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Ferreira, C.F.; Gutierrez, D.L.; Kreuze, J.F.; Iskra-Caruana, M.L.; Chabannes, M.; Barbosa, A.C.O.; Santos, T.A.; Silva, A.G.S.; Santos, R.M.F.; Amorim, E.P.; et al. Brief note rapid plant DNA and RNA extraction protocol using a bench drill. Genet. Mol. Res. 2019, 18, gmr18394. [Google Scholar] [CrossRef]
- Hepperle, D. SeqAssem—Analysis and Contig Assembly of Sequences; SequentiX-digital DNA Processing: Klein Raden, Germany, 2004. [Google Scholar]
- Sambrook, J.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold spring harbor laboratory press: Long Island, NY, USA, 1989. [Google Scholar]
- Hofgen, R.; Willmitzer, L. Storage of competent cells for Agrobacterium transformation. Nucl. Acids Res. 1988, 16, 9877. [Google Scholar] [CrossRef] [PubMed]
- Pirrello, C.; Malacarne, G.; Moretto, M.; Lenzi, L.; Perazzolli, M.; Zeilmaker, T.; Van Den Ackerveken, G.; Pilati, S.; Moser, C.; Giacomelli, L. Grapevine DMR6-1 is a candidate gene for susceptibility to downy mildew. Biomolecules 2022, 12, 182. [Google Scholar] [CrossRef] [PubMed]
- Borrelli, V.M.G.; Brambilla, V.; Rogowsky, P.; Marocco, A.; Lanubile, A. The enhancement of plant disease resistance using CRISPR/Cas9 technology. Front. Plant Sci. 2018, 9, 1245. [Google Scholar] [CrossRef]
- Alamillo, J.M.; López, C.M.; Martínez Rivas, F.J.; Torralbo, F.; Bulut, M.; Alseekh, S. Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein and hairy roots: A perfect match for gene functional analysis and crop improvement. Curr. Opin. Biotechnol. 2023, 79, 102876. [Google Scholar] [CrossRef]
- Kummari, D.; Palakolanu, S.R.; Kishor, P.B.K.; Bhatnagar-Mathur, P.; Singam, P.; Vadez, V.; Sharma, K.K. An Update and perspectives on the use of promoters in plant genetic engineering. J. Biosci. 2020, 45, 119. [Google Scholar] [CrossRef]
- Wada, N.; Ueta, R.; Osakabe, Y.; Osakabe, K. Precision genome editing in plants: State-of-the-art in CRISPR/Cas9-based genome engineering. BMC Plant Biol. 2020, 20, 234. [Google Scholar] [CrossRef]
- Vidya, N.; Arun, M. Updates and applications of CRISPR/Cas technology in plants. J. Plant Biol. 2023, 66, 499–518. [Google Scholar] [CrossRef]
- Azizi, P.; Rafii, M.Y.; Abdullah, S.N.A.; Hanafi, M.M.; Maziah, M.; Sahebi, M.; Ashkani, S.; Taheri, S.; Jahromi, M.F. Over-expression of the Pikh gene with a CaMV 35S promoter leads to improved blast disease (Magnaporthe oryzae) tolerance in rice. Front. Plant Sci. 2016, 7, 773. [Google Scholar] [CrossRef]
- Chung, P.J.; Chung, H.; Oh, N.; Choi, J.; Bang, S.W.; Jung, S.E.; Jung, H.; Shim, J.S.; Kim, J.-K. Efficiency of recombinant CRISPR/rCas9-mediated miRNA gene editing in rice. Int. J. Mol. Sci. 2020, 21, 9606. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-S.; Le, V.T.; Jung, Y.J.; Kang, K.-K.; Cho, Y.-G. OsPUB9 gene edited by CRISPR/Cas9 enhanced resistance to bacterial leaf blight in rice (Oryza sativa L.). Int. J. Mol. Sci. 2024, 25, 7145. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Ding, J.; Zhu, J.; Liu, X.; Xu, R.; Qin, R.; Gu, D.; Li, M.; Wei, P.; Li, J. Developing a CRISPR/frcas9 system for core promoter editing in rice. aBIOTECH 2024, 5, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Nie, H.; Shi, Y.; Geng, X.; Xing, G. CRISRP/Cas9-mediated targeted mutagenesis of Tomato Polygalacturonase Gene (SlPG) delays fruit softening. Front. Plant Sci. 2022, 13, 729128. [Google Scholar] [CrossRef] [PubMed]
- Pramanik, D.; Shelake, R.M.; Park, J.; Kim, M.J.; Hwang, I.; Park, Y.; Kim, J.-Y. CRISPR/Cas9-mediated generation of pathogen-resistant tomato against Tomato Yellow Leaf Curl Virus and powdery mildew. Int. J. Mol. Sci. 2021, 22, 1878. [Google Scholar] [CrossRef]
- Lu, Q.S.M.; Tian, L. An efficient and specific CRISPR-Cas9 genome editing system targeting soybean phytoene desaturase genes. BMC Biotechnol. 2022, 22, 7. [Google Scholar] [CrossRef]
- Yao, D.; Zhou, J.; Zhang, A.; Wang, J.; Liu, Y.; Wang, L.; Pi, W.; Li, Z.; Yue, W.; Cai, J.; et al. Advances in CRISPR/Cas9-based research related to soybean [Glycine Max (Linn.) Merr] molecular breeding. Front. Plant Sci. 2023, 14, 1247707. [Google Scholar] [CrossRef]
- Xun, H.; Zhang, X.; Yu, J.; Pang, J.; Wang, S.; Liu, B.; Dong, Y.; Jiang, L.; Guo, D. Analysis of expression characteristics of soybean leaf and root tissue-specific promoters in Arabidopsis and soybean. Transgenic Res. 2021, 30, 799–810. [Google Scholar] [CrossRef]
- Rahman, F.; Mishra, A.; Gupta, A.; Sharma, R. Spatiotemporal regulation of CRISPR/cas9 enables efficient, precise, and heritable edits in plant genomes. Front. Genome Ed. 2022, 4, 870108. [Google Scholar] [CrossRef]
- Krasnyanski, S.F.; Sandhu, J.; Domier, L.L.; Buetow, D.E.; Korban, S.S. Effect of an enhanced CaMV 35S promoter and a fruit-specific promoter on uida gene expression in transgenic tomato plants. In Vitro Cell. Dev. Biol. Plant 2001, 37, 427–433. [Google Scholar] [CrossRef]
- Singha, D.L.; Das, D.; Sarki, Y.N.; Chowdhury, N.; Sharma, M.; Maharana, J.; Chikkaputtaiah, C. Harnessing tissue-specific genome editing in plants through CRISPR/Cas system: Current state and future prospects. Planta 2022, 255, 28. [Google Scholar] [CrossRef] [PubMed]
- Potenza, C.; Aleman, L.; Sengupta-Gopalan, C. Targeting transgene expression in research, agricultural, and environmental applications: Promoters used in plant transformation. In Vitro Cell. Dev. Biol. Plant 2004, 40, 1–22. [Google Scholar] [CrossRef]
- Porto, M.S.; Pinheiro, M.P.N.; Batista, V.G.L.; Dos Santos, R.C.; De Albuquerque Melo Filho, P.; De Lima, L.M. Plant promoters: An approach of structure and function. Mol. Biotechnol. 2014, 56, 38–49. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Wang, J.; Yu, T.; Song, R.; Qi, W. Callus-specific CRISPR/Cas9 system to increase heritable gene mutations in maize. Planta 2024, 260, 16. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Jiang, B.; Wu, C.; Sun, S.; Hou, W.; Han, T. GmPRP2 promoter drives root-preferential expression in transgenic Arabidopsis and soybean hairy roots. BMC Plant Biol. 2014, 14, 245. [Google Scholar] [CrossRef] [PubMed]
- James, A.; Paul, J.-Y.; Souvan, J.; Cooper, T.; Dale, J.; Harding, R.; Deo, P. Assessment of root-specific promoters in banana and tobacco and identification of a banana TIP2 promoter with strong root activity. Front. Plant Sci. 2022, 13, 1009487. [Google Scholar] [CrossRef]
- Zheng, N.; Li, T.; Dittman, J.D.; Su, J.; Li, R.; Gassmann, W.; Peng, D.; Whitham, S.A.; Liu, S.; Yang, B. CRISPR/Cas9-based gene editing using egg cell-specific promoters in Arabidopsis and soybean. Front. Plant Sci. 2020, 11, 800. [Google Scholar] [CrossRef]
- Li, M.; Niu, X.; Li, S.; Fu, S.; Li, Q.; Xu, M.; Wang, C.; Wu, S. CRISPR/Cas9 based cell-type specific gene knock-out in Arabidopsis roots. Plants 2023, 12, 2365. [Google Scholar] [CrossRef]
- Cui, Y.; Jiang, N.; Xu, Z.; Xu, Q. Heterotrimeric G protein are involved in the regulation of multiple agronomic traits and stress tolerance in rice. BMC Plant Biol. 2020, 20, 90. [Google Scholar] [CrossRef]
- Zhang, H.; Xiang, Y.; He, N.; Liu, X.; Liu, H.; Fang, L.; Zhang, F.; Sun, X.; Zhang, D.; Li, X.; et al. Enhanced vitamin C production mediated by an ABA-induced PTP-like nucleotidase improves plant drought tolerance in Arabidopsis and maize. Mol. Plant 2020, 13, 760–776. [Google Scholar] [CrossRef]
- Jiang, W.; Zhou, H.; Bi, H.; Fromm, M.; Yang, B.; Weeks, D.P. Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 2013, 41, e188. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Wang, Y.; Xu, J.; Wang, N. Development of multiplex genome editing toolkits for citrus with high efficacy in biallelic and homozygous mutations. Plant Mol. Biol. 2020, 104, 297–307. [Google Scholar] [CrossRef] [PubMed]
- Satyavathi, V.V.; Princy, K.; Gupta, N.; Nizampatnam, N.R.; Sharma, R.; Sreelakshmi, Y. A comprehensive protocol for assembly of multiple gRNAs into a direct vector for genome editing in tomato. In Plant Functional Genomics; Maghuly, F., Ed.; Methods in molecular biology; Springer: New York, NY, USA, 2024; Volume 2788, pp. 317–335. ISBN 978-1-07-163781-4. [Google Scholar]
- Krenek, P.; Samajova, O.; Luptovciak, I.; Doskocilova, A.; Komis, G.; Samaj, J. Transient plant transformation mediated by Agrobacterium Tumefaciens: Principles, methods and applications. Biotechnol. Adv. 2015, 33, 1024–1042. [Google Scholar] [CrossRef] [PubMed]
- Azizi-Dargahlou, S.; Pouresmaeil, M. Agrobacterium tumefaciens-mediated plant transformation: A review. Mol. Biotechnol. 2024, 66, 1563–1580. [Google Scholar] [CrossRef]
- Chakraborty, N.; Chakraborty, P.; Sen, M.; Bandopadhyay, R. Choice of explant for plant genetic transformation. In Biolistic DNA Delivery in Plants; Rustgi, S., Luo, H., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2020; Volume 2124, pp. 107–123. ISBN 978-1-07-160355-0.1. [Google Scholar]
- Ondzighi-Assoume, C.A.; Willis, J.D.; Ouma, W.K.; Allen, S.M.; King, Z.; Parrott, W.A.; Liu, W.; Burris, J.N.; Lenaghan, S.C.; Stewart, C.N. Embryogenic cell suspensions for high-capacity genetic transformation and regeneration of switchgrass (Panicum virgatum L.). Biotechnol. Biofuels 2019, 12, 290. [Google Scholar] [CrossRef]
- Ntui, V.O.; Tripathi, J.N.; Shah, T.; Tripathi, L. Targeted knockout of Early Nodulin-like 3 (MusaENODL3) gene in banana reveals its function in resistance to Xanthomonas wilt disease. Plant Biotechnol. J. 2024, 22, 1101–1112. [Google Scholar] [CrossRef]
- Ribas, A.F.; Dechamp, E.; Champion, A.; Bertrand, B.; Combes, M.-C.; Verdeil, J.-L.; Lapeyre, F.; Lashermes, P.; Etienne, H. Agrobacterium-mediated genetic transformation of Coffea arabica (L.) is greatly enhanced by using established embryogenic callus cultures. BMC Plant Biol. 2011, 11, 92. [Google Scholar] [CrossRef]
- Qi, Y.; Du, L.; Quan, Y.; Tian, F.; Liu, Y.; Wang, Y. Agrobacterium-mediated transformation of embryogenic cell suspension cultures and plant regeneration in Lilium tenuifolium oriental × trumpet ‘Robina’. Acta Physiol. Plant 2014, 36, 2047–2057. [Google Scholar] [CrossRef]
- Cordeiro, D.; Alves, A.; Ferraz, R.; Casimiro, B.; Canhoto, J.; Correia, S. An efficient Agrobacterium-mediated genetic transformation method for Solanum betaceum Cav. embryogenic callus. Plants 2023, 12, 1202. [Google Scholar] [CrossRef]
- Belide, S.; Vanhercke, T.; Petrie, J.R.; Singh, S.P. Robust genetic transformation of sorghum (Sorghum bicolor L.) using differentiating embryogenic callus induced from immature embryos. Plant Methods 2017, 13, 109. [Google Scholar] [CrossRef]
- Song, Y.; Bai, X.; Dong, S.; Yang, Y.; Dong, H.; Wang, N.; Zhang, H.; Li, S. Stable and efficient Agrobacterium-mediated genetic transformation of larch using embryogenic callus. Front. Plant Sci. 2020, 11, 584492. [Google Scholar] [CrossRef]






| Parts | Construction of CRISPR/Cas9 Vectors CRISPR/Cas9 |
|---|---|
| Composition | |
| Part 1 | LB_U6 promoter_gRNA BsaI_U6 gene termination signal |
| Part 2 | 35s_T7_promoter_constitutive (gRNA with U6 promoter) |
| Part 3 | OCS 3′ terminator + RB |
| Part 4 | 35s + T7 + gRNA with U6 promoter (promoter banana) |
| Cas9 | Bba_K1218011 |
| Name | Seq 5′-3′ | pb | %GC | Ta | Amplicon |
|---|---|---|---|---|---|
| Vc9_Fw | CTACCCTCCGCGAGATCATC | 20 | 60% | 45 °C | 1912 pb C1 |
| Vc9_Rv | CGACCTCATCCACAATGTTGC | 21 | 52.4% | 45 °C | 1587 pb C2 |
| Vp3C9_Fw | GCGTTACCTTCCAAATACGTG | 21 | 47.6% | 51 °C | 988 pb |
| Vp3C9_Rv | CGCACGGTGAAACAGAAC | 18 | 55.6% | 51 °C | 988 pb |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mascarenhas, M.S.; Nascimento, F.d.S.; Schittino, L.M.P.; Galinari, L.B.; Lino, L.S.M.; Ramos, A.P.d.S.; Diniz, L.E.C.; Mendes, T.A.d.O.; Ferreira, C.F.; Santos-Serejo, J.A.d.; et al. Construction and Validation of CRISPR/Cas Vectors for Editing the PDS Gene in Banana (Musa spp.). Curr. Issues Mol. Biol. 2024, 46, 14422-14437. https://doi.org/10.3390/cimb46120865
Mascarenhas MS, Nascimento FdS, Schittino LMP, Galinari LB, Lino LSM, Ramos APdS, Diniz LEC, Mendes TAdO, Ferreira CF, Santos-Serejo JAd, et al. Construction and Validation of CRISPR/Cas Vectors for Editing the PDS Gene in Banana (Musa spp.). Current Issues in Molecular Biology. 2024; 46(12):14422-14437. https://doi.org/10.3390/cimb46120865
Chicago/Turabian StyleMascarenhas, Marcelly Santana, Fernanda dos Santos Nascimento, Luana Maria Pacheco Schittino, Livia Batista Galinari, Lucymeire Souza Morais Lino, Andresa Priscila de Souza Ramos, Leandro Eugenio Cardamone Diniz, Tiago Antônio de Oliveira Mendes, Claudia Fortes Ferreira, Janay Almeida dos Santos-Serejo, and et al. 2024. "Construction and Validation of CRISPR/Cas Vectors for Editing the PDS Gene in Banana (Musa spp.)" Current Issues in Molecular Biology 46, no. 12: 14422-14437. https://doi.org/10.3390/cimb46120865
APA StyleMascarenhas, M. S., Nascimento, F. d. S., Schittino, L. M. P., Galinari, L. B., Lino, L. S. M., Ramos, A. P. d. S., Diniz, L. E. C., Mendes, T. A. d. O., Ferreira, C. F., Santos-Serejo, J. A. d., & Amorim, E. P. (2024). Construction and Validation of CRISPR/Cas Vectors for Editing the PDS Gene in Banana (Musa spp.). Current Issues in Molecular Biology, 46(12), 14422-14437. https://doi.org/10.3390/cimb46120865

