Silencing LY6K Suppresses CD44+ EpCAM+ HCT116 Human Colon Cancer Stem Cells Growth: Insights from In Vitro and In Vivo Evidence
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Cells Lines
2.2. Magnetic-Activated Cell Sorting (MACS)
2.3. Sphere Formation Assay
2.4. Serum-Induced Differentiation of Tumorspheres
2.5. RNA Extraction and Quantitation
2.6. Transfection of Small Interfering RNA (siRNA)
2.7. Western Blot Analysis
2.8. Cell Migration and Invasion Assays
2.9. Cell Proliferation Assay
2.10. Flow Cytometry Analysis of Cell Cycle
2.11. Annexin V-FITC/PI Apoptosis Assay
2.12. In Vivo Tumor Xenograft Assay
2.13. Statistical Analysis
3. Results
3.1. Cell Identification
3.2. High Expression and siRNA-Mediated Silencing of LY6K in CCSCs
3.3. LY6K-Silencing Inhibits the Migration and Invasion of CCSCs
3.4. LY6K-Silencing Inhibits Cell Proliferation by Inducing G1 Cell-Cycle Arrest in CCSCs
3.5. LY6K-Silencing Suppresses the Growth of CCSCs in Xenografts and Promoted Mice Survival
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Goding Sauer, A.; Fedewa, S.A.; Butterly, L.F.; Anderson, J.C.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 145–164. [Google Scholar] [CrossRef] [PubMed]
- Luo, M.; Shang, L.; Brooks, M.D.; Jiagge, E.; Zhu, Y.; Buschhaus, J.M.; Conley, S.; Fath, M.A.; Davis, A.; Gheordunescu, E.; et al. Targeting Breast Cancer Stem Cell State Equilibrium through Modulation of Redox Signaling. Cell Metab. 2018, 28, 69–86.e66. [Google Scholar] [CrossRef] [PubMed]
- Nassar, D.; Blanpain, C. Cancer Stem Cells: Basic Concepts and Therapeutic Implications. Annu. Rev. Pathol. 2016, 11, 47–76. [Google Scholar] [CrossRef]
- Yan, C.; Luo, L.; Goto, S.; Urata, Y.; Guo, C.Y.; Doi, H.; Kitazato, K.; Li, T.S. Enhanced autophagy in colorectal cancer stem cells does not contribute to radio-resistance. Oncotarget 2016, 7, 45112–45121. [Google Scholar] [CrossRef][Green Version]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.G.; Lee, S.H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem Cells Int. 2018, 2018, 5416923. [Google Scholar] [CrossRef]
- Kong, H.K.; Park, J.H. Characterization and function of human Ly-6/uPAR molecules. BMB Rep. 2012, 45, 595–603. [Google Scholar] [CrossRef]
- McKenzie, I.F.; Gardiner, J.; Cherry, M.; Snell, G.D. Lymphocyte antigens: Ly-4, Ly-6, and Ly-7. Transplant. Proc. 1977, 9, 667–669. [Google Scholar]
- Rathbun, L.A.; Magliocco, A.M.; Bamezai, A.K. Human LY6 gene family: Potential tumor-associated antigens and biomarkers of prognosis in uterine corpus endometrial carcinoma. Oncotarget 2023, 14, 426–437. [Google Scholar] [CrossRef]
- Gravekamp, C. LY6 gene family presents a novel class of potential biomarkers associated with overall survival outcome of pancreatic ductal adenocarcinoma. Oncotarget 2021, 12, 1122–1123. [Google Scholar] [CrossRef]
- Russ, E.; Bhuvaneshwar, K.; Wang, G.; Jin, B.; Gage, M.M.; Madhavan, S.; Gusev, Y.; Upadhyay, G. High mRNA expression of LY6 gene family is associated with overall survival outcome in pancreatic ductal adenocarcinoma. Oncotarget 2021, 12, 145–159. [Google Scholar] [CrossRef]
- Park, S.; Park, D.; Han, S.; Chung, G.E.; Soh, S.; Ka, H.I.; Joo, H.J.; Yang, Y. LY6K depletion modulates TGF-β and EGF signaling. Cancer Med. 2023, 12, 12593–12607. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Gong, R.; Yang, H. Upregulation of LY6K induced by FTO-mediated demethylation promotes the tumorigenesis and metastasis of oral squamous cell carcinoma via CAV-1-mediated ERK1/2 signaling activation. Histol. Histopathol. 2024, 39, 1359–1370. [Google Scholar] [CrossRef]
- AlHossiny, M.; Luo, L.; Frazier, W.R.; Steiner, N.; Gusev, Y.; Kallakury, B.; Glasgow, E.; Creswell, K.; Madhavan, S.; Kumar, R.; et al. Ly6E/K Signaling to TGFβ Promotes Breast Cancer Progression, Immune Escape, and Drug Resistance. Cancer Res. 2016, 76, 3376–3386. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.H.; Kong, H.K.; Park, S.Y.; Park, J.H. Metastatic effect of LY-6K gene in breast cancer cells. Int. J. Oncol. 2009, 35, 601–607. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; McGarvey, P.; Madhavan, S.; Kumar, R.; Gusev, Y.; Upadhyay, G. Distinct lymphocyte antigens 6 (Ly6) family members Ly6D, Ly6E, Ly6K and Ly6H drive tumorigenesis and clinical outcome. Oncotarget 2016, 7, 11165–11193. [Google Scholar] [CrossRef] [PubMed]
- Duan, J.; Wang, Y.; Chen, Y.; Wang, Y.; Li, Q.; Liu, J.; Fu, C.; Cao, C.; Cong, Z.; Su, M. Silencing LY6D Expression Inhibits Colon Cancer in Xenograft Mice and Regulates Colon Cancer Stem Cells’ Proliferation, Stemness, Invasion, and Apoptosis via the MAPK Pathway. Molecules 2023, 28, 7776. [Google Scholar] [CrossRef]
- Zhang, C.; Tian, Y.; Song, F.; Fu, C.; Han, B.; Wang, Y. Salinomycin inhibits the growth of colorectal carcinoma by targeting tumor stem cells. Oncol. Rep. 2015, 34, 2469–2476. [Google Scholar] [CrossRef]
- Fu, C.; Zhou, N.; Zhao, Y.; Duan, J.; Xu, H.; Wang, Y. Dendritic cells loaded with CD44 CT-26 colon cell lysate evoke potent antitumor immune responses. Oncol. Lett. 2019, 18, 5897–5904. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schefe, J.H.; Lehmann, K.E.; Buschmann, I.R.; Unger, T.; Funke-Kaiser, H. Quantitative real-time RT-PCR data analysis: Current concepts and the novel “gene expression’s CT difference” formula. J. Mol. Med. 2006, 84, 901–910. [Google Scholar] [CrossRef]
- Fu, C.; Xiao, X.; Xu, H.; Lu, W.; Wang, Y. Efficacy of atovaquone on EpCAM(+)CD44(+) HCT-116 human colon cancer stem cells under hypoxia. Exp. Ther. Med. 2020, 20, 286. [Google Scholar] [CrossRef] [PubMed]
- Dalerba, P.; Dylla, S.J.; Park, I.K.; Liu, R.; Wang, X.; Cho, R.W.; Hoey, T.; Gurney, A.; Huang, E.H.; Simeone, D.M.; et al. Phenotypic characterization of human colorectal cancer stem cells. Proc. Natl. Acad. Sci. USA 2007, 104, 10158–10163. [Google Scholar] [CrossRef] [PubMed]
- Nandy, S.B.; Lakshmanaswamy, R. Cancer Stem Cells and Metastasis. Progress Mol. Biol. Transl. Sci. 2017, 151, 137–176. [Google Scholar] [CrossRef]
- Guo, D.; Liu, Y.; Jiang, Y.; Zheng, S.; Xu, T.; Zhu, J.; Chen, P.; Huang, P.; Zhang, Y. A narrative review of the emerging role of lymphocyte antigen 6 complex locus K in cancer: From basic research to clinical practice. Ann. Transl. Med. 2022, 10, 26. [Google Scholar] [CrossRef]
- Hailin, L.; Yiting, C.; Yue, W.; Lijun, L.; Renlu, Z.; Yunhan, C.; Yanyang, Z.; Qiuyu, Z. Ly6E on tumor cells impairs anti-tumor T-cell responses: A novel mechanism of tumor-induced immune exclusion. Cancer Immunol. Immunother. 2024, 74, 4. [Google Scholar] [CrossRef]
- Qin, H.; Lu, H.; Qin, C.; Huang, X.; Peng, K.; Li, Y.; Lan, C.; Bi, A.; Huang, Z.; Wei, Y.; et al. Pan-cancer analysis suggests that LY6H is a potential biomarker of diagnosis, immunoinfiltration, and prognosis. J. Cancer 2024, 15, 5515–5539. [Google Scholar] [CrossRef]
- Nayerpour Dizaj, T.; Doustmihan, A.; Sadeghzadeh Oskouei, B.; Akbari, M.; Jaymand, M.; Mazloomi, M.; Jahanban-Esfahlan, R. Significance of PSCA as a novel prognostic marker and therapeutic target for cancer. Cancer Cell Int. 2024, 24, 135. [Google Scholar] [CrossRef]
- Liao, X.H.; Xie, Z.; Guan, C.N. MiRNA-500a-3p inhibits cell proliferation and invasion by targeting lymphocyte antigen 6 complex locus K (LY6K) in human non-small cell lung cancer. Neoplasma 2018, 65, 673–682. [Google Scholar] [CrossRef]
- Geng, L.; Wang, Z.; Tian, Y. Down-regulation of ZNF252P-AS1 alleviates ovarian cancer progression by binding miR-324-3p to downregulate LY6K. J. Ovarian Res. 2022, 15, 1. [Google Scholar] [CrossRef]
- Andrys-Olek, J.; Selvanesan, B.C.; Varghese, S.; Arriaza, R.H.; Tiwari, P.B.; Chruszcz, M.; Borowski, T.; Upadhyay, G. Experimental and Computational Studies Reveal Novel Interaction of Lymphocytes Antigen 6K to TGF-β Receptor Complex. Int. J. Mol. Sci. 2023, 24, 12779. [Google Scholar] [CrossRef]
- Son, D.; Kong, H.K.; Kim, Y.; Song, M.J.; Kim, H.P.; Lee, H.W.; Park, J.H. Transgenic overexpression of human LY6K in mice suppresses mature T cell development in the thymus. Oncol. Lett. 2019, 17, 379–387. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Fan, J.; Gao, W.; Wu, Y.; Zhao, Q.; Chen, B.; Ding, Y.; Wen, S.; Nan, X.; Wang, B. LY6D as a Chemoresistance Marker Gene and Therapeutic Target for Laryngeal Squamous Cell Carcinoma. Stem Cells Dev. 2020, 29, 774–785. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Sheng, N.; Li, Y.; Fan, Y.; Nan, X.; Fu, R. Ly6D facilitates chemoresistance in laryngeal squamous cell carcinoma through miR-509/β-catenin signaling pathway. Am. J. Cancer Res. 2023, 13, 2155–2171. [Google Scholar] [PubMed]
- Kawaguchi, T.; Sho, M.; Tojo, T.; Yamato, I.; Nomi, T.; Hotta, K.; Hamada, K.; Suzaki, Y.; Sugiura, S.; Kushibe, K.; et al. Clinical significance of prostate stem cell antigen expression in non-small cell lung cancer. Jpn. J. Clin. Oncol. 2010, 40, 319–326. [Google Scholar] [CrossRef] [PubMed]
- Kikuchi, R.; Ueda, R.; Saito, K.; Shibao, S.; Nagashima, H.; Tamura, R.; Morimoto, Y.; Sasaki, H.; Noji, S.; Kawakami, Y.; et al. A Pilot Study of Vaccine Therapy with Multiple Glioma Oncoantigen/Glioma Angiogenesis-Associated Antigen Peptides for Patients with Recurrent/Progressive High-Grade Glioma. J. Clin. Med. 2019, 8, 263. [Google Scholar] [CrossRef]
- Suda, T.; Tsunoda, T.; Daigo, Y.; Nakamura, Y.; Tahara, H. Identification of human leukocyte antigen-A24-restricted epitope peptides derived from gene products upregulated in lung and esophageal cancers as novel targets for immunotherapy. Cancer Sci. 2007, 98, 1803–1808. [Google Scholar] [CrossRef]
- Iwahashi, M.; Katsuda, M.; Nakamori, M.; Nakamura, M.; Naka, T.; Ojima, T.; Iida, T.; Yamaue, H. Vaccination with peptides derived from cancer-testis antigens in combination with CpG-7909 elicits strong specific CD8+ T cell response in patients with metastatic esophageal squamous cell carcinoma. Cancer Sci. 2010, 101, 2510–2517. [Google Scholar] [CrossRef]
- Sledz, C.A.; Holko, M.; de Veer, M.J.; Silverman, R.H.; Williams, B.R. Activation of the interferon system by short-interfering RNAs. Nat. Cell Biol. 2003, 5, 834–839. [Google Scholar] [CrossRef]
- Judge, A.D.; Sood, V.; Shaw, J.R.; Fang, D.; McClintock, K.; MacLachlan, I. Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA. Nat. Biotechnol. 2005, 23, 457–462. [Google Scholar] [CrossRef]
- Janas, M.M.; Schlegel, M.K.; Harbison, C.E.; Yilmaz, V.O.; Jiang, Y.; Parmar, R.; Zlatev, I.; Castoreno, A.; Xu, H.; Shulga-Morskaya, S.; et al. Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat. Commun. 2018, 9, 723. [Google Scholar] [CrossRef]





| Target | Sequence (5′ → 3′) | Size (bp) |
|---|---|---|
| GAPDH | F: CAGGAGGCATTGCTGATGAT R: GAAGGCTGGGGCTCATTT | 138 |
| LY6E | F: CCGACCAGGACAACTACTGC R: ACACCAACATTGACGCCTTC | 130 |
| LY6H | F: ACAAGATGTGTGCCTCCTCC R: CACAAATCCTTCTCGCAGCA | 121 |
| LY6K | F: CTGACTGCGAGACAACGAGAT R: ATTTGCACCTCCTTGGGTTCT | 124 |
| PSCA | F: CAAAGCCCAGGTGAGCAACG R: CTGTGAGTCATCCACGCAGTT | 148 |
| NANOG | F: CTCCAACATCCTGAACCTCAGC R: CGTCACACCATTGCTATTCTTCG | 115 |
| SOX2 | F: TGGACAGTTACGCGCACAT R: CGAGTAGGACATGCTGTAGGT | 215 |
| C-MYC | F: CACCAGCAGCGACTCTGAGGAG R: ACTTGACCCTCTTGGCAGCAGG | 239 |
| OCT4 | F: GCAGCTTGGGCTCGAGAAGGAT R: AGCCCAGAGTGGTGACGGAGAC | 269 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, C.; Chen, K.; Duan, J.; Liu, K.; Li, M.; Chen, Y.; Cong, Z.; Wang, Y. Silencing LY6K Suppresses CD44+ EpCAM+ HCT116 Human Colon Cancer Stem Cells Growth: Insights from In Vitro and In Vivo Evidence. Curr. Issues Mol. Biol. 2024, 46, 14045-14057. https://doi.org/10.3390/cimb46120840
Fu C, Chen K, Duan J, Liu K, Li M, Chen Y, Cong Z, Wang Y. Silencing LY6K Suppresses CD44+ EpCAM+ HCT116 Human Colon Cancer Stem Cells Growth: Insights from In Vitro and In Vivo Evidence. Current Issues in Molecular Biology. 2024; 46(12):14045-14057. https://doi.org/10.3390/cimb46120840
Chicago/Turabian StyleFu, Changhao, Kuiqiao Chen, Jinyue Duan, Kun Liu, Miaomiao Li, Yuanyuan Chen, Zhongyi Cong, and Yi Wang. 2024. "Silencing LY6K Suppresses CD44+ EpCAM+ HCT116 Human Colon Cancer Stem Cells Growth: Insights from In Vitro and In Vivo Evidence" Current Issues in Molecular Biology 46, no. 12: 14045-14057. https://doi.org/10.3390/cimb46120840
APA StyleFu, C., Chen, K., Duan, J., Liu, K., Li, M., Chen, Y., Cong, Z., & Wang, Y. (2024). Silencing LY6K Suppresses CD44+ EpCAM+ HCT116 Human Colon Cancer Stem Cells Growth: Insights from In Vitro and In Vivo Evidence. Current Issues in Molecular Biology, 46(12), 14045-14057. https://doi.org/10.3390/cimb46120840

