Alliin Induces Reconstitution of Testes Damaged by Estrogen Overstimulation by Regulating Apoptosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Mouse Preparation
2.2. Testicular Cell Preparation
2.3. Estradiol and Alliin Injections in Mice
2.4. Enzyme-Linked Immunosorbent Assay (ELISA)
2.5. Immunofluorescence (IF)
2.6. Hematoxylin and Eosin Staining
2.7. Alcian Blue Staining
2.8. Alizarin Red Staining
2.9. Real-Time PCR Analysis
2.10. Western Blotting Analysis
2.11. Immunohistochemistry (IHC)
2.12. Statistical Analysis
3. Results
3.1. Analysis of Cell Survival and Morphological Changes After the Addition of Alliin and Estrogen to Testicular Cells
3.2. Analysis of Morphological Differences in Mouse Testes Treated with Estrogen and Alliin
3.3. Changes and Restructuring of Testicular Tissue Owing to Excessive Stimulation by Hormones
3.4. Changes in IGF/mTOR Signaling After Alliin Treatment
3.5. Effect of Alliin Treatment on the Expression of Key Apoptosis Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Levine, H.; Jørgensen, N.; Martino-Andrade, A.; Mendiola, J.; Weksler-Derri, D.; Mindlis, I.; Pinotti, R.; Swan, S.H. Temporal trends in sperm count: A systematic review and meta-regression analysis. Hum. Reprod. Update 2017, 23, 646–659. [Google Scholar] [CrossRef] [PubMed]
- Shozu, M.; Sebastian, S.; Takayama, K.; Hsu, W.T.; Schultz, R.A.; Neely, K.; Bryant, M.; Bulun, S.E. Estrogen excess associated with novel gain-of-function mutations affecting the aromatase gene. N. Engl. J. Med. 2003, 348, 1855–1865. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Minhas, S.; Dhillo, W.S.; Jayasena, C.N. Male infertility due to testicular disorders. J. Clin. Endocrinol. Metab. 2021, 106, e442–e459. [Google Scholar] [CrossRef] [PubMed]
- Schneider, G.; Kirschner, M.A.; Berkowitz, R.; Ertel, N.H. Increased estrogen production in obese men. J. Clin. Endocrinol. Metab. 1979, 48, 633–638. [Google Scholar] [CrossRef] [PubMed]
- Kley, H.K.; Deselaers, T.; Peerenboom, H.; Kr€uskemper, H.L. Enhanced conversion of androstenedione to estrogens in obese males. J. Clin. Endocrinol. Metab. 1980, 51, 1128–1132. [Google Scholar] [CrossRef]
- Leavy, M.; Trottmann, M.; Liedl, B.; Reese, S.; Stief, C.; Freitag, B.; Baugh, J.; Spagnoli, G.; Kölle, S. Effects of elevated β-estradiol levels on the functional morphology of the testes—New insights. Sci. Rep. 2017, 7, 39931. [Google Scholar] [CrossRef]
- Tan, M.L.; Shen, Y.J.; Chen, Q.L.; Wu, F.R.; Liu, Z.H. Environmentally relevant estrogens impaired spermatogenesis and sexual behaviors in male and female zebrafish. Aquat. Toxicol. 2024, 273, 107008. [Google Scholar] [CrossRef]
- Adeoya-Osiguwa, S.A.; Markoulaki, S.; Pocock, V.; Milligan, S.R.; Fraser, L.R. 17-Beta-estradiol and environmental estrogens significantly affect mammalian sperm function. Hum. Reprod. 2003, 18, 100–107. [Google Scholar] [CrossRef]
- Ded, L.; Sebkova, N.; Cerna, M.; Elzeinova, F.; Dostalova, P.; Peknicova, J.; Dvorakova-Hortova, K. In vivo exposure to 17β -estradiol triggers premature sperm capacitation in cauda epididymis. Reproduction. 2013, 145, 255–263. [Google Scholar] [CrossRef]
- Wahab, N.A.; Mokhtar, N.M.; Halim, W.N.H.A.; Das, S. The effect of Eurycoma longifolia jack on spermatogenesis in estrogen-treated rats. Clinics 2010, 65, 93–98. [Google Scholar] [CrossRef]
- Kaushik, M.C.; Misro, M.M.; Sehgal, N.; Nandan, D. Effect of chronic oestrogen administration on androgen receptor expression in reproductive organs and pituitary of adult male rat. Andrologia. 2010, 42, 193–205. [Google Scholar] [CrossRef] [PubMed]
- Kaushik, M.C.; Misro, M.M.; Sehgal, N.; Nandan, D. AR versus ER (α) Expression in the testes and pituitary following chronic estrogen administration in adult rat. Syst. Biol. Reprod. Med. 2010, 56, 420–430. [Google Scholar] [CrossRef] [PubMed]
- Hess, R.A.; Bunick, D.; Lee, K.H.; Bahr, J.; Taylor, J.A.; Korach, K.S.; Lubahn, D.B. A role for oestrogens in the male reproductive system. Nature 1997, 390, 509–512. [Google Scholar] [CrossRef] [PubMed]
- Melner, M.H.; Abney, T.O. The direct effect of 17β-estradiol on lh-stimulated testosterone production in hypophysectomized rats. J. Steroid Biochem. 1980, 13, 203–210. [Google Scholar] [CrossRef] [PubMed]
- da Rocha, A.B.; Lopes, R.M.; Schwartsmann, G. Natural products in anticancer therapy. Curr. Opin. Pharmacol. 2001, 1, 364–369. [Google Scholar] [CrossRef]
- Kourounakis, P.N.; Rekka, E.A. Effect on active oxygen species of alliin and Allium sativum (garlic) powder. Res. Commun. Chem. Pathol. Pharmacol. 1991, 74, 249–252. [Google Scholar]
- Salman, H.; Bergman, M.; Bessler, H.; Punsky, I.; Djaldetti, M. Effect of a garlic derivative (alliin) on peripheral blood cell immune responses. Int. J. Immunopharmacol. 1999, 21, 589–597. [Google Scholar] [CrossRef]
- Block, E. Garlic and Other Alliums: The Lore and the Science; Royal Society of Chemistry: Cambridge, UK, 2009; pp. 100–106. [Google Scholar]
- Block, E.; Bechand, B.; Gundala, S.; Vattekkatte, A.; Wang, K.; Mousa, S.S.; Godugu, K.; Yalcin, M.; Mousa, S.A. Fluorinated Analog NMR s of Organosulfur Compounds from Garlic (Allium sativum): Synthesis, Chemistry and Anti-Angiogenesis and Antithrombotic Studies. Molecules 2017, 22, 2081. [Google Scholar] [CrossRef]
- Rosas-González, V.C.; Téllez-Bañuelos, M.C.; Hernández-Flores, G.; Bravo-Cuellar, A.; Aguilar-Lemarroy, A.; Jave-Suárez, L.F.; Haramati, J.; Solorzano-Ibarra, F.; Ortiz-Lazareno, P.C. Differential effects of alliin and allicin on apoptosis and senescence in luminal A and triple-negative breast cancer: Caspase, ΔΨm, and pro-apoptotic gene involvement. Fundam Clin. Pharmacol. 2020, 34, 671–686. [Google Scholar] [CrossRef]
- Mansingh, D.P.; Dalpati, N.; Sali, V.K.; Rachel Vasanthi, A.H.R. Alliin the precursor of allicin in garlic extract mitigates proliferation of gastric adenocarcinoma cells by modulating apoptosis. Pharmacogn. Mag. 2018, 14, 84–91. [Google Scholar] [CrossRef]
- Park, Y.S.; Nam, G.H.; Jo, K.J.; Kawk, H.W.; Kim, S.Y.; Kim, Y.M. Extract from Zanthoxylum piperitum Induces Apoptosis of AGS Gastric Cancer Cells Through Akt/MDM2/p53 Signaling Pathway. Chin. J. Integr. Med. 2021, 27, 752–759. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Strauss, L.; Kaatrasalo, A.; Mayerhofer, A.; Huhtaniemi, I.; Santti, R.; Mäkelä, S.; Poutanen, M. Transgenic mice expressing p450 aromatase as a model for male infertility associated with chronic inflammation in the testis. Endocrinology 2006, 147, 1271–1277. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Jung, N.H.; Oh, M.G.; Yoon, J.T. Study on the VEGF gene expression and the role of PMSG hormone in the development of endometrial cancer in mice. J. Anim. Reprod. Biotechnol. 2020, 35, 35–41. [Google Scholar] [CrossRef]
- Oh, M.G.; Kim, S.H. Morphological remodeling in mouse vagina due to hormonal hypersecretion. J. Anim. Reprod. Biotechnol. 2022, 37, 42–47. [Google Scholar] [CrossRef]
- Baggett, B.; Engel, L.L.; Balderas, L.; Lanman, G. Conversion of C14-testosterone to C14-estrogenic steroids by endocrine tissues. Endocrinology 1959, 64, 600–608. [Google Scholar] [CrossRef]
- Chimento, A.; Sirianni, R.; Delalande, C.; Silandre, D.; Bois, C.; Andò, S.; Maggiolini, M.; Carreau, S.; Pezzi, V. 17 Beta-estradiol activates rapid signaling pathways involved in rat pachytene spermatocytes apoptosis through GPR30 and ER alpha. Mol. Cell. Endocrinol. 2010, 320, 136–144. [Google Scholar] [CrossRef]
- Chimento, A.; Sirianni, R.; Casaburi, I.; Pezzi, V. Role of estrogen receptors and G protein-coupled estrogen receptor in regulation of hypothalamus-pituitary-testes axis and spermatogenesis. Front. Endocrinol. 2014, 5, 1. [Google Scholar] [CrossRef]
- Rempuia, V.; Gurusubramanian, G.; Roy, V.K. Differential effect of visfatin inhibition on the testicular androgen and estrogen receptors expression in early pubertal mice. Endocrine 2024, 84, 1216–1228. [Google Scholar] [CrossRef]
- Simões, V.L.; Alves, M.G.; Martins, A.D.; Dias, T.R.; Rato, L.; Socorro, S.; Oliveira, P.F. Regulation of apoptotic signaling pathways by 5α-dihydrotestosterone and 17β-estradiol in immature rat Sertoli cells. J. Steroid Biochem. Mol. Biol. 2013, 135, 15–23. [Google Scholar] [CrossRef]
- Bernardino, R.L.; Alves, M.G.; Silva, J.; Barros, A.; Ferraz, L.; Sousa, M.; Sá, R.; Oliveira, P.F. Expression of estrogen receptors alpha(ER-α), beta(ER-β), and G protein-coupled receptor 30 (GPR30) in testicular tissue of men with Klinefelter syndrome. Horm. Metab. Res. 2016, 48, 413–415. [Google Scholar] [CrossRef]
- Yang, W.-R.; Zhu, F.-W.; Zhang, J.-J.; Wang, Y.; Zhang, J.-H.; Lu, C.; Wang, X.-Z. PI3K/Akt activated by GPR30 and Src regulates 17β-estradiol-induced cultured immature boar Sertoli cells proliferation. Reprod. Sci. 2017, 24, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Chen, D.; Jiang, Z.; Li, J.; Liu, S.; Dong, Y.; Yao, W.; Akingbemi, B.; Ge, R.; Li, X. Effects of estradiol and methoxychlor on Leydig cell regeneration in the adult rat testes. Int. J. Mol. Sci. 2014, 15, 7812–7826. [Google Scholar] [CrossRef] [PubMed]
- Balasubramonian, B.; Selcer, K.W. Steroid sulfatase in mouse liver and testes: Characterization, ontogeny and localization. Steroids 2024, 210, 109483. [Google Scholar] [CrossRef] [PubMed]
- Pinton, P.; Giorgi, C.; Siviero, R.; Zecchini, E.; Rizzuto, R. Calcium and apoptosis: ER-mitochondria Ca2+ transfer in the control of apoptosis. Oncogene 2008, 27, 6407–6418. [Google Scholar] [CrossRef] [PubMed]
- Kroemer, G.; Galluzzi, L.; Brenner, C. Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 2007, 87, 99–163. [Google Scholar] [CrossRef] [PubMed]
- Kroemer, G. Mitochondrial control of apoptosis: An introduction. Biochem. Biophys. Res. Commun. 2003, 304, 433–435. [Google Scholar] [CrossRef]
- Odetayo, A.F.; Akhigbe, R.E.; Hamed, M.A.; Balogun, M.E.; Oluwole, D.T.; Olayaki, L.A. Omega-3 fatty acids abrogates oxido-inflammatory and mitochondrial dysfunction-associated apoptotic responses in testes of tamoxifen-treated rats. Front. Nutr. 2024, 11, 1443895. [Google Scholar] [CrossRef]
Group | Compound | Schedule |
---|---|---|
1 | None | Saline solution (50 μL) was injected for 16 days. |
2 | Estradiol | Estradiol (5 IU/50 μL) was injected for 16 days. |
3 | Alliin | Alliin (6.25 μM/50 μL) was injected for 16 days. |
4 | Estradiol and alliin | Estradiol (5 IU/50 μL) was injected for 16 days. Estradiol was injected for 8 days, and then estradiol (5 IU/50 μL) and aliin (6.25 μM/50 μL) were injected for 8 days. |
5 | Estradiol and alliin | Estradiol (5 IU/50 μL) and alliin 6.25 μM were injected for 16 days. |
Target Gene | NCBI Gene ID | Primer Sequence (5′–3′) | Tm (°C) | |
---|---|---|---|---|
Mos-Gapdh | NM_001289726.2 | Forward Reverse | CCCGTTCGACAGACAGCCGTG CCGCCTTGACTGTGCCGTGG | 56 |
Mos-IGF-1 | NM_001111274.1 | Forward Reverse | TGTCGTCTTCACATCTCTTCTACCTG CCACACACGAACTGAAGAGCGT | 60 |
Mos-PI3K | NM_001024955.2 | Forward Reverse | AGGAGCGGTACAGCAAAGAA GCCGAACACCTTTTTGAGTC | 55 |
Mos-PDK1 | NM_001360002.1 | Forward Reverse | CCGGGCCAGGTGGACTTC GCAATCTTGTCGCAGAAACATAAA | 60 |
Mos-PKC | NM_011101.3 | Forward Reverse | TGGGGTCCTGCTGTATGAGA TCAAAGTTTTCGCCACTGCG | 55 |
Mos-AKT | NM_001165894.2 | Forward Reverse | TGAAAACCTTCTGTGGGACC TGGTCCTGGTTGTAGAAGGG | 55 |
Mos-mTOR | NM_020009.2 | Forward Reverse | CTGGGACTCAAATGTGTGCAGTTC GAACAATAGGGTGAATGATCCGGG | 58 |
Mos-TNF- a | NM_001278601.1 | Forward Reverse | CCACCACGCTCTTCTGTCTAC AGGGTCTGGGCCATAGAACT | 58 |
Mos-Casp-3 | NM_001284409.1 | Forward Reverse | CCTCAGAGAGACATTCATGG GCAGTAGTCGCCTCTGAAGA | 55 |
Mos-Casp-8 | NM_001080126.2 | Forward Reverse | GCAGAAAGTCTGCCTCATCC GGCCTCCATCTATGACCTGA | 55 |
Mos-CytC | NM_025710.2 | Forward Reverse | GAGGCAAGCATAAGACTGGA TACTCCATCAGGGTATCCTC | 52 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, D.-S.; Oh, M.-J.; Kim, S.-H. Alliin Induces Reconstitution of Testes Damaged by Estrogen Overstimulation by Regulating Apoptosis. Curr. Issues Mol. Biol. 2024, 46, 13021-13034. https://doi.org/10.3390/cimb46110776
Kim D-S, Oh M-J, Kim S-H. Alliin Induces Reconstitution of Testes Damaged by Estrogen Overstimulation by Regulating Apoptosis. Current Issues in Molecular Biology. 2024; 46(11):13021-13034. https://doi.org/10.3390/cimb46110776
Chicago/Turabian StyleKim, Dae-Seung, Min-Jee Oh, and Sang-Hwan Kim. 2024. "Alliin Induces Reconstitution of Testes Damaged by Estrogen Overstimulation by Regulating Apoptosis" Current Issues in Molecular Biology 46, no. 11: 13021-13034. https://doi.org/10.3390/cimb46110776
APA StyleKim, D.-S., Oh, M.-J., & Kim, S.-H. (2024). Alliin Induces Reconstitution of Testes Damaged by Estrogen Overstimulation by Regulating Apoptosis. Current Issues in Molecular Biology, 46(11), 13021-13034. https://doi.org/10.3390/cimb46110776