Skeletal Muscle Regeneration by the Exosomes of Adipose Tissue-Derived Mesenchymal Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Isolation and Analysis of Exosomes
2.3. Western Blotting
2.4. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Cell Proliferation Assay
2.6. Immunofluorescent Staining
2.7. Animals
2.8. Muscle Defect Surgery
2.9. Histologic Analyses
2.10. Statistical Analyses
3. Results
3.1. Characterization of MSC-Derived Exosomes
3.2. Effect of Exosomes on Satellite Cells
3.3. Muscle Regeneration after Exosome Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Janssen, I.; Heymsfield, S.B.; Wang, Z.M.; Ross, R. Skeletal muscle mass and distribution in 468 men and women aged 18–88 yr. J. Appl. Physiol. 2000, 89, 81–88. [Google Scholar] [CrossRef] [Green Version]
- Dallas, S.L.; Prideaux, M.; Bonewald, L.F. The osteocyte: An endocrine cell… and more. Endocr. Rev. 2013, 34, 658–690. [Google Scholar] [CrossRef] [Green Version]
- Emmelot-Vonk, M.H.; Verhaar, H.J.; Pour, H.R.N.; Aleman, A.; Lock, T.M.; Bosch, J.R.; Grobbee, D.E.; van der Schouw, Y.T. Effect of testosterone supplementation on functional mobility, cognition, and other parameters in older men: A randomized controlled trial. JAMA 2008, 299, 39–52. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Singh, A.; Sen, D. Mesenchymal stem cells in cardiac regeneration: A detailed progress report of the last 6 years (2010–2015). Stem Cell Res. Ther. 2016, 7, 1–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walpurgis, K.; Thomas, A.; Thevis, M. Detection of the myostatin-neutralizing antibody Domagrozumab in serum by means of Western blotting and LC-HRMS. Drug Test. Anal. 2019, 11, 1714–1723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhattacharya, I.; Manukyan, Z.; Chan, P.; Heatherington, A.; Harnisch, L. Application of quantitative pharmacology approaches in bridging pharmacokinetics and pharmacodynamics of domagrozumab from adult healthy subjects to pediatric patients with Duchenne muscular disease. J. Clin. Pharmacol. 2018, 58, 314–326. [Google Scholar] [CrossRef] [PubMed]
- Bogdanovich, S.; Krag, T.O.; Barton, E.R.; Morris, L.D.; Whittemore, L.-A.; Ahima, R.S.; Khurana, T.S. Functional improvement of dystrophic muscle by myostatin blockade. Nature 2002, 420, 418–421. [Google Scholar] [CrossRef]
- Rahaman, M.N.; Mao, J.J. Stem cell-based composite tissue constructs for regenerative medicine. Biotechnol. Bioeng. 2005, 91, 261–284. [Google Scholar] [CrossRef]
- Phinney, D.G.; Prockop, D.J. Concise review: Mesenchymal stem/multipotent stromal cells: The state of transdifferentiation and modes of tissue repair—Current views. Stem Cells 2007, 25, 2896–2902. [Google Scholar] [CrossRef]
- Schäffler, A.; Büchler, C. Concise review: Adipose tissue-derived stromal cells—basic and clinical implications for novel cell-based therapies. Stem Cells 2007, 25, 818–827. [Google Scholar] [CrossRef]
- Bunnell, B.A.; Flaat, M.; Gagliardi, C.; Patel, B.; Ripoll, C. Adipose-derived stem cells: Isolation, expansion and differentiation. Methods 2008, 45, 115–120. [Google Scholar] [CrossRef] [Green Version]
- Nakagami, H.; Morishita, R.; Maeda, K.; Kikuchi, Y.; Ogihara, T.; Kaneda, Y. Adipose tissue-derived stromal cells as a novel option for regenerative cell therapy. J. Atheroscler. Thromb. 2006, 13, 77–81. [Google Scholar] [CrossRef] [Green Version]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; de Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef] [PubMed]
- Rehman, J.; Traktuev, D.; Li, J.; Merfeld-Clauss, S.; Temm-Grove, C.J.; Bovenkerk, J.E.; Pell, C.L.; Johnstone, B.H.; Considine, R.V.; March, K.L. Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 2004, 109, 1292–1298. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Johnstone, B.H.; Cook, T.G.; Liang, Z.; Traktuev, D.; Cornetta, K.; Ingram, D.A.; Rosen, E.D.; March, K.L. Suppression of hepatocyte growth factor production impairs the ability of adipose-derived stem cells to promote ischemic tissue revascularization. Stem Cells 2007, 25, 3234–3243. [Google Scholar] [CrossRef] [PubMed]
- Nakagami, H.; Maeda, K.; Morishita, R.; Iguchi, S.; Nishikawa, T.; Takami, Y.; Kikuchi, Y.; Saito, Y.; Tamai, K.; Ogihara, T. Novel autologous cell therapy in ischemic limb disease through growth factor secretion by cultured adipose tissue-derived stromal cells. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 2542–2547. [Google Scholar] [CrossRef] [PubMed]
- Gorecka, A.; Salemi, S.; Haralampieva, D.; Moalli, F.; Stroka, D.; Candinas, D.; Eberli, D.; Brügger, L. Autologous transplantation of adipose-derived stem cells improves functional recovery of skeletal muscle without direct participation in new myofiber formation. Stem Cell Res. Ther. 2018, 9, 195. [Google Scholar] [CrossRef]
- Caplan, A.I.; Dennis, J.E. Mesenchymal stem cells as trophic mediators. J. Cell. Biochem. 2006, 98, 1076–1084. [Google Scholar] [CrossRef]
- Xia, C.; Cao, J. Imaging the survival and utility of pre-differentiated allogeneic MSC in ischemic heart. Biochem. Biophys. Res. Commun. 2013, 438, 382–387. [Google Scholar] [CrossRef]
- Lou, G.; Chen, Z.; Zheng, M.; Liu, Y. Mesenchymal stem cell-derived exosomes as a new therapeutic strategy for liver diseases. Exp. Mol. Med. 2017, 49, e346. [Google Scholar] [CrossRef]
- Yu, B.; Zhang, X.; Li, X. Exosomes derived from mesenchymal stem cells. Int. J. Mol. Sci. 2014, 15, 4142–4157. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Zhang, M.; Shi, M.; Zhang, T.; Lu, W.; Yang, S.; Cui, Q.; Li, Z. Adipose-derived mesenchymal stromal cell-derived exosomes promote tendon healing by activating both SMAD1/5/9 and SMAD2/3. Stem Cell Res. Ther. 2021, 12, 338. [Google Scholar] [CrossRef]
- Liu, Z.; Xu, Y.; Wan, Y.; Gao, J.; Chu, Y.; Li, J. Exosomes from adipose-derived mesenchymal stem cells prevent cardiomyocyte apoptosis induced by oxidative stress. Cell Death Discov. 2019, 5, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wagner, W.; Wein, F.; Seckinger, A.; Frankhauser, M.; Wirkner, U.; Krause, U.; Blake, J.; Schwager, C.; Eckstein, V.; Ansorge, W.; et al. Comparative characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and umbilical cord blood. Exp. Hematol. 2005, 33, 1402–1416. [Google Scholar] [CrossRef] [PubMed]
- Barlow, S.; Brooke, G.; Chatterjee, K.; Price, G.; Pelekanos, R.; Rossetti, T.; Doody, M.; Venter, D.; Pain, S.; Gilshenan, K.; et al. Comparison of human placenta-and bone marrow-derived multipotent mesenchymal stem cells. Stem Cells Dev. 2008, 17, 1095–1107. [Google Scholar] [CrossRef] [Green Version]
- Dubey, N.K.; Mishra, V.K.; Dubey, R.; Deng, Y.H.; Tsai, F.C.; Deng, W.P. Revisiting the Advances in Isolation, Characterization and Secretome of Adipose-Derived Stromal/Stem Cells. Int. J. Mol. Sci. 2018, 19, 2200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puissant, B.; Barreau, C.; Bourin, P.; Clavel, C.; Corre, J.; Bousquet, C.; Taureau, C.; Cousin, B.; Abbal, M.; Laharrague, P.; et al. Immunomodulatory effect of human adipose tissue-derived adult stem cells: Comparison with bone marrow mesenchymal stem cells. Br. J. Haematol. 2005, 129, 118–129. [Google Scholar] [CrossRef] [PubMed]
- McIntosh, K.R. Evaluation of cellular and humoral immune responses to allogeneic adipose-derived stem/stromal cells. Methods Mol. Biol. 2011, 702, 133–150. [Google Scholar]
- Gir, P.; Oni, G.; Brown, S.A.; Mojallal, A.; Rohrich, R.J. Human adipose stem cells: Current clinical applications. Plast. Reconstr. Surg. 2012, 129, 1277–1290. [Google Scholar] [CrossRef]
- Zuk, P.A.; Zhu, M.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef] [Green Version]
- Mizuno, H.; Zuk, P.A.; Zhu, M.; Lorenz, H.P.; Benhaim, P.; Hedrick, M.H. Myogenic differentiation by human processed lipoaspirate cells. Plast. Reconstr. Surg. 2002, 109, 199–209, discussion 210–211. [Google Scholar] [CrossRef]
- Zheng, B.; Cao, B.; Li, G.; Huard, J. Mouse adipose-derived stem cells undergo multilineage differentiation in vitro but primarily osteogenic and chondrogenic differentiation in vivo. Tissue Eng. 2006, 12, 1891–1901. [Google Scholar] [CrossRef] [Green Version]
- Bayati, V.; Hashemitabar, M.; Gazor, R.; Nejatbakhsh, R.; Bijannejad, D. Expression of surface markers and myogenic potential of rat bone marrow-and adipose-derived stem cells: A comparative study. Anat. Cell Biol. 2013, 46, 113–121. [Google Scholar] [CrossRef] [Green Version]
- Zimowska, M.; Archacka, K.; Brzoska, E.; Bem, J.; Czerwinska, A.M.; Grabowska, I.; Kasprzycka, P.; Michalczewska, E.; Stepaniec, I.; Soszynska, M.; et al. IL-4 and SDF-1 increase adipose tissue-derived stromal cell ability to improve rat skeletal muscle regeneration. Int. J. Mol. Sci. 2020, 21, 3302. [Google Scholar] [CrossRef]
- Madrigal, M.; Rao, K.S.; Riordan, N.H. A review of therapeutic effects of mesenchymal stem cell secretions and induction of secretory modification by different culture methods. J. Transl. Med. 2014, 12, 260. [Google Scholar] [CrossRef] [Green Version]
- Barreca, M.M.; Cancemi, P.; Geraci, F. Mesenchymal and Induced Pluripotent Stem Cells-Derived Extracellular Vesicles: The New Frontier for Regenerative Medicine? Cells 2020, 9, 1163. [Google Scholar] [CrossRef] [PubMed]
- Ratajczak, J.; Miekus, K.; Kucia, M.; Zhang, J.; Reca, R.; Dvorak, P.; Ratajczak, M. Embryonic stem cell-derived microvesicles reprogram hematopoietic progenitors: Evidence for horizontal transfer of mRNA and protein delivery. Leukemia 2006, 20, 847–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khan, M.; Nickoloff, E.; Abramova, T.; Johnson, J.; Verma, S.K.; Krishnamurthy, P.; Mackie, A.R.; Vaughan, E.; Garikipati, V.N.S.; Benedict, C. Embryonic stem cell-derived exosomes promote endogenous repair mechanisms and enhance cardiac function following myocardial infarction. Circ. Res. 2015, 117, 52–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McBride, J.D.; Rodriguez-Menocal, L.; Guzman, W.; Candanedo, A.; Garcia-Contreras, M.; Badiavas, E.V. Bone marrow mesenchymal stem cell-derived CD63+ exosomes transport Wnt3a exteriorly and enhance dermal fibroblast proliferation, migration, and angiogenesis in vitro. Stem Cells Dev. 2017, 26, 1384–1398. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Chuah, S.J.; Lai, R.C.; Hui, J.H.P.; Lim, S.K.; Toh, W.S. MSC exosomes mediate cartilage repair by enhancing proliferation, attenuating apoptosis and modulating immune reactivity. Biomaterials 2018, 156, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Zheng, J.; Cai, J.; Zeng, K.; Zhou, C.; Zhang, J.; Li, S.; Li, H.; Chen, L.; He, L. Extracellular vesicles derived from human umbilical cord mesenchymal stem cells alleviate rat hepatic ischemia-reperfusion injury by suppressing oxidative stress and neutrophil inflammatory response. FASEB J. 2019, 33, 1695–1710. [Google Scholar] [CrossRef] [Green Version]
- Sedrakyan, S.; Villani, V.; da Sacco, S.; Tripuraneni, N.; Porta, S.; Achena, A.; Lavarreda-Pearce, M.; Petrosyan, A.; Soloyan, H.; de Filippo, R. Amniotic fluid stem cell-derived vesicles protect from VEGF-induced endothelial damage. Sci. Rep. 2017, 7, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, P.; Yang, Q.; Wang, Q.; Shi, C.; Wang, D.; Armato, U.; Prà, I.D.; Chiarini, A. Mesenchymal stromal cells-exosomes: A promising cell-free therapeutic tool for wound healing and cutaneous regeneration. Burn. Trauma 2019, 7. [Google Scholar] [CrossRef]
- Koh, T.J.; DiPietro, L.A. Inflammation and wound healing: The role of the macrophage. Expert Rev. Mol. Med. 2011, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Landén, N.X.; Li, D.; Ståhle, M. Transition from inflammation to proliferation: A critical step during wound healing. Cell. Mol. Life Sci. 2016, 73, 3861–3885. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Liu, L.; Yang, J.; Yu, Y.; Chai, J.; Wang, L.; Ma, L.; Yin, H. Exosome derived from human umbilical cord mesenchymal stem cell mediates MiR-181c attenuating burn-induced excessive inflammation. EBiomedicine 2016, 8, 72–82. [Google Scholar] [CrossRef] [Green Version]
- Midwood, K.S.; Williams, L.V.; Schwarzbauer, J.E. Tissue repair and the dynamics of the extracellular matrix. Int. J. Biochem. Cell Biol. 2004, 36, 1031–1037. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Jiang, C.; Zhao, J. Human endothelial progenitor cells-derived exosomes accelerate cutaneous wound healing in diabetic rats by promoting endothelial function. J. Diabetes Complicat. 2016, 30, 986–992. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Wang, J.; Zhou, X.; Xiong, Z.; Zhao, J.; Yu, R.; Huang, F.; Zhang, H.; Chen, L. Exosomes derived from human adipose mensenchymal stem cells accelerates cutaneous wound healing via optimizing the characteristics of fibroblasts. Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef]
- Zhang, S.; Chu, W.; Lai, R.; Lim, S.; Hui, J.; Toh, W. Exosomes derived from human embryonic mesenchymal stem cells promote osteochondral regeneration. Osteoarthr. Cartil. 2016, 24, 2135–2140. [Google Scholar] [CrossRef] [Green Version]
- Ham, O.; Song, B.-W.; Lee, S.-Y.; Choi, E.; Cha, M.-J.; Lee, C.Y.; Park, J.-H.; Kim, I.-K.; Chang, W.; Lim, S. The role of microRNA-23b in the differentiation of MSC into chondrocyte by targeting protein kinase A signaling. Biomaterials 2012, 33, 4500–4507. [Google Scholar] [CrossRef]
- Ning, G.; Liu, X.; Dai, M.; Meng, A.; Wang, Q. MicroRNA-92a upholds Bmp signaling by targeting noggin3 during pharyngeal cartilage formation. Dev. Cell 2013, 24, 283–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsukawa, T.; Sakai, T.; Yonezawa, T.; Hiraiwa, H.; Hamada, T.; Nakashima, M.; Ono, Y.; Ishizuka, S.; Nakahara, H.; Lotz, M.K. MicroRNA-125b regulates the expression of aggrecanase-1 (ADAMTS-4) in human osteoarthritic chondrocytes. Arthritis Res. Ther. 2013, 15, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, J.S.; Yoon, H.I.; Lee, K.S.; Choi, Y.C.; Yang, S.H.; Kim, I.-S.; Cho, Y.W. Exosomes from differentiating human skeletal muscle cells trigger myogenesis of stem cells and provide biochemical cues for skeletal muscle regeneration. J. Control. Release 2016, 222, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Phinney, D.G.; di Giuseppe, M.; Njah, J.; Sala, E.; Shiva, S.; St Croix, C.M.; Stolz, D.B.; Watkins, S.C.; Di, Y.P.; Leikauf, G.D. Mesenchymal stem cells use extracellular vesicles to outsource mitophagy and shuttle microRNAs. Nat. Commun. 2015, 6, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, Y.; Miyaki, S.; Ishitobi, H.; Matsuyama, S.; Nakasa, T.; Kamei, N.; Akimoto, T.; Higashi, Y.; Ochi, M. Mesenchymal-stem-cell-derived exosomes accelerate skeletal muscle regeneration. FEBS Lett. 2015, 589, 1257–1265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Gasperi, R.; Hamidi, S.; Harlow, L.M.; Ksiezak-Reding, H.; Bauman, W.A.; Cardozo, C.P. Denervation-related alterations and biological activity of miRNAs contained in exosomes released by skeletal muscle fibers. Sci. Rep. 2017, 7, 1–11. [Google Scholar]
- Braun, T.; Gautel, M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat. Rev. Mol. Cell Biol. 2011, 12, 349–361. [Google Scholar] [CrossRef]
- Forterre, A.; Jalabert, A.; Chikh, K.; Pesenti, S.; Euthine, V.; Granjon, A.; Errazuriz, E.; Lefai, E.; Vidal, H.; Rome, S. Myotube-derived exosomal miRNAs downregulate Sirtuin1 in myoblasts during muscle cell differentiation. Cell Cycle 2014, 13, 78–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murphy, C.; Withrow, J.; Hunter, M.; Liu, Y.; Tang, Y.L.; Fulzele, S.; Hamrick, M.W. Emerging role of extracellular vesicles in musculoskeletal diseases. Mol. Asp. Med. 2018, 60, 123–128. [Google Scholar] [CrossRef]
- Guescini, M.; Maggio, S.; Ceccaroli, P.; Battistelli, M.; Annibalini, G.; Piccoli, G.; Sestili, P.; Stocchi, V. Extracellular vesicles released by oxidatively injured or intact C2C12 myotubes promote distinct responses converging toward myogenesis. Int. J. Mol. Sci. 2017, 18, 2488. [Google Scholar] [CrossRef] [Green Version]
- Da Silva Meirelles, L.; Fontes, A.M.; Covas, D.T.; Caplan, A.I. Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytokine Growth Factor Rev. 2009, 20, 419–427. [Google Scholar] [CrossRef]
- Toh, W.S.; Foldager, C.B.; Pei, M.; Hui, J.H.P. Advances in mesenchymal stem cell-based strategies for cartilage repair and regeneration. Stem Cell Rev. Rep. 2014, 10, 686–696. [Google Scholar] [CrossRef]
- Olver, C.; Vidal, M. Proteomic analysis of secreted exosomes. Subcell. Biochem. 2007, 43, 99–131. [Google Scholar] [CrossRef]
- De Paepe, B.; de Bleecker, J.L. Cytokines and chemokines as regulators of skeletal muscle inflammation: Presenting the case of Duchenne muscular dystrophy. Mediat. Inflamm. 2013, 2013, 540370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tidball, J.G.; Villalta, S.A. Regulatory interactions between muscle and the immune system during muscle regeneration. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2010, 298, R1173–R1187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wehling-Henricks, M.; Sokolow, S.; Lee, J.J.; Myung, K.H.; Villalta, S.A.; Tidball, J.G. Major basic protein-1 promotes fibrosis of dystrophic muscle and attenuates the cellular immune response in muscular dystrophy. Hum. Mol. Genet. 2008, 17, 2280–2292. [Google Scholar] [CrossRef] [PubMed]
- Wehling-Henricks, M.; Jordan, M.C.; Gotoh, T.; Grody, W.W.; Roos, K.P.; Tidball, J.G. Arginine metabolism by macrophages promotes cardiac and muscle fibrosis in mdx muscular dystrophy. PLoS ONE 2010, 5, e10763. [Google Scholar] [CrossRef] [Green Version]
- Toh, W.S.; Lai, R.C.; Hui, J.H.P.; Lim, S.K. MSC exosome as a cell-free MSC therapy for cartilage regeneration: Implications for osteoarthritis treatment. Sem. Cell Dev. Biol. 2017, 67, 56–64. [Google Scholar] [CrossRef]
Antibody | Company | Species | Dilution |
---|---|---|---|
CD9 | Invitrogen | Human | 1:1000 |
CD63 | Santa Cruz | Human, rat, mouse | 1:1000 |
CD81 | Invitrogen | Human, rat | 1:1000 |
MYOG | Santa Cruz | Human, rat, mouse | 1:300 |
MYOD | Santa Cruz | Human, rat, mouse | 1:300 |
Gene | Primer Sequence (5′→3′) | |
---|---|---|
MYOG | Forward | GGGGAAAACTACCTGCCTGTC |
Reverse | AGGCGCTCGATGTACTGGAT | |
MYOD | Forward | CGCCATCCGCTATATCGAGG |
Reverse | CTGTAGTCCATCATGCCGTCG | |
PAX7 | Forward | ACCCCTGCCTAACCACATC |
Reverse | GCGGCAAAGAATCTTGGAGAC | |
GAPDH | Forward | ACAACTTTGGTATCGTGGAAGG |
Reverse | GCCATCACGCCACAGTTTC |
Group | Surgery | Scaffold | Exosome | Animal (n) |
---|---|---|---|---|
Healthy control | Mock surgery without muscle defect | N/A | - | 4 |
Gel alone | Muscle defect | Fibrin | - | 6 |
Gel + exosome | Muscle defect | Fibrin | +2 mg/mL | 6 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Byun, S.-E.; Sim, C.; Chung, Y.; Kim, H.K.; Park, S.; Kim, D.K.; Cho, S.; Lee, S. Skeletal Muscle Regeneration by the Exosomes of Adipose Tissue-Derived Mesenchymal Stem Cells. Curr. Issues Mol. Biol. 2021, 43, 1473-1488. https://doi.org/10.3390/cimb43030104
Byun S-E, Sim C, Chung Y, Kim HK, Park S, Kim DK, Cho S, Lee S. Skeletal Muscle Regeneration by the Exosomes of Adipose Tissue-Derived Mesenchymal Stem Cells. Current Issues in Molecular Biology. 2021; 43(3):1473-1488. https://doi.org/10.3390/cimb43030104
Chicago/Turabian StyleByun, Seong-Eun, Changgon Sim, Yoonhui Chung, Hyung Kyung Kim, Sungmoon Park, Do Kyung Kim, Seongmin Cho, and Soonchul Lee. 2021. "Skeletal Muscle Regeneration by the Exosomes of Adipose Tissue-Derived Mesenchymal Stem Cells" Current Issues in Molecular Biology 43, no. 3: 1473-1488. https://doi.org/10.3390/cimb43030104