BuZhong YiQi Formula Alleviates Diabetes-Caused Hyposalivation by Activating Salivary Secretion Pathway in the Parotid and Submandibular Glands of Rats
Abstract
:1. Introduction
2. Results
2.1. Network Pharmacology Analysis of BZYQF
2.2. Molecular Docking of Validated Compounds in BZYQF
2.3. BZYQF Alleviates T2DM
2.4. BZYQF Ameliorated Saliva Secretion and Responsiveness to Citric Acid Stimulation in T2DM Rats
2.5. BZYQF Improved the Levels of Biochemical Indicators and sAA Activity in the PG and SMG of T2DM Rats
2.6. BZYQF Improved the Morphological Structure and sAA Content in the PG and SMG of T2DM Rats
2.7. BZYQF Upregulated mRNA Expression of Inflammatory Factors and Salivary Secretion Pathway Signaling Molecules in the PG and SMG of T2DM Rats
2.8. BZYQF Upregulated Protein Expression of β1-AR, sAA, and CHRM3 of Salivary Secretion Pathway in the PG and SMG of T2DM Rats
3. Discussion
4. Materials and Methods
4.1. Preparation and Constituent Characterization of BZYQF
4.2. Network Pharmacology Analysis
4.3. Molecular Docking
4.4. Induction of T2DM Rats and BZYQF Treatment
4.5. Sample Collection and Processing
4.6. Determination of Biochemical Indicators in Saliva, Salivary Glands, and Serum
4.7. Hematoxylin and Eosin and Immunohistochemical Staining
4.8. Real-Time Quantitative PCR
4.9. Western Blot
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
BZYQF | BuZhong YiQi Formula |
T2DM | type 2 diabetes mellitus |
PG | parotid gland |
SMG | submandibular gland |
SLG | sublingual gland |
TCM | Traditional Chinese Medicine |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
sAA and AMY1 | salivary alpha-amylase |
IL-6 | interleukin-6 |
TNF | tumor necrosis factor |
PKA | protein kinase A |
IP3R | inositol 1,4,5-trisphosphate receptor |
β1-AR | β1 adrenergic receptor |
AQP5 | aquaporin-5 |
CHRM3 | cholinergic receptor |
FBG | fasting blood glucose |
TC | total cholesterol |
TG | triglyceride |
Ach | acetylcholine |
FINS | fasting serum insulin |
MH | metformin hydrochloride |
References
- Kudiyirickal, M.G.; Pappachan, J.M. Diabetes mellitus and oral health. J. Endocrinol. 2015, 49, 27–34. [Google Scholar] [CrossRef]
- Saleh, J.; Figueiredo, M.A.; Cherubini, K.; Salum, F.G. Salivary hypofunction: An update on aetiology, diagnosis and therapeutics. Arch. Oral Biol. 2015, 60, 242–255. [Google Scholar] [CrossRef]
- Sánchez Garrido, I.; Ramírez, L.; Muñoz Corcuera, M.; Garrido, E.; Sánchez, L.; Martínez Acitores, M.L.; Hernández, G.; López-Pintor, R.M. Xerostomia and Salivary Dysfunction in Patients With Diabetes Mellitus. A Cross-Sectional Study. J. Oral Pathol. Med. 2024, 53, 622–636. [Google Scholar] [CrossRef]
- Chibly, A.M.; Aure, M.H.; Patel, V.N.; Hoffman, M.P. Salivary gland function, development, and regeneration. Physiol. Rev. 2022, 102, 1495–1552. [Google Scholar] [CrossRef] [PubMed]
- Song, E.C.; Chung, S.H.; Kim, J.H. Molecular mechanisms of saliva secretion and hyposecretion. Eur. J. Oral Sci. 2024, 132, e12969. [Google Scholar] [CrossRef] [PubMed]
- Humphrey, S.P.; Williamson, R.T. A review of saliva: Normal composition, flow, and function. J. Prosthet. Dent. 2001, 85, 162–169. [Google Scholar] [CrossRef] [PubMed]
- Rohleder, N.; Nater, U.M. Determinants of salivary alpha-amylase in humans and methodological considerations. Psychoneuroendocrinology 2009, 34, 469–485. [Google Scholar] [CrossRef]
- Chen, S.Y.; Wang, Y.; Zhang, C.L.; Yang, Z.M. Decreased basal and stimulated salivary parameters by histopathological lesions and secretory dysfunction of parotid and submandibular glands in rats with type 2 diabetes. Exp. Ther. Med. 2020, 19, 2707–2719. [Google Scholar] [CrossRef]
- Bhattarai, K.R.; Lee, H.Y.; Kim, S.H.; Kim, H.R.; Chae, H.J. Ixeris dentata Extract Increases Salivary Secretion through the Regulation of Endoplasmic Reticulum Stress in a Diabetes-Induced Xerostomia Rat Model. Int. J. Mol. Sci. 2018, 19, 1059. [Google Scholar] [CrossRef]
- Lee, H.Y.; Gu, M.; Cheng, J.; Suh, J.W.; Chae, H.J. Ixeris dentata and Lactobacillus gasseri Extracts Improve Salivary Secretion Capability in Diabetes-Associated Dry Mouth Rat Model. Nutrients 2020, 12, 1331. [Google Scholar] [CrossRef]
- Huang, Y.; Mao, Q.Y.; Shi, X.J.; Cong, X.; Zhang, Y.; Wu, L.L.; Yu, G.Y.; Xiang, R.L. Disruption of tight junctions contributes to hyposalivation of salivary glands in a mouse model of type 2 diabetes. J. Anat. 2020, 237, 556–567. [Google Scholar] [CrossRef] [PubMed]
- Grunberger, G. Should Side Effects Influence the Selection of Antidiabetic Therapies in Type 2 Diabetes? Curr. Diab. Rep. 2017, 17, 21. [Google Scholar] [CrossRef]
- Chambers, M.S.; Rosenthal, D.I.; Weber, R.S. Radiation-induced xerostomia. Head Neck 2007, 29, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Takashi, I.; Kanai, R.; Hasegawa, K.; Ogaeri, T.; Tran, S.D.; Sumita, Y. Recent progress in regenerative therapy for damaged salivary glands: From bench to bedside. Oral Dis. 2024, 30, 38–49. [Google Scholar] [CrossRef]
- Badooei, F.; Imani, E.; Hosseini-Teshnizi, S.; Banar, M.; Memarzade, M. Comparison of the effect of ginger and aloe vera mouthwashes on xerostomia in patients with type 2 diabetes: A clinical trial, triple-blind. Med. Oral Patol. Oral Cir. Bucal 2021, 26, e408–e413. [Google Scholar] [CrossRef]
- Zhao, Z.Y.; Gao, Z.J.; Chen, P.Y. Comparative study on the effects of dark plum and lemon spray on salivation and drymouth degree of xerostomia in patients with diabetes. Clin. Nurs. Res. 2019, 33, 2400–2403. [Google Scholar]
- Yang, Z.M.; Chen, W.W. Research progress on the correlation between spleen deficiency syndrome and disturbance of material and energy metabolism. Tradit. Chin. Med. 2012, 29, 332–336. [Google Scholar] [CrossRef]
- Yang, Z.M.; Chen, L.H.; Lin, J.; Zhang, M.; Yang, X.R.; Chen, W.W. Effect of Citric Acid Stimulation on Salivary Alpha-amylase, Total Protein, Salivary Flow Rate and pH Value in Pi Deficiency Children. Chin. J. Integr. Tradit. West. Med. 2015, 35, 188–192. [Google Scholar]
- Zheng, X.F.; Tian, J.S.; Liu, P.; Xing, J.; Qin, X.M. Analysis of the restorative effect of Bu-zhong-yi-qi-tang in the spleen-qi deficiency rat model using 1H-NMR-based metabonomics. J. Ethnopharmacol. 2014, 151, 912–920. [Google Scholar] [CrossRef]
- Hu, L.; Yamamoto, M.; Chen, J.; Duan, H.; Du, J.; He, L.; Shi, D.; Yao, X.; Nagai, T.; Kiyohara, H.; et al. Integrating network pharmacology and experimental verification to decipher the immunomodulatory effect of Bu-Zhong-Yi-Qi-Tang against poly (I:C)-induced pulmonary inflammation. Front. Pharmacol. 2022, 13, 1015486. [Google Scholar] [CrossRef]
- Sheng, Q. Effects of BuZhong Yiqi Decoction on blood glucose, HOMA-IR and HOMA-IS in diabetic patients. Mod. Med. Health Res. 2020, 4, 66–67. [Google Scholar]
- Li, N.; Duan, C.M.; Hu, M.E. Effect of BuZhong Yiqi decoction on blood glucose and islet function in patients with type 2 diabetes. Shanxi J. Tradit. Chin. Med. 2019, 35, 21–23. [Google Scholar]
- Xu, J.; Sun, Q.; Qiu, M.; Wu, Y.; Cheng, L.; Jiang, N.; Zhang, R.; Chen, J.; Yuan, W.; Jin, H.; et al. Exploring the pharmacological mechanism of Glycyrrhiza uralensis against KOA through integrating network pharmacology and experimental assessment. J. Cell. Mol. Med. 2024, 28, e18319. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, Y.; Li, C.; Liu, D.; Cai, Y.; Li, Q. Anti-epileptic mechanism of isopimaric acid from Platycladi cacumen based on network pharmacology, molecular docking and biological validation. Exp. Ther. Med. 2024, 28, 348. [Google Scholar] [CrossRef]
- Villa, A.; Connell, C.L.; Abati, S. Diagnosis and management of xerostomia and hyposalivation. Ther. Clin. Risk Manag. 2015, 11, 45–51. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.R.; Jung, W.K.; Park, S.B.; Ryu, H.Y.; Kim, Y.H.; Kim, J. Polydatin Alleviates Diabetes-Induced Hyposalivation through Anti-Glycation Activity in db/db Mouse. Pharmaceutics 2021, 14, 51. [Google Scholar] [CrossRef]
- Luo, M.J.; Wang, Y.; Chen, S.Y.; Yang, Z.M. Astragalus Polysaccharides Alleviate Type 2 Diabetic Rats by Reversing the Expressions of Sweet Taste Receptors and Genes Related to Glycolipid Metabolism in Liver. Front. Pharmacol. 2022, 13, 916603. [Google Scholar] [CrossRef]
- Liu, X.Q.; Wu, L.; Guo, X.J. Effect of Bu-Zhong-Yi-Qi-Tang on deficiency of N-glycan/nitric oxide and islet damage induced by streptozotocin in diabetic rats. World J. Gastroenterol. 2009, 15, 1730–1737. [Google Scholar] [CrossRef]
- Yang, Z.-M.; Wang, Y.; Chen, S.-Y. Astragalus polysaccharide alleviates type 2 diabetic rats by reversing the glucose transporters and sweet taste receptors/GLP-1/GLP-1 receptor signaling pathways in the intestine-pancreatic axis. J. Funct. Foods 2021, 76, 104310. [Google Scholar] [CrossRef]
- Li, S.W.; Wei, Q.Q.; Song, X.; Zhang, H.; Jiao, Y.P. Study on antioxidant and hypoglycemic activities of Codonopsis pilosula polysaccharide. Clin. Res. Pract. 2020, 5, 8–11. [Google Scholar] [CrossRef]
- Song, P.; Na, N.; Wang, Y. Effects of saikosaponin D on insulin resistance and FoxO1/PGC-1α pathway in type 2 diabetic rats. Chin. J. Immunol. 2023, 39, 1425–1430. [Google Scholar]
- Zhang, B.N.; Zhang, D.P. Determination of Salivary Amylase Content in 30 Patients with Spleen Deficiency Type 2 Diabetes Mellitus. Tradit. Chin. Med. Res. 2012, 25, 20–22. [Google Scholar]
- Wang, X.; Niu, M.; Fang, Y.; Wu, S. Evaluation of parotid gland function in type 2 diabetes patients using diffusion-weighted imaging before and after acid stimulation. Int. J. Diabetes Dev. Ctries. 2023, 43, 274–280. [Google Scholar] [CrossRef]
- Chen, L.H.; Yang, Z.M.; Chen, W.W.; Lin, J.; Zhang, M.; Yang, X.R.; Zhao, L.B. Attenuated acute salivary α-amylase responses to gustatory stimulation with citric acid in thin children. Br. J. Nutr. 2015, 113, 1078–1085. [Google Scholar] [CrossRef]
- Panchbhai, A.S.; Degwekar, S.S.; Bhowte, R.R. Estimation of salivary glucose, salivary amylase, salivary total protein and salivary flow rate in diabetics in India. J. Oral Sci. 2010, 52, 359–368. [Google Scholar] [CrossRef] [PubMed]
- Mandel, A.L.; Breslin, P.A. High endogenous salivary amylase activity is associated with improved glycemic homeostasis following starch ingestion in adults. J. Nutr. 2012, 142, 853–858. [Google Scholar] [CrossRef]
- Elder, P.J.D.; Ramsden, D.B.; Burnett, D.; Weickert, M.O.; Barber, T.M. Human amylase gene copy number variation as a determinant of metabolic state. Expert Rev. Endocrinol. Metab. 2018, 13, 193–205. [Google Scholar] [CrossRef] [PubMed]
- Holmberg, K.V.; Hoffman, M.P. Anatomy, biogenesis and regeneration of salivary glands. Monogr. Oral Sci. 2014, 24, 1–13. [Google Scholar] [CrossRef]
- Valstar, M.H.; de Bakker, B.S.; Steenbakkers, R.; de Jong, K.H.; Smit, L.A.; Klein Nulent, T.J.W.; van Es, R.J.J.; Hofland, I.; de Keizer, B.; Jasperse, B.; et al. The tubarial salivary glands: A potential new organ at risk for radiotherapy. Radiother. Oncol. 2021, 154, 292–298. [Google Scholar] [CrossRef]
- Tandler, B.; Gresik, E.W.; Nagato, T.; Phillips, C.J. Secretion by striated ducts of mammalian major salivary glands: Review from an ultrastructural, functional, and evolutionary perspective. Anat. Rec. 2001, 264, 121–145. [Google Scholar] [CrossRef]
- Sato, T.; Mito, K.; Ishii, H. Relationship between impaired parasympathetic vasodilation and hyposalivation in parotid glands associated with type 2 diabetes mellitus. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2020, 318, R940–R949. [Google Scholar] [CrossRef] [PubMed]
- Kołodziej, U.; Maciejczyk, M.; Miąsko, A.; Matczuk, J.; Knaś, M.; Żukowski, P.; Żendzian-Piotrowska, M.; Borys, J.; Zalewska, A. Oxidative Modification in the Salivary Glands of High Fat-Diet Induced Insulin Resistant Rats. Front. Physiol. 2017, 8, 20. [Google Scholar] [CrossRef]
- Hassan, S.S.; Alqahtani, M.S. Comparative Study of Cytokeratin Immunostaining of Parotid Gland Parenchyma in Normal, Diabetic, and Excretory Duct Ligation of Mongrel Dogs. Eur. J. Dent. 2023, 17, 678–686. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, Y.; Munemasa, T.; Nodai, T.; Mukaibo, T.; Kondo, Y.; Masaki, C.; Hosokawa, R. Application of anti-vascular endothelial growth factor antibody restores the function of saliva secretion in a type 2 diabetes mouse model. J. Oral Biosci. 2024, 66, 619–627. [Google Scholar] [CrossRef]
- Proctor, G.B.; Carpenter, G.H. Regulation of salivary gland function by autonomic nerves. Auton. Neurosci. 2007, 133, 3–18. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J. Xerostomia and Its Cellular Targets. Int. J. Mol. Sci. 2023, 24, 5358. [Google Scholar] [CrossRef]
- Feldman, E.L.; Callaghan, B.C.; Pop-Busui, R.; Zochodne, D.W.; Wright, D.E.; Bennett, D.L.; Bril, V.; Russell, J.W.; Viswanathan, V. Diabetic neuropathy. Nat. Rev. Dis. Primers 2019, 5, 42. [Google Scholar] [CrossRef]
- Ma, T.; Song, Y.; Gillespie, A.; Carlson, E.J.; Epstein, C.J.; Verkman, A.S. Defective secretion of saliva in transgenic mice lacking aquaporin-5 water channels. J. Biol. Chem. 1999, 274, 20071–20074. [Google Scholar] [CrossRef]
- Zeng, X.X.; Wang, L.; Wang, M.Y.; Hu, Z.R.; Li, X.K.; Fei, G.J.; Ling, L.; Fan, Y.T.; Yang, Z.M. BuZhong YiQi Formula Alleviates Postprandial Hyperglycemia in T2DM Rats by Inhibiting α-Amylase and α-Glucosidase In Vitro and In Vivo. Pharmaceuticals 2025, 18, 210. [Google Scholar] [CrossRef]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef]
- Zhang, N.S. Discussion on the clinical application law of middle-reinforcing and qi-benifiting (BuZhong YiQi) decoction. J. Beijing Univ. Tradit. Chin. Med. 1995, 18, 16–18+72. [Google Scholar]
- Tang, S.M.; Li, H.Z.; Chen, W.Q.; Yuan, Q.F.; Yang, Z.M. Comparison of Therapeutic Effects of Astragalus Polysaccharide and Metformin on Rats with Type 2 Diabetes Mellitus. Guiding J. Tradit. Chin. Med. Pharm. 2017, 23, 12–16. [Google Scholar] [CrossRef]
- LIN, J.; LU, Q.; YANG, Z.M. Evaluation of Saliva Collection Method in Rat Model of Spleen-deficiency by Using Salivary Alpha-amylase Activity Index. J. Basic Chin. Med. 2016, 22, 909–911+924. [Google Scholar] [CrossRef]
- Wang, H.; He, L.; Liu, Z.; Xu, X.; Zhang, H.; Mao, P.; Li, M. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway. Open Med. 2023, 18, 20230770. [Google Scholar] [CrossRef]
Compounds | Class I | Sources | Compounds | Class I | Sources |
---|---|---|---|---|---|
isorhamnetin | Flavonoids | CaiHu, HuangQi, GanCao | Mairin | Terpenoids | HuangQi, GanCao |
kaempferol | Flavonoids | CaiHu, HuangQi, GanCao | Licoricone | Flavonoids | GanCao |
Licochalcone B | Flavonoids | GanCao | petunidin | Flavonoids | CaiHu |
naringenin | Flavonoids | ChenPi | Atractylenolide I | Terpenoids | BaiZhu |
Nicotinic Acid | Others (Vitamin) | DangGui | Atractylenolide II | Terpenoids | DangShen |
quercetin | Flavonoids | CaiHu, HuangQi, GanCao | Formononetin | Flavonoids | GanCao |
Jaranol | Flavonoids | HuangQi |
Group | N | Glucose (mmol/L) | TC (mmol/L) | TG (mmol/L) | Ach (μg/mL) | FINS (μU/mL) | HOMA-IS |
---|---|---|---|---|---|---|---|
CON | 8 | 5.93 ± 0.53 *** | 1.89 ± 0.20 ** | 0.71 ± 0.17 ** | 21.50 ± 1.87 ** | 13.71 ± 1.79 *** | 120.27 ± 43.84 *** |
T2DM | 7 | 23.22 ± 2.54 | 4.85 ± 2.62 | 5.39 ± 3.71 | 16.47 ± 2.40 | 5.37 ± 1.12 | 5.54 ± 1.39 |
BZYQF | 8 | 19.81 ± 1.08 ** | 2.72 ± 0.81 * | 2.30 ± 1.11 * | 31.18 ± 3.76 *** | 10.44 ± 3.68 ** | 12.99 ± 4.90 ** |
MH | 6 | 19.06 ± 1.66 ** | 3.43 ± 1.25 | 1.75 ± 0.70 * | 31.02 ± 3.98 *** | - | - |
Group | N | Salivary Flow Rate | Total Protein Content | Protein Secretion Rate | sAA Activity | sAA Specific Activity |
---|---|---|---|---|---|---|
CON | 8 | 26.73 ± 13.07 * | 0.77 ± 0.43 * | 0.04 ± 0.11 | 3.32 ± 1.26 *** | 0.94 ± 0.82 * |
T2DM | 8 | 15.83 ± 3.86 | 0.19 ± 0.59 | 0.10 ± 0.17 | 0.47 ± 0.54 | 0.23 ± 0.33 |
BZYQF | 8 | 29.98 ± 15.06 * | 0.74 ± 0.37 * | 0.05 ± 0.11 | 2.63 ± 0.93 *** | 0.74 ± 0.52 * |
MH | 6 | 30.94 ± 14.57 * | 0.56 ± 0.29 | 0.10 ± 0.05 | 1.72 ± 1.30 * | 0.15 ± 0.29 |
CON (N = 8) | T2DM (N = 8) | BZYQF (N = 8) | ||||
---|---|---|---|---|---|---|
PG | SMG | PG | SMG | PG | SMG | |
Glucose (mmol/L) | 0.12 ± 0.04 *** | 0.05 ± 0.01 ## | 0.51 ± 0.17 | 0.25 ± 0.16 | 0.35 ± 0.09 * | 0.10 ± 0.04 # |
TC (mmol/L) | 0.21 ± 0.07 ** | 0.09 ± 0.05 | 0.36 ± 0.07 | 0.13 ± 0.02 | 0.28 ± 0.07 | 0.11 ± 0.03 |
TG (mmol/L) | 0.75 ± 0.34 *** | 0.28 ± 0.09 | 2.48 ± 0.48 | 0.30 ± 0.15 | 1.40 ± 1.10 * | 0.22 ± 0.08 |
sAA activity (U/mL) | 1.19 ± 0.16 *** | 2.00 ± 0.15 ### | 0.52 ± 0.40 | 1.05 ± 0.24 | 1.11 ± 0.31 ** | 1.81 ± 0.56 ## |
Ach (mg/g) | 1.30 ± 0.16 *** | 1.48 ± 0.16 ### | 0.78 ± 0.07 | 0.98 ± 0.10 | 1.07 ± 0.16 ** | 1.21 ± 0.12 ## |
Total protein (mg/mL) | 4.91 ± 0.45 | 8.60 ± 0.49 | 4.75 ± 0.56 | 8.55 ± 0.38 | 4.88 ± 0.44 | 8.97 ± 0.48 |
Chinese Name | Latin Name | English Name | Part Used | Dosage |
---|---|---|---|---|
HuangQi | Astragalus membranaceus (Fisch.) Bunge | Astragali radix | Root | 200 g |
DangShen | Codonopsis pilosula (Franch.) Nannf | Codonopsis radix | Root | 60 g |
GanCao | Glycyrhiza uralensis Fisch. | Glycyrrhizae radix et rhizoma Praeparata cum melle | Root | 100 g |
BaiZhu | Atractylodes macrocephala Koidz. | Atractylodis macrocephalae Rhizoma | Root | 60 g |
DangGui | Angelica sinensis [Oliv.] Diels. | Angelicae sinensis radix | Root | 60 g |
ChenPi | Citrus reticulata Blanco. | Citri reticulatae pericarpium | Pericarp | 60 g |
ShengMa | Cimicifuga heracleifolia Kom | Cimicifugae rhizoma | Root | 60 g |
ChaiHu | Bupleurum chinense DC. | Bupleuri radix | Root | 60 g |
ShengJiang | Zingiber offcinale Roscoe. | Rhizoma zingiberis recens | Root | 20 g |
DaZao | Ziziphus jujuba Mill. | Chinese-date | 40 g |
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Product Size |
---|---|---|---|
IL-6 | AGGAGTGGCTAAGGACCAAGACC | TGCCGAGTAGACCTCATAGTGACC | 85 bp |
TNF-α | GCATGATCCGAGATGTGGAACTGG | CGCCACGAGCAGGAATGAGAAG | 113 bp |
PKA | GGACAAGCAGAAGGTGGTGAAGC | ACCAGGCACGTACTCCATGACC | 154 bp |
IP3R | CCGTACAAGTACGTGCTGCGTCTC | GCCGATCTGAGACTGCATGACGC | 146 bp |
β1-AR | CTCATCGTGCTGCTCATCGTAGTG | GATGAAGAGGTTGGTGAGCGTCTG | 93 bp |
AQP5 | CAACAACACAACGCCTGGCAAG | AGAGTCGGTGGAGGAGAAGATGC | 88 bp |
CHRM3 | CGGTCGCTGTCACTTCTGGTTC | CGCTGCTGCTGTGGTCTTGG | 80 bp |
AMY1 | CTGGTTGATACAAGTTGATGAGAG | TATCAACCCAGCGCCACTC | 420 bp |
β-actin | GGAGATTACTGCCCTGGCTCCTA | GACTCATCGTACTCCTGCTTGCTG | 150 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.-Y.; Hu, Z.-R.; Wang, L.; Zeng, X.-X.; Li, X.-K.; Fei, G.-J.; Zhang, J.-L.; Chen, J.-R.; Yang, Z.-M. BuZhong YiQi Formula Alleviates Diabetes-Caused Hyposalivation by Activating Salivary Secretion Pathway in the Parotid and Submandibular Glands of Rats. Pharmaceuticals 2025, 18, 377. https://doi.org/10.3390/ph18030377
Wang M-Y, Hu Z-R, Wang L, Zeng X-X, Li X-K, Fei G-J, Zhang J-L, Chen J-R, Yang Z-M. BuZhong YiQi Formula Alleviates Diabetes-Caused Hyposalivation by Activating Salivary Secretion Pathway in the Parotid and Submandibular Glands of Rats. Pharmaceuticals. 2025; 18(3):377. https://doi.org/10.3390/ph18030377
Chicago/Turabian StyleWang, Ming-Yu, Zhen-Ran Hu, Liang Wang, Xin-Xin Zeng, Xiang-Ke Li, Guo-Jun Fei, Jing-Li Zhang, Jing-Ru Chen, and Ze-Min Yang. 2025. "BuZhong YiQi Formula Alleviates Diabetes-Caused Hyposalivation by Activating Salivary Secretion Pathway in the Parotid and Submandibular Glands of Rats" Pharmaceuticals 18, no. 3: 377. https://doi.org/10.3390/ph18030377
APA StyleWang, M.-Y., Hu, Z.-R., Wang, L., Zeng, X.-X., Li, X.-K., Fei, G.-J., Zhang, J.-L., Chen, J.-R., & Yang, Z.-M. (2025). BuZhong YiQi Formula Alleviates Diabetes-Caused Hyposalivation by Activating Salivary Secretion Pathway in the Parotid and Submandibular Glands of Rats. Pharmaceuticals, 18(3), 377. https://doi.org/10.3390/ph18030377