Novel Insights into Amlodipine-Induced Gingival Enlargement: A Clinical and Molecular Perspective
Abstract
1. Introduction
2. Results
2.1. Sociodemographic Characteristics, Clinical Characteristics, and Quality of Life
2.2. Cytokine Profile in Gingival Tissue
2.3. Relative Expression of Growth Factors in Gingival Tissue
2.4. Oxidative Status
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Sampling
4.3. Inclusion and Exclusion Criteria
4.4. Study Population Size
4.5. Procedure
4.6. RT-PCR
4.7. Colorimetric Assays
4.8. Statistical Analysis
5. Conclusions
Limitations
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brown, R.S.; Arany, P.R. Mechanism of Drug-Induced Gingival Overgrowth Revisited: A Unifying Hypothesis. Oral Dis. 2015, 21, e51–e61. [Google Scholar] [CrossRef] [PubMed]
- Gaur, S.; Agnihotri, R. Is Dental Plaque the Only Etiological Factor in Amlodipine-Induced Gingival Overgrowth? A Systematic Review of Evidence. J. Clin. Exp. Dent. 2018, 10, e610–e619. [Google Scholar] [CrossRef]
- Kose, K.N.; Yilmaz, S.; Noyan, U.; Kuru, B.; Yildirim, H.S.; Agrali, O.B.; Ozener, H.O.; Kuru, L. The Gingival Crevicular Fluid Levels of Growth Factors in Patients with Amlodipine-Induced Gingival Overgrowth: A Pilot Study. Niger. J. Clin. Pract. 2020, 23, 561–567. [Google Scholar] [CrossRef]
- Quenel, L.; Keribin, P.; Giran, G.; Tessier, M.H.; Lesclous, P. Amlodipine-Induced Gingival Enlargement: A Case Report. J. Stomatol. Oral Maxillofac. Surg. 2020, 121, 308–311. [Google Scholar] [CrossRef]
- Portnoy, P.S.; Lee, S.Y.; McMullen, A.; Qu, V. Amlodipine-Induced Gingival Overgrowth: A Health Justice Issue. J. Nurse Pract. 2022, 18, 123–127. [Google Scholar] [CrossRef]
- Ramírez-Rámiz, A.; Brunet-LLobet, L.; Lahor-Soler, E.; Miranda-Rius, J. On the Cellular and Molecular Mechanisms of Drug-Induced Gingival Overgrowth. Open Dent. J. 2017, 11, 420–435. [Google Scholar] [CrossRef]
- Meriem, B.S.; Nouha, B.M.; Ines, J.; Khaled, T.; Manel, B.S.; Insaf, H.; Ahmed, L.; Mouna, H.; Sabra, A.; Habib, S. Amlodipine-Induced Gingival Hyperplasia in a Patient Undergoing Peritoneal Dialysis. Skinmed 2022, 20, 392–394. [Google Scholar]
- Bhandari, S.; Siwakoti, S.; Shrestha, S.; Gautam, K.; Bhandari, S. Drug-Induced Gum Overgrowth with Low-Dose Amlodipine: A Case Report. Cureus 2022, 14, e24857. [Google Scholar] [CrossRef] [PubMed]
- Reddy, S.C.; Midha, N.; Chhabra, V.; Kumar, D.; Bohra, G.K. Amlodipine Induced Gum Hypertrophy: A Rare Case Report. Curr. Drug Saf. 2022, 17, 281–283. [Google Scholar]
- Butera, A.; Gallo, S.; Maiorani, C.; Preda, C.; Chiesa, A.; Esposito, F.; Pascadopoli, M.; Scribante, A. Management of Gingival Bleeding in Periodontal Patients with Domiciliary Use of Toothpastes Containing Hyaluronic Acid, Lactoferrin, or Paraprobiotics: A Randomized Controlled Clinical Trial. Appl. Sci. 2021, 11, 8586. [Google Scholar] [CrossRef]
- Damdoum, M.; Varma, S.R.; Nambiar, M.; Venugopal, A. Calcium Channel Blockers Induced Gingival Overgrowth: A Comprehensive Review from a Dental Perspective. J. Int. Soc. Prev. Community Dent. 2022, 12, 309–322. [Google Scholar]
- Seymour, R.A.; Ellis, J.S.; Thomason, J.M. Risk Factors for Drug-Induced Gingival Overgrowth. J. Clin. Periodontol. 2000, 27, 217–223. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.S.; Tsai, C.H.; Kuan, Y.H.; Huang, F.M.; Chang, Y.C. The Upregulation of Transglutaminase-2 by Cyclosporin A in Human Gingival Fibroblasts is Augmented by Oxidative Stress. J. Periodontol. 2013, 84, 1469–1475. [Google Scholar] [CrossRef]
- Chin, Y.T.; Tu, H.P.; Lin, C.Y.; Kuo, P.J.; Chiu, H.C.; Liu, S.H.; Lee, S.Y.; Fu, E. Antioxidants Protect against Gingival Overgrowth Induced by Cyclosporine A. J. Periodontal Res. 2021, 56, 397–407. [Google Scholar] [CrossRef] [PubMed]
- Becerik, S.; Celec, P.; Gürkan, A.; Öztürk, V.Ö.; Kamodyova, N.; Atilla, G.; Emingil, G. Gingival Crevicular Fluid and Plasma Levels of Transglutaminase-2 and Oxidative Stress Markers in Cyclosporin A-Induced Gingival Overgrowth. J. Periodontol. 2016, 87, 1508–1516. [Google Scholar] [CrossRef]
- Sume, S.S.; Berker, E.; Ilarslan, Y.; Ozer Yucel, O.; Tan, C.; Goyushov, S.; Gultekin, S.E.; Tezcan, I. Elevated Interleukin-17A Expression in Amlodipine-Induced Gingival Overgrowth. J. Periodontal Res. 2020, 55, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Triveni, M.G.; Rudrakshi, C.; Mehta, D.S. Amlodipine-Induced Gingival Overgrowth. J. Indian Soc. Periodontol. 2009, 13, 160–163. [Google Scholar]
- Guttal, K.S.; Karkera, N.; Arunkumar, S.; Nandimath, K. Assessment of Effects of Duration and Dosage of Amlodipine on Gingival Health: A Prospective Study. J. Global Oral Health 2023, 5, 99–104. [Google Scholar] [CrossRef]
- Teoh, L.; Stewart, K.; Moses, G. Where Are Oral and Dental Adverse Drug Effects in Product Information? Int. J. Pharm. Pract. 2020, 28, 591–598. [Google Scholar] [CrossRef]
- Spiering, W.; Grobbee, D.E. Bloeddrukstreefwaarden bij Hypertensiebehandeling; hoe Laag is het Best? [Target Blood Pressure Values in Hypertension Treatment; How Low is Optimal?]. Ned. Tijdschr. Voor Geneeskd. 2013, 157, A5638. [Google Scholar]
- Gebremichael, G.B.; Berhe, K.K.; Zemichael, T.M. Uncontrolled Hypertension and Associated Factors Among Adult Hypertensive Patients in Ayder Comprehensive Specialized Hospital, Tigray, Ethiopia, 2018. BMC Cardiovasc. Disord. 2019, 19, 121. [Google Scholar] [CrossRef] [PubMed]
- Umeizudike, K.A.; Olawuyi, A.B.; Umeizudike, T.I.; Olusegun-Joseph, A.D.; Bello, B.T. Effect of Calcium Channel Blockers on Gingival Tissues in Hypertensive Patients in Lagos, Nigeria: A Pilot Study. Contemp. Clin. Dent. 2017, 8, 565–570. [Google Scholar] [CrossRef]
- Bajkovec, L.; Mrzljak, A.; Likic, R.; Alajbeg, I. Drug-Induced Gingival Overgrowth in Cardiovascular Patients. World J. Cardiol. 2021, 13, 68–75. [Google Scholar] [CrossRef] [PubMed]
- Spanemberg, J.C.; Cardoso, J.A.; Slob, E.M.G.B.; López-López, J. Quality of Life Related to Oral Health and Its Impact in Adults. J. Stomatol. Oral Maxillofac. Surg. 2019, 120, 234–239. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Gonzalez, J.; Mora-Fernandez, C.; Gomez-Chinchon, M.; Muros, M.; Herrera, H.; Garcia, J. Serum and Gene Expression Profile of Tumor Necrosis Factor-α and Interleukin-6 in Hypertensive Diabetic Patients: Effect of Amlodipine Administration. Int. J. Immunopathol. Pharmacol. 2010, 23, 51–59. [Google Scholar] [CrossRef]
- Mohler, E.R.; Sorensen, L.C.; Ghali, J.K.; Schocken, D.D.; Willis, P.W.; Bowers, J.A.; Cropp, A.B.; Pressler, M.L. Role of Cytokines in the Mechanism of Action of Amlodipine: The PRAISE Heart Failure Trial. J. Am. Coll. Cardiol. 1997, 30, 35–41. [Google Scholar] [CrossRef]
- Malcolm, J.; Awang, R.A.; Oliver-Bell, J.; Butcher, J.P.; Campbell, L.; Adrados Planell, A.; Lappin, D.F.; Fukada, S.Y.; Nile, C.J.; Liew, F.Y.; et al. IL-33 Exacerbates Periodontal Disease Through Induction of RANKL. J. Dent. Res. 2015, 94, 968–975. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Gao, M.; Yi, Z. Biological Effects of IL-33/ST2 Axis on Oral Diseases: Autoimmune Diseases and Periodontal Diseases. Int. Immunopharmacol. 2023, 122, 110524. [Google Scholar] [CrossRef]
- Trimarchi, M.; Lauritano, D.; Ronconi, G.; Caraffa, A.; Gallenga, C.E.; Frydas, I.; Kritas, S.K.; Calvisi, V.; Conti, P. Mast Cell Cytokines in Acute and Chronic Gingival Tissue Inflammation: Role of IL-33 and IL-37. Int. J. Mol. Sci. 2022, 23, 13242. [Google Scholar] [CrossRef]
- Sağlam, M.; Köseoğlu, S.; Aral, C.A.; Savran, L.; Pekbağrıyanık, T.; Çetinkaya, A. Increased Levels of Interleukin-33 in Gingival Crevicular Fluids of Patients with Chronic Periodontitis. Odontology 2017, 105, 184–190. [Google Scholar] [CrossRef]
- Wright, H.J.; Chapple, I.L.; Matthews, J.B. TGF-β Isoforms and TGF-β Receptors in Drug-Induced and Hereditary Gingival Overgrowth. J. Oral Pathol. Med. 2001, 30, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Al-Hamilly, N.S.; Radwan, L.R.; Abdul-Rahman, M.; Mourad, M.I.; Grawish, M.E. Biological Roles of KGF, CTGF and TGF-β in Cyclosporine-A-and Phenytoin-Induced Gingival Overgrowth: A Comparative Experimental Animal Study. Arch. Oral Biol. 2016, 66, 38–43. [Google Scholar] [CrossRef] [PubMed]
- Kaynar, K.; Ulusoy, S.; Ovali, E.; Vanizor, B.; Dikmen, T.; Gul, S. TGF-β and TNF-α Producing Effects of Losartan and Amlodipine on Human Mononuclear Cell Culture. Nephrology 2005, 10, 478–482. [Google Scholar] [CrossRef]
- Takayama, S.I.; Yoshida, J.; Hirano, H.; Okada, H.; Murakami, S. Effects of Basic Fibroblast Growth Factor on Human Gingival Epithelial Cells. J. Periodontol. 2002, 73, 1467–1473. [Google Scholar] [CrossRef]
- Sanaie, A.R.; Firth, J.D.; Uitto, V.J.; Putnins, E.E. Keratinocyte Growth Factor (KGF)-1 and -2 Protein and Gene Expression in Human Gingival Fibroblasts. J. Periodontal Res. 2002, 37, 66–74. [Google Scholar]
- Mackenzie, I.C.; Gao, Z. Keratinocyte Growth Factor Expression in Human Gingival Fibroblasts and Stimulation of in Vitro Gene Expression by Retinoic Acid. J. Periodontol. 2001, 72, 445–453. [Google Scholar] [CrossRef]
- Bletsa, A.; Abdalla, H.; Løes, S.; Berggreen, E. Lymphatic Growth Factors are Expressed in Human Gingiva and Upregulated in Gingival Fibroblasts After Stimulation. J. Periodontol. 2018, 89, 606–615. [Google Scholar] [CrossRef]
- Kumar, A.; Mutter, S.; Parente, E.B.; Harjutsalo, V.; Lithovius, R.; Mathavan, S.; Lehto, M.; Hiltunen, T.P.; Kontula, K.K.; Groop, P.H. L-Type Calcium Channel Blocker Increases VEGF Concentrations in Retinal Cells and Human Serum. PLoS ONE 2023, 18, e0284364. [Google Scholar] [CrossRef]
- Menger, M.M.; Merscher, B.; Scheuer, C.; Braun, B.J.; Herath, S.C.; Rollmann, M.F.; Stenger, D.; Später, T.; Pohlemann, T.; Menger, M.D.; et al. Amlodipine Accelerates Bone Healing in a Stable Closed Femoral Fracture Model in Mice. Eur. Cell Mater. 2021, 41, 592–602. [Google Scholar] [CrossRef]
- Akalin, F.A.; Toklu, E.; Renda, N. Analysis of Superoxide Dismutase Activity Levels in Gingiva and Gingival Crevicular Fluid in Patients with Chronic Periodontitis and Periodontally Healthy Controls. J. Clin. Periodontol. 2005, 32, 238–243. [Google Scholar] [CrossRef]
- Salehi, I.; Mohammadi, M.; Mirzaei, F.; Soufi, F.G. Amlodipine Attenuates Oxidative Stress in the Heart and Blood of High-Cholesterol Diet Rabbits: Cardiovascular Topics. Cardiovasc. J. Afr. 2012, 23, 18–22. [Google Scholar] [CrossRef]
- Kim, H.J.; Han, S.J.; Kim, D.J.; Jang, H.C.; Lim, S.; Choi, S.H.; Kim, Y.H.; Shin, D.H.; Kim, S.H.; Kim, T.H.; et al. Effects of Valsartan and Amlodipine on Oxidative Stress in Type 2 Diabetic Patients with Hypertension: A Randomized, Multicenter Study. Korean J. Intern. Med. 2017, 32, 497. [Google Scholar] [CrossRef]
- Zhang, D.; Jin, W.; Wu, R.; Li, J.; Park, S.A.; Tu, E.; Zanvit, P.; Xu, J.; Liu, O.; Cain, A.; et al. High Glucose Intake Exacerbates Autoimmunity Through Reactive-Oxygen-Species-Mediated TGF-β Cytokine Activation. Immunity 2019, 51, 671–681. [Google Scholar] [CrossRef]
- Scribante, A.; Gallo, S.; Pascadopoli, M.; Frani, M.; Butera, A. Ozonized Gels vs. Chlorhexidine in Non-Surgical Periodontal Treatment: A Randomized Clinical Trial. Oral Dis. 2023. [Google Scholar] [CrossRef]
- Scribante, A.; Gallo, S.; Pascadopoli, M.; Soleo, R.; Di Fonso, F.; Politi, L.; Venugopal, A.; Marya, A.; Butera, A. Management of Periodontal Disease with Adjunctive Therapy with Ozone and Photobiomodulation (PBM): A Randomized Clinical Trial. Photonics 2022, 9, 138. [Google Scholar] [CrossRef]
- Syahputra, A.; Pasaribu, K.; Pulungan, D. The Difference of Superoxide Dismutase Levels in Patients’ Saliva with Gingivitis Associated with Dental Plaque Only Before and After Scaling at Periodontics Installation, Faculty of Dentistry USU. In Proceedings of the International Dental Conference of Sumatera Utara, Medan, Indonesia, 7–9 December 2017; Volume 1, pp. 45–49. [Google Scholar]
- Charlson, M.E.; Pompei, P.; Ales, K.L.; MacKenzie, C.R. A New Method of Classifying Prognostic Comorbidity in Longitudinal Studies: Development and Validation. J. Chronic Dis. 1987, 40, 373–383. [Google Scholar] [CrossRef] [PubMed]
- Stancić, I.; Sojić, L.T.; Jelenković, A. Adaptation of Oral Health Impact Profile (OHIP-14) Index for Measuring Impact of Oral Health on Quality of Life in Elderly to Serbian Language. Vojnosanit Pregl. 2009, 66, 511–515. [Google Scholar] [CrossRef]
- Janković, S.M.; Bogavac-Stanojević, N.; Mikulić, I.; Izetbegović, S.; Iličković, I.; Krajnović, D.; Suljic Mehmedika, E.; Gojak, R.; Mehičević, A.; Gazibera, B.; et al. A Questionnaire for Rating Health-Related Quality of Life. Slov. J. Public Health 2021, 60, 260–268. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]






| Total N (%) | Without Gingival Enlargement N (%) | With Gingival Enlargement N (%) | p | |
|---|---|---|---|---|
| Gender | ||||
| Male | 11 (34.4) | 6 (37.5) | 5 (31.2) | 1.000 |
| Female | 21 (65.6) | 10 (62.5) | 11 (68.8) | |
| Education | ||||
| Elementary | 3 (9.4) | 0 (0.0) | 3 (18.8) | 0.130 |
| High School | 19 (59.4) | 11 (68.8) | 8 (50.0) | |
| College | 8 (25.0) | 5 (31.2) | 3 (18.8) | |
| Master’s/PhD | 2 (6.3) | 0 (0.0) | 2 (12.5) | |
| Employment | ||||
| Yes | 18 (56.3) | 4 (25.0) | 4 (25.0) | 0.724 |
| No | 8 (25.0) | 10 (62.5) | 8 (50.0) | |
| Retired | 6 (18.8) | 2 (12.5) | 4 (25.0) | |
| Marital Status | ||||
| Single | 3 (9.4) | 1 (6.2) | 2 (12.5) | 0.559 |
| In Relationship | 1 (3.1) | 1 (6.2) | 0 (0.0) | |
| Married | 18 (56.3) | 10 (62.5) | 8 (50.0) | |
| Divorced | 5 (15.6) | 3 (18.8) | 2 (12.5) | |
| Widowed | 5 (15.6) | 1 (6.2) | 4 (25.0) | |
| Alcohol Consumption | ||||
| No | 23 (71.9) | 11 (68.8) | 12 (75.0) | 1.000 |
| Moderate | 9 (28.1) | 5 (31.2) | 4 (25.0) | |
| Physical Activity | ||||
| None | 8 (25.0) | 2 (12.5) | 6 (37.5) | 0.352 |
| Occasional | 11 (34.4) | 6 (37.5) | 5 (31.2) | |
| Regular | 13 (40.6) | 8 (50.0) | 5 (31.2) | |
| Comorbidities | ||||
| No | 24 (75.0) | 11 (68.8) | 13 (81.2) | 0.685 |
| Yes | 8 (25.0) | 5 (31.2) | 3 (18.8) | |
| Additional Therapy | ||||
| No | 5 (27.8) | 2 (22.2) | 3 (33.3) | 1.000 |
| Yes | 13 (72.2) | 7 (77.8) | 6 (66.7) |
| Total N (%) | Without Gingival Enlargement N (%) | With Gingival Enlargement N (%) | p ** | |
|---|---|---|---|---|
| Medication Usage | ||||
| No Medication | 16 (50.0) | 8 (50.0) | 8 (50.0) | 0.560 |
| Amlodipine | 4 (12.5) | 3 (18.8) | 1 (6.2) | |
| Combination | 12 (37.5) | 5 (31.2) | 7 (43.8) | |
| Dosage | ||||
| No Medication | 16 (50.0) | 8 (50.0) | 8 (50.0) | 1.000 |
| 5 mg | 14 (87.5) | 7 (43.8) | 7 (43.8) | |
| 10 mg | 2 (12.5) | 1 (6.2) | 1 (6.2) | |
| Total Mean ± SD | Without Gingival Enlargement Mean ± SD | With Gingival Enlargement Mean ± SD | p *** | |
| Duration of Medication Use (months) | 36.44 ± 24.96 | 14.69 ± 21.75 | 21.75 ± 29.798 | 0.440 |
| Disease Duration (years) | 12.06 ± 7.69 | 4.75 ± 7.31 | 7.31 ± 9.93 | 0.382 |
| Systolic Blood Pressure * | 134.00 ± 10.59 | 128.38 ± 7.25 | 139.63 ± 10.743 | 0.028 |
| Diastolic Blood Pressure | 85.81 ± 13.51 | 81.88 ± 7.53 | 89.75 ± 17.29 | 0.257 |
| Without Gingival Enlargement Median (IQR) | With Gingival Enlargement Median (IQR) | p ** | |
|---|---|---|---|
| Age | 54.5 (26.75) | 50.5 (29.75) | 0.956 |
| Charlson Comorbidity Index (CCI) | 1.0 (2.0) | 0.5 (2.0) | 0.724 |
| CCI Percentage | 96.0 (8.0) | 97.0 (8.0) | 0.724 |
| Oral Health Impact Profile—OHIP-14 * | 4.0 (7.0) | 13.0 (17.0) | 0.002 |
| WB-HRQoL 1 | 83.0 (12.0) | 73.5 (17.0) | 0.149 |
| PI | 0.92 (1.34) | 0.91 (0.69) | 0.926 |
| Papillae Bleeding Index * | 0.36 (0.92) | 0.87 (1.33) | 0.043 |
| Clinical Attachment Level | 1.16 (2.95) | 1.1 (1.46) | 0.669 |
| Total N (%) | Without Gingival Enlargement N (%) | With Gingival Enlargement N (%) | p ** | |
|---|---|---|---|---|
| Mouth Breathing | ||||
| No | 20 (62.5) | 12 (75.0) | 8 (50.0) | 0.273 |
| Yes | 12 (37.5) | 4 (25.0) | 8 (50.0) | |
| Bruxism | ||||
| Ne | 23 (71.9) | 13 (81.2) | 10 (62.5) | 0.432 |
| Da | 9 (28.1) | 3 (18.8) | 6 (37.5) | |
| Parafunctional Habits | ||||
| Ne | 26 (81.2) | 13 (81.2) | 13 (81.2) | 1.000 |
| Da | 6 (18.8) | 3 (18.8) | 3 (18.8) | |
| Gingival Bleeding | ||||
| No | 21 (65.6) | 11 (68.8) | 10 (65.2) | 0.754 |
| Mild | 7 (21.9) | 4 (25.0) | 3 (18.8) | |
| Moderate | 4 (12.5) | 1 (6.2) | 3 (18.8) | |
| Masticatory Difficulties * | ||||
| No | 24 (75.0) | 16 (100.0) | 8 (50.0) | 0.002 |
| Yes | 8 (25.0) | 0 (0.0) | 8 (50.0) | |
| Speech Difficulties | ||||
| No | 29 (90.6) | 16 (100.0) | 13 (81.2) | 0.226 |
| Yes | 3 (9.4) | 0 (0.0) | 3 (18.8) | |
| Denture-Wearing Difficulties | ||||
| No | 2 (6.2) | 1 (6.2) | 1 (6.2) | 0.792 |
| Yes | 4 (12.5) | 1 (6.2) | 3 (18.8) | |
| Not Applicable | 26 (81.3) | 14 (87.5) | 12 (75.0) | |
| Taste Disorders | ||||
| No | 30 (93.8) | 16 (100.0) | 14 (87.5) | 0.484 |
| Yes | 2 (6.2) | 0 (0.0) | 2 (12.5) | |
| Halitosis | ||||
| No | 21 (65.6) | 11 (68.8) | 10 (62.5) | 1.000 |
| Yes | 11 (34.4) | 5 (31.2) | 6 (37.5) | |
| Brushing Twice Daily | ||||
| No | 5 (15.6) | 3 (18.8) | 2 (12.5) | 1.000 |
| Yes | 27 (84.4) | 13 (81.2) | 14 (87.5) | |
| Mouthwash Usage | ||||
| No | 18 (56.2) | 10 (62.5) | 8 (50.0) | 0.722 |
| Yes | 14 (43.8) | 6 (37.5) | 8 (50.0) | |
| Dental Floss or Interdental Brushes Usage | ||||
| No | 21 (65.6) | 11 (68.9) | 10 (62.5) | 1.000 |
| Yes | 11 (34.4) | 5 (31.2) | 6 (37.5) | |
| Regular Check-Ups | ||||
| No | 13 (40.6) | 7 (43.8) | 6 (37.5) | 1.000 |
| Yes | 19 (59.4) | 9 (56.2) | 10 (62.5) |
| Primer Name | Sequence (5′-3′) |
|---|---|
| Human β-actin | F: AGCACAGAGCCTCGCCTT R: CATCATCCATGGTGAGCTGG |
| Human IL-6 | F: ACTCACCTCTTCAGAACGAATTG R: CCATCTTTGGAAGGTTCAGGTTG |
| Human TNF | F: CCTCTCTCTAATCAGCCCTCTG R: GAGGACCTGGGAGTAGATGAG |
| Human VEGF-C | F: ACCTGCCCCACCAATTACA R: GCCTCTTGTAAAGACTGGTT |
| Human VEGF-D | F: CCTGAAGAAGATCGCTGTTC R: GAGAGCTGGTTCCTGGAGAT |
| Human TGF β 1 | F: CCCAGCATCTGCAAAGCTC R: GTCAATGTACAGCTGCCGCA |
| Human CTGF | F: GGCTTACCGACTGGAAGAC R: AGGAGGCGTTGTCATTGG |
| Human IL-33 | F: AATCAGGTGACGGTGTTG R: ACACTCCAGGATCAGTCTTG |
| Human ST2 | F: ATGTTCTGGATTGAGGCCAC R: GACTACATCTTCTCCAGGTAGCAT |
| Human FGF 2 | F: CTGGCTATGAAGGAAGATGGA R: TGCCCAGTTCGTTTCAGTG |
| Human KGF (FGF 7) | F: TTG-TGG-CAA-TCA-AAG-GGG-TG R: CCT-CCG-TTG-TGT-GTC-CAT-TTA-GC |
| Human EGF | F: CTTGTCATGCTGCTCCTCCTG R: TGCGACTCCTCACATCTCTGC |
| Human GAPDH | F: GGAAGGTGAAGGTCGGAGTCA R: GTCATTGATGGCAACAATATCCACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mojsilović, J.; Jovičić, N.; Vujović Ristić, S.; Stevanović, M.; Mijailović, S.; Rosić, G.; Janković, S.; Kostić, M. Novel Insights into Amlodipine-Induced Gingival Enlargement: A Clinical and Molecular Perspective. Pharmaceuticals 2024, 17, 1075. https://doi.org/10.3390/ph17081075
Mojsilović J, Jovičić N, Vujović Ristić S, Stevanović M, Mijailović S, Rosić G, Janković S, Kostić M. Novel Insights into Amlodipine-Induced Gingival Enlargement: A Clinical and Molecular Perspective. Pharmaceuticals. 2024; 17(8):1075. https://doi.org/10.3390/ph17081075
Chicago/Turabian StyleMojsilović, Jana, Nemanja Jovičić, Sanja Vujović Ristić, Momir Stevanović, Sara Mijailović, Gvozden Rosić, Slobodan Janković, and Marina Kostić. 2024. "Novel Insights into Amlodipine-Induced Gingival Enlargement: A Clinical and Molecular Perspective" Pharmaceuticals 17, no. 8: 1075. https://doi.org/10.3390/ph17081075
APA StyleMojsilović, J., Jovičić, N., Vujović Ristić, S., Stevanović, M., Mijailović, S., Rosić, G., Janković, S., & Kostić, M. (2024). Novel Insights into Amlodipine-Induced Gingival Enlargement: A Clinical and Molecular Perspective. Pharmaceuticals, 17(8), 1075. https://doi.org/10.3390/ph17081075

