Genetic Diversity of Tourist-Habituated Rhesus Macaques Inhabiting Wulongkou Area, Jiyuan, China: Based on Deceased Individuals
Abstract
1. Introduction
2. Materials and Methods
2.1. Subject and Sampling
2.2. DNA Extraction and Genotyping
2.3. Statistical Analysis
2.4. Ethical Statement of Ethics
3. Results
3.1. Genetic Diversity
3.2. Bottleneck Effect Testing
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AR | allelic richness |
| bp | base pair |
| ca. | circa |
| COVID-19 | coronavirus disease 2019 |
| DNA | deoxyribonucleic acid |
| E | east longitude |
| F | fixation index |
| He | expected heterozygosity |
| Heq | expected equilibrium heterozygosity |
| Ho | observed heterozygosity |
| HWE | Hardy–Weinberg equilibrium |
| IAM | infinite alleles model |
| LD | linkage disequilibrium |
| n | sample size |
| N | northern latitude |
| Na | mean number of alleles per locus |
| Ne | effective number of alleles |
| m | meter |
| min | minute |
| PCR | polymerase chain reaction |
| PIC | polymorphic information content |
| s | second |
| SD | standard deviation of the mean |
| SE | standard error of the mean |
| SMM | stepwise mutation model |
| Ta | annealing temperature |
| TPM | two-phase model |
| WLK | Wulongkou |
| μL | microlitre |
| μM | micromole |
References
- Newsome, D.; Dowling, R.K.; Moore, S.A. Wildlife Tourism; Channel View Publications: Bristol, UK, 2005. [Google Scholar]
- Fatima, J.K. Wilderness of Wildlife Tourism; Apple Academic Press: Palm Bay, FL, USA, 2017. [Google Scholar] [CrossRef] [Scilit]
- Speiran, S.I.M.; Hovorka, A.J. Bringing animals in-to wildlife tourism. Sustainability 2024, 16, 7155. [Google Scholar] [CrossRef] [Scilit]
- Fotiadis, A.; Polyzos, S.; Huan, T.T.C. The good, the bad and the ugly on COVID-19 tourism recovery. Ann. Tour. Res. 2021, 87, 103117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Newsome, D. The collapse of tourism and its impact on wildlife tourism destinations. J. Tour. Futures 2021, 7, 295–302. [Google Scholar] [CrossRef] [Scilit]
- Usui, R.; Sheeran, L.K.; Asbury, A.M.; Blackson, M. Impacts of the COVID-19 pandemic on mammals at tourism destinations: A systematic review. Mammal Rev. 2021, 51, 492–507. [Google Scholar] [CrossRef] [Scilit]
- UNWTO. COVID-19 Tourism Recovery Technical Assistance Package; World Tourism Organization: Madrid, Spain, 2020. [Google Scholar]
- Durant, I. We Urgently Need to Kickstart Tourism’s Recovery but Crisis Offers an Opportunity to Rethink it. World Economic Forum 2021. Available online: https://www.weforum.org/agenda/2021/08/tourism-still-in-deep-trouble/ (accessed on 17 February 2025).
- Usui, R.; Sheeran, L.K.; Asbury, A.M.; Pedersen, L. Building resilience in primate tourism: Insights from the COVID-19 pandemic and future directions. Primates 2024, 65, 191–201. [Google Scholar] [CrossRef] [Scilit]
- Aebli, A.; Volgger, M.; Taplin, R. A two-dimensional approach to travel motivation in the context of the COVID-19 pandemic. Curr. Issues Tour. 2021, 25, 60–75. [Google Scholar] [CrossRef] [Scilit]
- Buckley, R.C.; Cooper, M. Tourism as a tool in nature-based mental health: Progress and prospects post-pandemic. Int. J. Environ. Res. Public Health 2022, 19, 13112. [Google Scholar] [CrossRef] [Scilit]
- Yao, Y.B.; Zhao, X.X.; Ren, L.P.; Jia, G.M. Compensatory travel in the post COVID-19 pandemic era: How does boredom stimulate intentions? J. Hosp. Tour. Manag. 2023, 54, 56–64. [Google Scholar] [CrossRef] [Scilit]
- Stone, L.S.; Stone, M.T. Wildlife Tourism Dynamics in Southern Africa; Springer: Cham, Switzerland, 2024. [Google Scholar] [CrossRef] [Scilit]
- Maréchal, L.; Semple, S.; Majolo, B.; Qarro, M.; Heistermann, M.; MacLarnon, A. Impacts of tourism on anxiety and physiological stress levels in wild male Barbary macaques. Biol. Conserv. 2011, 144, 2188–2193. [Google Scholar] [CrossRef] [Scilit]
- Shutt, K.; Heistermann, M.; Kasim, A.; Todd, A.; Kalousova, B.; Profosouva, I.; Petrzelkova, K.; Fuh, T.; Dicky, J.; Bopalanzognako, J.; et al. Effects of habituation, research and ecotourism on faecal glucocorticoid metabolites in wild western lowland gorillas: Implications for conservation management. Biol. Conserv. 2014, 172, 72–79. [Google Scholar] [CrossRef] [Scilit]
- Afonso, E.; Fu, R.; Dupaix, A.; Goydadin, A.C.; Yu, Z.; Callou, C.; Villette, P.; Giraudoux, P.; Li, L. Feeding sites promoting wildlife-related tourism might highly expose the endangered Yunnan snub-nosed monkey (Rhinopithecus bieti) to parasite transmission. Sci. Rep. 2021, 11, 15817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afonso, E.; Fu, R.; Dupaix, A.; Goydadin, A.; Yu, Z.; Li, D.; Giraudoux, P.; Li, L. Creating small food-habituated groups might alter genetic diversity in the endangered Yunnan snub-nosed monkey. Glob. Ecol. Conserv. 2021, 26, e1422. [Google Scholar] [CrossRef] [Scilit]
- Maestripieri, D. Macachiavellian Intelligence: How Rhesus Macaques and Humans Have Conquered the World; University of Chicago Press: Chicago, IL, USA, 2007. [Google Scholar]
- Singh, M.; Kumar, A.; Kumara, H.N.; Macaca mulatta (Amended Version of 2020 Assessment). The IUCN Red List of Threatened Species 2024: E.T12554A256057746. Available online: https://www.iucnredlist.org/species/12554/17950825 (accessed on 17 February 2025).
- Wang, Y.W.; Lu, J.Q.; Tian, J.D. Survey on the status of rhesus macaque-involved tourism in China. Chi. J. Zool. 2022, 57, 514–520. [Google Scholar] [CrossRef]
- Bezanson, M.; McNamara, A. The what and where of primate field research may be failing primate conservation. Evol. Anthropol. 2019, 28, 166–178. [Google Scholar] [CrossRef] [Scilit]
- Andrade, M.C.R.; Penedo, M.C.T.; Ward, T.; Silva, V.F.; Cabello, P.H. Determination of genetic status in a closed colony of rhesus monkeys (Macaca mulatta). Primates 2004, 45, 183–186. [Google Scholar] [CrossRef] [Scilit]
- Kanthaswamy, S.; Kou, A.; Smith, D.G. Population genetic statistics from rhesus macaques (Macaca mulatta) in three different housing configurations at the California National Primate Research Center. J. Am. Assoc. Lab. Anim. 2010, 49, 598–609. [Google Scholar]
- Li, D.Y.; Xu, H.L.; Trask, J.S.; Zhu, Q.; Cheng, A.C.; Smith, D.G.; George, D.; Zhang, L. Genetic diversity and population structure in wild Sichuan rhesus macaques. Mol. Biol. Rep. 2013, 40, 3033–3041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanthaswamy, S.; Ng, J.; Hernandez-Pacheco, R.; Ruiz-Lambides, A.; Maldonado, E.; Martinez, M.I.; Sariol, C.A. The population genetic composition of conventional and SPF colonies of rhesus macaques (Macaca mulatta) at the Caribbean Primate Research Center. J. Am. Assoc. Lab. Anim. 2016, 55, 147–151. [Google Scholar]
- Kanthaswamy, S.; Oldt, R.F.; Ng, J.; Ruiz-Lambides, A.V.; Maldonado, E.; Martinez, M.I.; Sariol, C.A. Population genetic structure of the Cayo Santiago colony of rhesus macaques (Macaca mulatta). J. Am. Assoc. Lab. Anim. 2017, 56, 396–401. [Google Scholar]
- Zhou, Y.Y.; Tian, J.D.; Lu, J.Q. Genetic structure and recent population demographic history of Taihangshan macaque (Macaca mulatta tcheliensis), North China. Integr. Zool. 2023, 18, 530–542. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.Z.; Quan, G.Q.; Lin, Y.L.; Charles, S. Extinction of rhesus monkeys (Macaca mulatta) in Xinglung, North China. Int. J. Primatol. 1989, 10, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.Q.; Hou, J.H.; Wang, H.F.; Qu, W.Y. Current status of Macaca mulatta in Taihangshan Mountains Area, Jiyuan, Henan, China. Int. J. Primatol. 2007, 28, 1085–1091. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.J.; Luo, J.; Li, Q.Q.; Wang, Y.Q.; Murphy, R.W.; Blair, C.; Wu, S.F.; Yue, B.S.; Zhang, Y.P. Ecological genetics of Chinese rhesus macaque in response to mountain building: All things are not equal. PLoS ONE 2013, 8, e55315. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.J.; Tan, X.; Orozco-terWengel, P.; Zhou, X.M.; Zhang, L.Y.; Tian, S.L.; Yan, Z.Z.; Xu, H.L.; Ren, B.P.; Zhang, P.; et al. Population genomics of wild Chinese rhesus macaques reveals a dynamic demographic history and local adaptation, with implications for biomedical research. Gigascience 2018, 7, giy106. [Google Scholar] [CrossRef] [Scilit]
- Pang, K.L.; Jin, Q.Q.; Yuan, Z.A.; Kuang, Z.J.; Lu, J.Q.; Tian, J.D. Spondyloarthritis in Taihangshan macaques (Macaca mulatta tcheliensis). Folia Primatol. 2021, 92, 203–210. [Google Scholar] [CrossRef] [Scilit]
- Kong, X.G.; Guo, W.D.; Kuang, S.A.; Yang, Q.; Lu, J.Q. Status and utilization of the rhesus macaques in Wulongkou Scenic Spot, Jiyuan, Henan, China. J. Henan Forest Sci. Tech. 2011, 31, 11–12. [Google Scholar]
- Wang, B.S.; Wang, Z.L.; Tian, J.D.; Cui, Z.W.; Lu, J.Q. Establishment of a microsatellite set for noninvasive paternity testing in free-ranging Macaca mulatta tcheliensis in Mount Taihangshan area, Jiyuan, China. Zool. Stud. 2015, 54, 8. [Google Scholar] [CrossRef] [Scilit]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef] [Scilit]
- Rousset, F. GENEPOP’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [Scilit]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar] [CrossRef] [Scilit]
- Carvajal-Rodriguez, A. Myriads: P-value-based multiple testing correction. Bioinformatics 2018, 34, 1043–1045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
- Goudet, J. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Updated from Goudet (1995). J. Hered. 2001, 86, 485–486. [Google Scholar] [CrossRef] [Scilit]
- Cornuet, J.M.; Luikart, G. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 1996, 144, 2001–2014. [Google Scholar] [CrossRef] [Scilit]
- Cristescu, R.; Sherwin, W.B.; Handasyde, K.; Cahill, V.; Cooper, D.W. Detecting bottlenecks using BOTTLENECK 1.2.02 in wild populations: The importance of the microsatellite structure. Conserv. Genet. 2010, 11, 1043–1049. [Google Scholar] [CrossRef] [Scilit]
- Luikart, G.; Allendorf, F.W.; Cornuet, J.M.; Sherwin, W.B. Distortion of allele frequency distributions provides a test for recent population bottlenecks. J. Hered. 1998, 89, 238–247. [Google Scholar] [CrossRef] [Scilit]
- DeWoody, J.A.; Harder, A.M.; Mathur, S.; Willoughby, J.R. The long-standing significance of genetic diversity in conservation. Mol. Ecol. 2021, 30, 4147–4154. [Google Scholar] [CrossRef] [Scilit]
- Fooden, J. Systematic review of the rhesus macaque, Macaca mulatta (Zimmermann, 1780). Fieldiana Zool. 2000, 96, 1–180. [Google Scholar] [CrossRef] [Scilit]
- Serrote, C.; Reiniger, L.; Silva, K.B.; Rabaiolli, S.; Stefanel, C.M. Determining the polymorphism information content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef] [Scilit]
- Yao, Y.F.; Dai, Q.X.; Li, J.; Ni, Q.Y.; Zhang, M.W.; Xu, H.L. Genetic diversity and differentiation of the rhesus macaque (Macaca mulatta) population in western Sichuan, China, based on the second exon of the major histocompatibility complex class II DQB (MhcMamu-DQB1) alleles. BMC Evol. Biol. 2014, 14, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, D.G.; George, D.; Kanthaswamy, S.; McDonough, J. Identification of country of origin and admixture between Indian and Chinese rhesus macaques. Int. J. Primatol. 2006, 27, 881–898. [Google Scholar] [CrossRef] [Scilit]
- Kanthaswamy, S.; von Dollen, A.; Kurushima, J.D.; Alminas, O.; Rogers, J.; Ferguson, B.; Lerche, N.W.; Allen, P.C.; Smith, D.G. Microsatellite markers for standardized genetic management of captive colonies of rhesus macaques (Macaca mulatta). Am. J. Primatol. 2006, 68, 73–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Satkoski, J.A.; Malhi, R.; Kanthaswamy, S.; Tito, R.; Malladi, V.; Smith, D. Pyrosequencing as a method for SNP identification in the rhesus macaque (Macaca mulatta). BMC Genom. 2008, 9, 256. [Google Scholar] [CrossRef] [Scilit]
- Bonhomme, M.; Cuartero, S.; Blancher, A.; Crouau-Roy, B. Assessing natural introgression in 2 biomedical model species, the rhesus macaque (Macaca mulatta) and the long-tailed macaque (Macaca fascicularis). J. Hered. 2009, 100, 158–169. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.R.; Li, J.H.; Zhu, Y.; Sun, B.H. Development of a microsatellite set for paternity assignment of captive rhesus macaques (Macaca mulatta) from Anhui province, China. Genetika 2013, 49, 838–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Groot, N.; Doxiadis, G.G.; Otting, N.; de Vos-Rouweler, A.J.; Bontrop, R.E. Differential recombination dynamics within the MHC of macaque species. Immunogenetics 2014, 66, 535–544. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.T.; Hu, Z.X.; Li, W.J.; Zeng, T.; Zhang, X.Y.; Li, J.; Zhang, W.W.; Yue, B.S. Isolation and strategies of novel tetranucleotide microsatellites with polymorphisms from different chromosomes of the rhesus monkey (Macaca mulatta). Mol. Biol. Rep. 2019, 46, 3955–3966. [Google Scholar] [CrossRef] [Scilit]


| Locus | Primer | Type of Repeated Motif | Ta * (°C) | Length (bp) |
|---|---|---|---|---|
| D2S169 | F: TTCTAAGACTTGGCAGAACAT R: AGCTCTTTCAGGTGACTTCA | Di | 55 | 214–230 |
| D2S2151 | F: CCTGCACTCTCATGTATATTG R: GTGCCTGACTTATTTTACTTTG | Di | 53 | 208–240 |
| D3S1768 | F: GGTTGCTGCCAAAGATTAGA R: CACTGTGATTTGCTGTTGGA | Tetra | 56 | 180–200 |
| D4S1626 | F: TACACTTGAACAAAGTAAGGATGC R: AAAGGAAAAGGAATGGGATG | Di | 55 | 174–212 |
| D6S493 | F: ATCCCAACTCTTAAATGGGC R: TTCCATGGCAGAAATTGTTT | Tetra | 55 | 256–280 |
| D6S501 | F: GCTGGAAACTGATAAGGGCT R: GCCACCCTGGCTAAGTTACT | Tetra | 58 | 171–195 |
| D7S513 | F: AGTGTTTTGAAGGTTGTAGGTTAAT R: ATATCTTTCAGGGGAGCAGG | Di | 57 | 185–205 |
| D9S934 | F: TTTCCTAGTAGCTCAAGTAAAGAGG R: AGACTTGGACTGAATTACACTGC | Tetra | 58 | 186–202 |
| D11S2002 | F: CATGGCCCTTCTTTTCATAG R: AATGAGGTCTTACTTTGTTGCC | Tetra | 56 | 210–266 |
| D12S1645 | F: ACCACATACCTGGCTGTTAC R: GGTTCAAGACCTCCCAAA | Di | 55 | 192–226 |
| Variables | n | Na | Ne | AR | Ho | He | PIC | F | PHWE | |
|---|---|---|---|---|---|---|---|---|---|---|
| Locus | ||||||||||
| D2S169 | 42 | 8 | 5.513 | 7.996 | 0.738 | 0.819 | 0.796 | 0.098 | 0.0831 | |
| D2S2151 | 41 | 7 | 2.690 | 6.558 | 0.537 | 0.628 | 0.557 | 0.146 | 0.1983 | |
| D3S1768 | 41 | 4 | 2.180 | 3.851 | 0.683 | 0.541 | 0.440 | −0.262 | 0.9685 | |
| D4S1626 | 40 | 10 | 4.482 | 9.611 | 0.825 | 0.777 | 0.747 | −0.062 | 0.8279 | |
| D6S493 | 42 | 6 | 2.566 | 5.807 | 0.690 | 0.610 | 0.567 | −0.131 | 0.7731 | |
| D6S501 | 35 | 7 | 3.587 | 7.000 | 0.800 | 0.721 | 0.677 | −0.109 | 0.9114 | |
| D7S513 | 35 | 8 | 3.723 | 8.000 | 0.657 | 0.731 | 0.700 | 0.102 | 0.0021 | |
| D9S934 | 39 | 5 | 3.541 | 4.991 | 0.718 | 0.718 | 0.666 | 0.000 | 0.5844 | |
| D11S2002 | 42 | 7 | 2.767 | 6.781 | 0.619 | 0.639 | 0.600 | 0.031 | 0.5444 | |
| D12S1645 | 41 | 7 | 3.596 | 6.851 | 0.659 | 0.722 | 0.680 | 0.088 | 0.1936 | |
| Mean | 39.8 | 6.9 | 3.464 | 6.745 | 0.693 | 0.691 | 0.643 | −0.010 | — | |
| SE | 0.9 | 0.5 | 0.314 | 0.514 | 0.027 | 0.027 | 0.033 | 0.041 | — | |
| Locus | n | He | IAM | SMM | TPM | |||
|---|---|---|---|---|---|---|---|---|
| Heq | p | Heq | p | Heq | p | |||
| D2S169 | 84 | 0.828 | 0.676 | 0.023 | 0.803 | 0.329 | 0.793 | 0.252 |
| D2S2151 | 82 | 0.636 | 0.640 | 0.402 | 0.771 | 0.030 | 0.759 | 0.042 |
| D3S1768 | 82 | 0.548 | 0.447 | 0.343 | 0.590 | 0.286 | 0.578 | 0.329 |
| D4S1626 | 80 | 0.787 | 0.753 | 0.420 | 0.848 | 0.048 | 0.840 | 0.085 |
| D6S493 | 84 | 0.618 | 0.583 | 0.499 | 0.732 | 0.053 | 0.717 | 0.097 |
| D6S501 | 70 | 0.732 | 0.652 | 0.291 | 0.780 | 0.148 | 0.762 | 0.238 |
| D7S513 | 70 | 0.742 | 0.693 | 0.401 | 0.809 | 0.075 | 0.796 | 0.118 |
| D9S934 | 78 | 0.727 | 0.526 | 0.054 | 0.676 | 0.295 | 0.658 | 0.246 |
| D11S2002 | 84 | 0.646 | 0.640 | 0.422 | 0.774 | 0.028 | 0.760 | 0.054 |
| D12S1645 | 82 | 0.731 | 0.640 | 0.275 | 0.774 | 0.179 | 0.758 | 0.244 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Zhou, Y.; Luo, T.; Tian, J.; Lu, J. Genetic Diversity of Tourist-Habituated Rhesus Macaques Inhabiting Wulongkou Area, Jiyuan, China: Based on Deceased Individuals. Diversity 2025, 17, 244. https://doi.org/10.3390/d17040244
Wang Y, Zhou Y, Luo T, Tian J, Lu J. Genetic Diversity of Tourist-Habituated Rhesus Macaques Inhabiting Wulongkou Area, Jiyuan, China: Based on Deceased Individuals. Diversity. 2025; 17(4):244. https://doi.org/10.3390/d17040244
Chicago/Turabian StyleWang, Yuwei, Yanyan Zhou, Tongtong Luo, Jundong Tian, and Jiqi Lu. 2025. "Genetic Diversity of Tourist-Habituated Rhesus Macaques Inhabiting Wulongkou Area, Jiyuan, China: Based on Deceased Individuals" Diversity 17, no. 4: 244. https://doi.org/10.3390/d17040244
APA StyleWang, Y., Zhou, Y., Luo, T., Tian, J., & Lu, J. (2025). Genetic Diversity of Tourist-Habituated Rhesus Macaques Inhabiting Wulongkou Area, Jiyuan, China: Based on Deceased Individuals. Diversity, 17(4), 244. https://doi.org/10.3390/d17040244

