Next Article in Journal
Chloroquine Potentiates the Chemotherapeutic Effect of Carboplatin and ATR/Chk1 Inhibitors by Increasing the Replication Stress
Previous Article in Journal
Pandanus amaryllifolius and Tectona grandis Extracts Improve Fetal Outcomes in Streptozotocin-Induced Gestational Diabetes in Rats
Previous Article in Special Issue
Heterologous Biosynthesis of Crocin I in Solanum lycopersicum L.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 27
Issue 2
10.3390/ijms27020855
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Marker-Assisted Selection for Disease Resistance in Potato Breeding in the Ural Region of Russia (2018–2025): Comprehensive Genotyping and Validation of Key Resistance Markers

by
Georgiy A. Lihodeevskiy
*,
Elena P. Shanina
,
Maria A. Stafeeva
,
Vadim F. Akhmetkhanov
and
Arina V. Shalaeva
Ural Federal Agrarian Research Center, Ural Branch of the Russian Academy of Science, 620142 Yekaterinburg, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2026, 27(2), 855; https://doi.org/10.3390/ijms27020855
Submission received: 24 December 2025 / Revised: 12 January 2026 / Accepted: 13 January 2026 / Published: 15 January 2026
(This article belongs to the Special Issue Molecular and Genetic Advances in Plant Breeding)
Browse Figures
Versions Notes

Abstract

Marker-assisted selection (MAS) is a key tool in modern potato breeding for developing resistant varieties. This study aimed to evaluate the efficiency of molecular markers for selecting resistance to major pathogens in Ural (Russian Federation) potato breeding material. From 2018 to 2025, a total of 1212 hybrids and varieties were genotyped using 12 SCAR (sequence-characterized amplified regions) markers associated with resistance to potato wart (Synchytrium endobioticum), late blight (Phytophthora infestans), cyst nematodes (Globodera spp.), and viruses (PVX, PVY). The most frequent markers were TG689, N127, N195, and NL25. Phenotypic validation on more than 100 hybrids confirmed strong predictive power for NL25, TG689, and N195 markers in selecting resistance to wart disease and nematodes. In contrast, markers Rpi-blb1 and Rpi-sto1 for late blight did not show significant associations in this population. The results demonstrate the high diagnostic value of NL25, TG689, and N195 markers for MAS in Ural breeding programs, supporting their use for efficient selection of resistant genotypes.

1. Introduction

In modern breeding practice, a significant role is given to genetic technologies. They enable the identification of economically valuable traits in organisms, such as yield, accumulation of biologically active substances, and resistance to biotic and abiotic stresses. Among the methods widely used in Russia are the polymerase chain reaction (PCR) and gel electrophoresis. Their use ensures rapid and accurate detection of genetic determinants for target traits in agricultural crops, including potatoes, which determines their indispensability in the breeding process.
Marker-assisted selection (MAS) is one of the most widely used methods in modern agricultural practice. In potato breeding, this technology plays a key role by enabling the efficient selection of hybrids possessing target agronomic traits and enhanced resistance to pathogens. Genotyping methods allow for the identification of potato species, varieties, and hybrids carrying genetic markers associated with resistance to a wide range of infectious agents, including viral [1,2], bacterial [3], nematode [4,5], and fungal diseases [6,7]. The integration of marker-assisted selection into breeding programs contributes not only to increased yield and improved tuber quality but also to a significant reduction in the crop’s susceptibility to diseases [8,9,10].
Modern breeding practice utilizes a significant arsenal of molecular markers associated with potato resistance to phytopathogens. A substantial portion of the markers used for detecting resistance belongs to the SCAR (sequence-characterized amplified regions) category. A SCAR marker is a specific genomic DNA fragment, defined by its nucleotide sequence and localized to a precise locus, which is amplified in a polymerase chain reaction (PCR) using unique primers [11]. This class of markers is recognized as a highly effective tool in plant breeding, as it provides researchers with the ability to reliably and rapidly identify alleles of genes that determine resistance to diseases and pest damage. The use of SCAR markers underlies the accelerated development of variety identification with complex pathogen resistance, which is a key factor in increasing yield and improving product quality indicators.
The causal agent of potato wart disease, the obligate biotrophic soil fungus Synchytrium endobioticum (phylum Chytridiomycota), is among the most dangerous pathogens, capable of causing significant yield losses reaching 50–100% [12]. The pathogenesis is characterized by the formation of galls on tubers. The high virulence of S. endobioticum is due, in particular, to the exceptional resilience of its winter spores (zoosporangia), which remain viable in soil for over 40 years [13], as well as the absence of effective chemical control measures. The widespread prevalence of the pathogen in potato-growing regions, including the Russian Federation, makes breeding resistant varieties a critically important task. To enable efficient selection of resistant genotypes, the use of molecular markers linked to resistance genes plays a key role. One of the most significant resistance genes is Sen1. Using the marker NL25, a specific allele of the Sen1 gene associated with resistance to the pathogen can be identified [6,14]. The efficacy of this marker and the corresponding allele in resistance breeding has been repeatedly validated in independent studies [15,16,17].
Late blight, caused by the oomycete Phytophthora infestans, remains the most economically significant disease of potato, leading to substantial yield losses globally [18,19,20,21,22]. The primary strategy for late blight control continues to be multiple fungicide applications, with the number reaching 10–15 in Northern Europe and up to 25 times per growing season under wet conditions [19]. However, intensive chemical use promotes the selection of more aggressive pathogen strains [23,24]. Consequently, a key direction for reducing pesticide load is the development of varieties with durable resistance. Wild Mexican potato species serve as a promising source of such traits. In particular, the broad-spectrum gene Rpi-blb1 was identified in the diploid species S. bulbocastanum [25,26]. Due to interspecific incompatibility, its introgression into cultivated potato (S. tuberosum) was achieved using somatic hybridization methods [27]. A functional homolog of this gene, Rpi-sto1, was discovered in the allotetraploid species S. stoloniferum [28]. Both genes (Rpi-blb1 and Rpi-sto1) have been successfully mapped [25,29], and specific PCR markers have been developed for their detection in breeding material [28,30]. According to current knowledge, pyramiding several resistance genes in a single variety is recommended to enhance the effectiveness and durability of resistance [31].
Cyst-forming nematodes of the genus Globodera (G. rostochiensis and G. pallida) are among the most dangerous pests of potato, causing significant yield reductions worldwide [32]. Yield losses, resulting from nematode parasitism on the root system and tubers, leading to a decrease in their size, can reach 20–70% [33]. Cultivation of resistant varieties is the most environmentally safe and effective method of control. Breeding such varieties is based on the use of key resistance genes. The dominant allele of the Gro1 gene, introgressed from Solanum spegazzinii and mapped to chromosome VII, confers resistance to G. rostochiensis [34]. Specifically, the Gro1-4 allele confers resistance to pathotypes Ro1-Ro5 of this species [35,36]. The H1 gene, sourced from S. tuberosum subsp. andigena mediates a hypersensitive response to pathotypes Ro1 and Ro4 of G. rostochiensis [37]. In turn, the Gpa2 gene determines resistance to some populations of G. pallida [38,39,40]. Specific molecular markers are used to identify these genes in breeding programs: Gro1-4-1 for the Gro1 gene [4]; TG689 [41] and N195 [4] for the H1 gene; and Gpa2-2 for the Gpa2 gene [4]. Notably, markers TG689 and N195 detect the same H1 gene but appear to be different variants for their tagging, which can lead to segregation in analyses [42,43,44]. Thus, pyramiding alleles of the Gro1, H1, and Gpa2 genes in modern cultivars is a strategically important direction for creating an effective and durable resistance system to cyst-forming nematodes.
In addition to fungal and nematode diseases, viral infections pose a substantial threat to potatoes. Potato virus X (PVX) is one of the most widespread pathogens, causing global economic damage with estimated yield losses of up to 20% [45]. The PVX symptom complex includes mosaic, chlorosis, leaf rugosity, and necrosis, leading to significant suppression of photosynthetic activity and, consequently, reduced plant productivity. The infection negatively affects tuberization, resulting in the formation of small and underdeveloped tubers. The latent (asymptomatic) form of infection poses a particular epidemic threat, where the virus persists in the host plant without visible symptoms [46]. This property of PVX significantly complicates visual diagnosis and promotes the uncontrolled spread of the pathogen through infected seed material. Resistance to PVX is conferred by the Rx gene. This gene was identified in Solanum tuberosum subsp. andigena, annotated on chromosome XII near Gpa2 [47], and can be detected using the RxSP marker [2].
Potato virus Y (PVY) is recognized as one of the most economically significant pathogens of the crop, capable of causing yield losses of up to 70%. The infection leads to tuber development disorders, exacerbating economic damage [48]. Therefore, developing varieties with genetic resistance to PVY is a priority in breeding [49]. A high level of resistance to PVY is provided by the Ryadg gene (source—S. tuberosum subsp. andigena), Rysto (S. stoloniferum), and Rychc (S. chacoense), which confer extreme resistance, i.e., the ability to suppress the replication of a wide range of virus strains [37,50,51,52]. These genes have been mapped to chromosomes XI, XII, and IX, respectively [53,54,55]. Based on these studies, breeding markers have been developed: RYSC3 for the Ryadg gene [56], YES3-3A for Rysto [57], and Ry186 for Rychc [58]. Mixed viral infections pose a particular danger. Co-infection with PVX and PVY, as well as PVX and Potato leafroll virus (PLRV), leads to a synergistic effect and the most significant yield losses [45,59,60]. Consequently, a strategic objective of modern breeding is to pyramid resistance genes to several pathogens in a single cultivar [61,62]. Markers NL25, Gpa2-2, Gro1-4-1, N195, YES3-3A, RYSC3, Rx1, Rpi-blb1, and Rpi-sto1 are included in the Russian genetic profile of potato varieties [63].

2. Results

2.1. Genotyping of Hybrids and Varieties of Ural Breeding

Between 2018 and 2025, a total of 1212 hybrids and varieties from the collection of the Potato Breeding and Seed Production Center were genotyped. In the initial years, the research focused on screening the plant material collection for donor genotypes (Table S1). We have only recently begun implementing marker-assisted selection (MAS) as a methodology for selecting hybrids for further breeding work [64,65,66]. Genotyping began in 2018 with 9 markers: Rpi-blb1, Rpi-sto1, RYSC3, Ry186, RyYES3-3, RxSP, Gpa-2-2, Gro1-4-1, TG689. The NL25 marker was added in 2019, followed by the N127 marker in 2021 (Figure 1). Starting from 2022, genotyping has been conducted for 12 resistance markers (with the N195 marker introduced into the workflow) on at least 100 samples per year. The number of hybrids and varieties with complete genotype data is 629 (Table 1). The most frequently encountered marker in the studied samples was TG689, detected in 84.5% of the plants. Resistance to potato wart disease, a trait under intensive selection at the Center, was identified in 70.6% of the plants. The markers N127 and N195 were also quite prevalent, found in 83.4% and 70.9% of plants, respectively. The rarest marker was Rpi-blb1, observed in only a single sample.
At this stage of the project, gene pyramiding is not the primary objective. Nevertheless, we have identified 107 plants whose genotypes simultaneously contain the markers TG689, N127, N195, and NL25 (Figure 2). Overall, these four markers are the most prevalent in the studied population. Rare markers (Rpi-blb1, Ry186, Gro1-4-1, Rpi-sto1) are present in only a small number of samples, yet some of them form complex genotype combinations with other markers. The most notable multiple resistances involve the markers RyYES3-3, RxSP, and Gpa-2-2 (found in 10 to 35 plants depending on the specific intersection). In total, there are 5 samples containing any 8 markers simultaneously, 26 samples with 7 markers, and 72 samples with 6 markers.
The evaluation of associations between primer pairs revealed several significant linkages (Table 2). Strong associations (Cramér’s V > 0.3, p < 0.01) were established for the pairs TG689–N195 and Gpa-2-2–RxSP, and moderate associations (Cramér’s V > 0.15) for Ry186–RyYES3-3 and RYSC3–RxSP. All these pairs exhibit positive associations between the markers, based on odds ratios (OR > 1).

2.2. Validation of Genotyping Results

Testing for resistance to S. endobioticum (D1) and G. rostochiensis (Ro1) was conducted as part of the state variety trials. Over 9 years, 242 hybrids underwent this testing.
Resistance phenotypes were distributed as follows: for potato wart disease, 211 resistant, 15 moderately resistant, 16 susceptible; for the golden nematode, 183 resistant, 13 moderately resistant, 45 susceptible.
During late blight epiphytotics in the experimental fields of the Ural Federal Agricultural Research Center of the Ural Branch of the Russian Academy of Sciences (see Figure 3 for an example of the field conditions), field observations identified 14 potato hybrids/varieties as resistant and 6 hybrids as susceptible to P. infestans.
Among the six tested molecular markers, three demonstrated a statistically significant (p < 0.001) and strong positive association with the corresponding resistance phenotype (Table 3). The most effective was the NL25 marker: its presence predicted resistance with a positive predictive value (PPV) of 98.5%, and an odds ratio (OR) of 48.75 (95% CI: 10.2–233.8). The TG689 marker demonstrated the highest sensitivity (0.93), although its specificity was moderate (0.60). The N195 marker also showed a high PPV (93.3%) with moderate sensitivity and specificity. The markers Gro1-4-1, Rpi-sto1, and Rpi-blb1 did not show a statistically significant association with resistance (p > 0.05) and possessed low diagnostic characteristics, which preclude their practical use for selection within this population.

3. Discussion

The present study reports the results of multi-year (2018–2025) genotyping of a large potato collection using marker-assisted selection to identify resistance to the most important pathogens affecting the Ural region. Over the course of the project, more than 1000 potato hybrids and varieties were genotyped, with complete data available for all 12 markers in 629 plants. This study presents the first comprehensive report integrating multi-year genotyping data with phenotypic validation from the Ural potato breeding program. While preliminary methodological approaches and screening results for subsets of the material were reported earlier [64,65,66], the consolidated dataset, full-scale marker-trait association analysis, and validation metrics presented here are original and have not been published previously.
The most common markers, each present in more than 400 plants, are TG689, N127, N195, and NL25. According to Russian sources, these are among the most prevalent markers [15]. In 107 plants, or about one-sixth of all plants with complete genotypic data, these same markers occur simultaneously. Overall, within the studied plant group, there are over a hundred possessing 5 or more resistance markers, thus creating favorable conditions for further breeding work.
The identified significant association between TG689 and N195 is not surprising, as both markers are associated with the H1 gene. High association degrees are also characteristic of the Gpa-2-2–RxSP pair, which forms a linkage group. For the Ry186–RyYES3-3 pair, a high and significant OR was found, but with a wide CI due to the rarity of combinations involving the Ry186 marker. The discovered associations between TG689–N127, N195–N127, Gpa-2-2–RYSC3, RYSC3–RxSP, and RyYES3-3–N127 are of interest; these are associations of moderate strength, even though the markers belong to different chromosomes (Table 4). This result may indicate a systemic breeding structure within the collection.
Our results demonstrate the high efficacy of the NL25, TG689, and N195 markers for predicting field resistance to major potato pathogens. The NL25 marker, associated with the Sen1 gene conferring resistance to potato wart disease, showed exceptionally high positive predictive value (PPV = 98.54%) and an odds ratio (OR = 48.75), indicating its particular diagnostic value in our population. These findings are consistent with GWAS analysis data from Polish and German cultivars, where the NL25 marker was also identified as one of the most reliable for detecting resistance to pathotype D1 [70].
The TG689 and N195 markers, both designed to detect the H1 gene for resistance to the golden potato cyst nematode, demonstrated high sensitivity (Se > 0.8) and moderate specificity (Sp ≥ 0.60), along with high predictive ability. Similar observations were made in an earlier breeding study in the Czech Republic, where the TG689 marker showed over 90% correspondence with the phenotypic expression, which aligns with our PPV of 91.04% [10]. Experience from Russian collections (Institute of Plant Industry collection, VIR), where 113 domestic and related potato cultivars were analyzed, showed that the NL25 marker provides high accuracy for detecting resistance to S. endobioticum. However, the predictive ability of markers for the H1 and Gro1-4 genes was significantly more variable, requiring the use of several markers in combination for reliable identification of the resistant genotype [15]. In our study, the Gro1-4-1marker proved uninformative for G. rostochiensis (pathotype Ro1), most likely due to its relatively low frequency in our material.
An unexpected result was obtained during the validation of markers for resistance to late blight (Phytophthora infestans). The Rpi-blb1 and Rpi-sto1 markers, despite their widespread recognition and successful use in European breeding programs, did not demonstrate a statistically significant association with field resistance in our population. This result can primarily be explained by the small sample size of only 20 hybrids/varieties. This observation does not indicate the ineffectiveness of the markers themselves but rather points to their rarity in the Ural breeding material and possibly to different sources of resistance to P. infestans in the local gene pool. In future research, it would be useful to increase the number of markers associated with late blight resistance, in particular to include Rpi-R8, as the observed resistance may be conditioned by other loci [31,71].

4. Materials and Methods

The study utilized hybrid material from the breeding nurseries of the Potato Breeding and Seed Production Center at the Ural Federal Agricultural Research Center of the Ural Branch of the Russian Academy of Sciences.
For DNA extraction from plant samples, the reagent kit “Sorb-GMO-B” (“Syntol,” Moscow, Russia) was employed. PCR was performed using the primers listed in Table 5, with conditions corresponding to the original sources for each marker. A Taq DNA polymerase kit (“Eurogen,” Moscow, Russia) was used for the PCR. The GBSS-3 and BCH-2 markers served as positive controls for DNA extraction. The PCR products were visualized via gel electrophoresis.
Resistance testing of potato hybrids and varieties against S. endobioticum pathotype 1(D1) and G. rostochiensis (pathotype Ro1) was conducted at the All-Russian Research Institute of Starch and Starch-Containing Raw Materials Processing—a Branch of the Russian Potato Research Centre. Based on field observations during epiphytotics, potato hybrids showing resistance and susceptibility to P. infestans were identified.
Genotyping results were entered into Microsoft Excel spreadsheets and analyzed using R v4.5.2 [73]. Results for all markers were coded as 1 for presence and 0 for absence in the genotype. The strength of association between marker pairs was assessed using Cramér’s V, implemented via the assocstats() function from the vcd package [74], while the direction of association was evaluated using the oddsratio() function from the epitools package [75].
Phenotypes were defined as follows: for S. endobioticum and P. infestans: Resistant and Susceptible; for G. rostochiensis: Resistant, Moderately resistant, and Susceptible. For binary categorical analysis, the Resistant and Moderately resistant categories were combined into a single group.
To assess the genotype-phenotype association, contingency table analysis with Odds Ratio (OR) calculation was performed using the epi.2by2() function from the epiR package v2.0.89 [76]. Agreement between genotype and phenotype was evaluated using Weighted Kappa via kappa2(weight = “squared”) from the irr package v0.84.1 [77], and the significance of associations was tested with the chi-square statistic using the chisq.test() function.
Visualization was performed in R using the ggplot2 v4.0.1 [78] and UpSetR v1.4.0 [79] packages.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms27020855/s1.

Author Contributions

Conceptualization, G.A.L. and E.P.S.; methodology, M.A.S. and A.V.S.; validation, G.A.L., M.A.S. and A.V.S.; investigation, G.A.L.; writing—original draft preparation, G.A.L. and V.F.A.; writing—review and editing, G.A.L. and E.P.S.; visualization, G.A.L.; supervision, E.P.S.; funding acquisition, E.P.S. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Ministry of Science and Higher Education of the Russian Federation. The grant was provided within the framework of the State Target: Development of new crop varieties with targeted consumer-oriented traits, resistant to abiotic and biotic stressors, based on existing gene pools and modern breeding methods, capable of realizing their genetic yield potential under unstable climatic conditions (FNUW-2026-0012).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
MASMarker-Assisted Selection
SCARSequence-Characterized Amplified Region
PVXPotato Virus X
PVYPotato Virus Y
PLRVPotato Leafroll Virus
OROdds Ratio
CIConfidence Interval
PPVPositive Predictive Value
SeSensitivity
SpSpecificity

References

  1. Mori, K.; Sakamoto, Y.; Mukojima, N.; Tamiya, S.; Nakao, T.; Ishii, T.; Hosaka, K. Development of a multiplex PCR method for simultaneous detection of diagnostic DNA markers of five disease and pest resistance genes in potato. Euphytica 2011, 180, 347–355. [Google Scholar] [CrossRef]
  2. Ohbayashi, K.; Nakata, N.; Chaya, M.; Komura, K. Development of a detection method of resistance to potato disease and pest using DNA markers. 1. Detection methods of resistance to potato virus X, potato cyst nematode and late blight. Bull. Nagasaki Agric. For. Technol. Dev. Cen. 2010, 1, 1–26. [Google Scholar]
  3. Charkowski, A.; Sharma, K.; Parker, M.L.; Secor, G.A.; Elphinstone, J. Bacterial Diseases of Potato. In The Potato Crop; Campos, H., Ortiz, O., Eds.; Springer Nature: Cham, Switzerland, 2020; Chapter 10; pp. 351–388. [Google Scholar] [CrossRef]
  4. Asano, K.; Kobayashi, A.; Tsuda, S.; Nishinaka, M.; Tamiya, S. DNA marker-assisted evaluation of potato genotypes for potential resistance to potato cyst nematode pathotypes not yet invading into Japan. Breed. Sci. 2012, 62, 142–150. [Google Scholar] [CrossRef] [PubMed]
  5. Milczarek, D. A Multiplex PCR Method of Detecting Markers Linked to Genes Conferring Resistance to Globodera rostochiensis. Am. J. Potato Res. 2012, 89, 169–171. [Google Scholar] [CrossRef]
  6. Hehl, R.; Faurie, E.; Hesselbach, J.; Salamini, F.; Whitham, S.; Baker, B.; Gebhardt, C. TMV resistance gene N homologues are linked to Synchytrium endobioticum resistance in potato. Theor. Appl. Genet. 1999, 98, 379–386. [Google Scholar] [CrossRef]
  7. Dong, S.M.; Zhou, S.Q. Potato late blight caused by Phytophthora infestans: From molecular interactions to integrated management strategies. J. Integr. Agric. 2022, 21, 3456–3466. [Google Scholar] [CrossRef]
  8. Barone, A. Molecular marker-assisted selection for potato breeding. Am. J. Potato Res. 2004, 81, 111–117. [Google Scholar] [CrossRef]
  9. Khlestkina, E.K.; Shumnyy, V.K.; Kolchanov, N.A. Marker-assisted selection and examples of its application in world potato growing. Achiev. Sci. Technol. AICis 2016, 30, 5–8. [Google Scholar]
  10. Milczarek, D.; Plich, J.; Tatarowska, B.; Flis, B. Early selection of potato clones with resistance genes: The relationship between combined resistance and agronomical characteristics. Breed. Sci. 2017, 67, 416–420. [Google Scholar] [CrossRef]
  11. Paran, I.; Michelmore, R.W. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 1993, 85, 985–993. [Google Scholar] [CrossRef]
  12. Obidiegwu, J.E.; Flath, K.; Gebhardt, C. Managing potato wart: A review of present research status and future perspective. Theor. Appl. Genet. 2014, 127, 763–780. [Google Scholar] [CrossRef]
  13. Przetakiewicz, J. The Viability of Winter Sporangia of Synchytrium endobioticum (Schilb.) Perc. from Poland. Am. J. Potato Res. 2015, 92, 704–708. [Google Scholar] [CrossRef]
  14. Gebhardt, C.; Bellin, D.; Henselewski, H.; Lehmann, W.; Schwarzfischer, J.; Valkonen, J.P. Marker-assisted combination of major genes for pathogen resistance in potato. Theor. Appl. Genet. 2006, 112, 1458–1464. [Google Scholar] [CrossRef] [PubMed]
  15. Antonova, O.Y.; Shvachko, N.A.; Novikova, L.Y.; Shuvalov, O.Y.; Kostina, L.I.; Klimenko, N.S.; Shuvalova, A.R.; Gavrilenko, T.A. Genetic diversity of potato varieties bred in Russia and its neighboring countries based on the polymorphism of SSR-loci and markers associated with resistance R-genes. Russ. J. Genet. Appl. Res. 2017, 7, 489–500. [Google Scholar] [CrossRef]
  16. Bartkiewicz, A.; Chilla, F.; Terefe-Ayana, D.; Lübeck, J.; Strahwald, J.; Tacke, E.; Hofferbert, H.R.; Flath, K.; Linde, M.; Debener, T. Improved genetic resolution for linkage mapping of resistance to potato wart in monoparental dihaploids with potential diagnostic value in tetraploid potato varieties. Theor. Appl. Genet. 2018, 131, 2555–2566. [Google Scholar] [CrossRef] [PubMed]
  17. Przetakiewicz, J.; Plich, J. Assessment of potato resistance to Synchytrium endobioticum. Plant Breed. Seed Sci. 2017, 76, 37–43. [Google Scholar] [CrossRef]
  18. Haverkort, A.J.; Boonekamp, P.M.; Hutten, R.; Jacobsen, E.; Lotz, L.A.P.; Kessel, G.J.T.; Visser, R.G.F.; van der Vossen, E.A.G. Societal costs of late blight in potato and prospects of durable resistance through cisgenic modification. Potato Res. 2008, 51, 47–57. [Google Scholar] [CrossRef]
  19. Haverkort, A.J.; Boonekamp, P.M.; Hutten, R.; Jacobsen, E.; Lotz, L.A.P.; Kessel, G.J.T.; Vossen, J.H.; Visser, R.G.F. Durable late blight resistance in potato through dynamic varieties obtained by cisgenesis: Scientific and societal advances in the DuRPh Project. Potato Res. 2016, 59, 35–66. [Google Scholar] [CrossRef]
  20. Haverkort, A.J.; Struik, P.C.; Visser, R.G.F.; Jacobsen, E. Applied biotechnology to combat late blight in potato caused by Phytophthora infestans. Potato Res. 2009, 52, 249–264. [Google Scholar] [CrossRef]
  21. Elansky, C.H. Late blight of potato in Russia. Potato Prot. 2015, 1, 8–11. [Google Scholar]
  22. Ivanov, A.I.; Ivanova, Z.A.; Yakusheva, O.I.; Filippov, P.A. Potato responsiveness to fertilizers and crop losses from late blight in the North-West of Russia. Potatoes Veg. 2019, 8, 23–26. [Google Scholar] [CrossRef]
  23. Angmo, D.; Sharma, S.P.; Kalia, A. Breeding strategies for late blight resistance in potato crop: Recent developments. Mol. Biol. Rep. 2023, 50, 7879–7891. [Google Scholar] [CrossRef]
  24. Berindean, I.V.; Taoutaou, A.; Rida, S.; Ona, A.D.; Stefan, M.F.; Costin, A.; Racz, I.; Muntean, L. Modern Breeding Strategies and Tools for Durable Late Blight Resistance in Potato. Plants 2024, 13, 1711. [Google Scholar] [CrossRef]
  25. Song, J.; Bradeen, J.M.; Naess, S.K.; Raasch, J.A.; Wielgus, S.M.; Haberlach, G.T.; Liu, J.; Kuang, H.; Austin-Phillips, S.; Buell, C.R.; et al. Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proc. Natl. Acad. Sci. USA 2003, 100, 9128–9133. [Google Scholar] [CrossRef] [PubMed]
  26. Van Der Vossen, E.; Sikkema, A.; Hekkert, B.T.L.; Gros, J.; Stevens, P.; Muskens, M.; Wouters, D.; Pereira, A.; Stiekema, W.; Allefs, S. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. Plant J. 2003, 36, 867–882. [Google Scholar] [CrossRef] [PubMed]
  27. Helgeson, J.P.; Haberlach, G.T. Somatic Hybrids of Solanum Tuberosum and Related Species. In Plant Biotechnology and In Vitro Biology in the 21st Century; Altman, A., Ziv, M., Izhar, S., Eds.; Current Plant Science and Biotechnology in Agriculture; Springer: Dordrecht, The Netherlands, 1999; Volume 36, pp. 151–154. [Google Scholar] [CrossRef]
  28. Wang, M.; Allefs, S.; van den Berg, R.G.; Vleeshouwers, V.G.; van der Vossen, E.A.; Vosman, B. Allele mining in Solanum: Conserved homologues of Rpi-blb1 are identified in Solanum stoloniferum. Theor. Appl. Genet. 2008, 116, 933–943. [Google Scholar] [CrossRef]
  29. Vleeshouwers, V.G.A.A.; Rietman, H.; Krenek, P.; Champouret, N.; Young, C.; Oh, S.K.; Wang, M.; Bouwmeester, K.; Vosman, B.; Visser, R.G.F.; et al. Effector genomics accelerates discovery and functional profiling of potato disease resistance and Phytophthora infestans avirulence genes. PLoS ONE 2008, 3, e2875. [Google Scholar] [CrossRef]
  30. Zhu, S.; Li, Y.; Vossen, J.H.; Visser, R.G.; Jacobsen, E. Functional stacking of three resistance genes against Phytophthora infestans in potato. Transgenic Res. 2012, 21, 89–99. [Google Scholar] [CrossRef] [PubMed]
  31. Ivanova, E.A.; Alpatieva, N.V.; Rogozina, E.V. Molecular markers as a tool in potato breeding for late blight resistance. Plant Biotechnol. Breed. 2025, 8, 5–22. [Google Scholar] [CrossRef]
  32. Oerke, E.-C.; Dehne, H.-W.; Schönbeck, F.; Weber, A. Crop Production and Crop Protection: Estimated Losses in Major Food and Cash Crops; Elsevier Science B.V.: Amsterdam, The Netherlands, 1994; pp. 450–535. [Google Scholar] [CrossRef]
  33. Mugniéry, D.; Plantard, O.; Fournet, S.; Grenier, E.; Caromel, B.; Kerlan, M.-C.; Picard, D.; Ellissèche, D. Evaluation de l’efficacité etde la durabilité des resistances à Globodera pallida PA2/3, provenant de Solanum vernei, S. spegazzinii, et S. sparsipilum. Nematol. Mediterr. 2007, 35, 143–153. [Google Scholar]
  34. Barone, A.; Ritter, E.; Schachtschabel, U.; Debener, T.; Salamini, F.; Gebhardt, C. Localization by restriction fragment length polymorphism mapping in potato of a major dominant gene conferring resistance to the potato cyst nematode Globodera rostochiensis. Mol. Gen. Genet. 1990, 224, 177–182. [Google Scholar] [CrossRef]
  35. Paal, J.; Henselewski, H.; Muth, J.; Meksem, K.; Menéndez, C.M.; Salamini, F.; Ballvora, A.; Gebhardt, C. Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach. Plant J. 2004, 38, 285–297. [Google Scholar] [CrossRef]
  36. Schwarzfischer, A.; Behn, A.; Groth, J.; Reichmann, M.; Kellermann, A.; Songe, Y.S. Marker-assisted selection in practical potato breeding—Experience and outlook. In Proceedings of the Jahrestagung der Vereinigung der Pflanzenzüchter und Saatgutkaufleute Österreichs, Raumberg-Gumpenstein, Irdning, Austria, 24–26 November 2009; pp. 81–85. [Google Scholar]
  37. Gebhardt, C.; Valkonen, J.P. Organization of genes controlling disease resistance in the potato genome. Annu. Rev. Phytopathol. 2001, 39, 79–102. [Google Scholar] [CrossRef]
  38. van der Voort, J.R.; Wolters, P.; Folkertsma, R.; Hutten, R.; van Zandvoort, P.; Vinke, H.; Kanyuka, K.; Bendahmane, A.; Jacobsen, E.; Janssen, R.; et al. Mapping of the cyst nematode resistance locus Gpa2 in potato using a strategy based on comigrating AFLP markers. Theor. Appl. Genet. 1997, 95, 874–880. [Google Scholar] [CrossRef]
  39. van der Voort, J.; van Eck, H.; van Zandvoort, P.; Overmars, H.; Helder, J.; Bakker, J. Linkage analysis by genotyping of sibling populations: A genetic map for the potato cyst nematode constructed using a “pseudo-F2” mapping strategy. Mol. Gen. Genet. 1999, 261, 1021–1031. [Google Scholar] [CrossRef]
  40. Bakker, E.; Butterbach, P.; Rouppe van der Voort, J.; van der Vossen, E.; van Vliet, J.; Bakker, J.; Goverse, A. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato. Theor. Appl. Genet. 2003, 106, 1524–1531. [Google Scholar] [CrossRef]
  41. Ortega, F.; Lopez-Vizcon, C. Application of Molecular Marker-Assisted Selection (MAS) for Disease Resistance in a Practical Potato Breeding Programme. Potato Res. 2012, 55, 1–13. [Google Scholar] [CrossRef]
  42. Biryukova, V.A.; Shmyglya, I.V.; Meleshin, A.A.; Mitushkin, A.V.; Manankov, V.V.; Abrosimova, S.B. Study of genetic collections of the All-russian Research Institute of Potato Farming by means of molecular markers. Achiev. Sci. Technol. AICis 2016, 30, 22–26. [Google Scholar]
  43. Bakulina, A.V.; Savintseva, L.S.; Bashlakova, O.N.; Sintsova, N.F. Molecular screening of potato varieties bred by Falenki Breeding station for resistance to phytopathogens. Agric. Sci. Euro-North-East 2021, 22, 340–350. [Google Scholar] [CrossRef]
  44. Gerieva, F.T.; Gazdanova, I.O. Molecular and genetic analysis of potato cultivars from the collection of VSC RAS for resistance to phytopathogens. Agrar. Sci. J. 2022, 6, 11–14. [Google Scholar] [CrossRef]
  45. Shaikhaldein, H.O.; Hoffmann, B.; Alaraidh, I.A.; Aseel, D.G. Evaluation of extreme resistance genes of Potato virus X (Rx1 and Rx2) in different potato genotypes. J. Plant Dis. Prot. 2018, 125, 251–257. [Google Scholar] [CrossRef]
  46. Nadeem, A.; Aslam Khan, M.; Ahmad Khan, N.; Binyamin, R.; Azam Khan, M. Identification of resistance source in Potato Germplasm against PVX and PVY. Pak. J. Bot. 2011, 43, 2745–2749. [Google Scholar]
  47. van der Voort, J.R.; Kanyuka, K.; van der Vossen, E.; Bendahmane, A.; Mooijman, P.; Klein-Lankhorst, R.; Stiekema, W.; Baulcombe, D.; Bakker, J. Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a single segment introgressed from the wild species Solanum tuberosum subsp. andigena CPC 1673 into cultivated potato. Mol. Plant-Microbe Interact. 1999, 12, 197–206. [Google Scholar] [CrossRef]
  48. Karasev, A.V.; Gray, S.M. Continuous and emerging challenges of Potato virus Y in potato. Annu. Rev. Phytopathol. 2013, 51, 571–586. [Google Scholar] [CrossRef]
  49. Solomon-Blackburn, R.M.; Barker, H. Breeding virus resistant potatoes (Solanum tuberosum): A review of traditional and molecular approaches. Heredity 2001, 86, 17–35. [Google Scholar] [CrossRef]
  50. Munoz, F.J.; Plaisted, R.L.; Thurston, H.D. Resistance to potato virus Y in Solanum tuberosum spp. andigena. Am. Potato J. 1975, 52, 107–115. [Google Scholar] [CrossRef]
  51. Ross, H. Inheritance of extreme resistance to virus Y in Solanum stoloniferum and its hybrids with Solanum tuberosum. In Proceedings of the Third Conference on Potato Virus Diseases, Lisse-Wagemomgen, The Netherlands, 24–28 June 1957; pp. 204–211. [Google Scholar]
  52. Asama, K.; Ito, H.; Murakami, N.; Itoh, T. New potato variety “Konafubuki”. Bull. Hokkaido Prefect. Agric. Exp. Stn. 1982, 48, 75–84. [Google Scholar]
  53. Hosaka, K.; Hosaka, Y.; Mori, M.; Maida, T.; Matsunaga, H. Detection of a simplex RAPD marker linked to resistance to potato virus Y in a tetraploid potato. Am. J. Potato Res. 2001, 78, 191–196. [Google Scholar] [CrossRef]
  54. Hämäläinen, J.; Sorri, V.; Watanabe, K.; Gebhardt, C.; Valkonen, J.P.T. Molecular examination of a chromosome region that controls resistance to potato Y and A potyviruses in potato. Theor. Appl. Genet. 1998, 96, 1036–1043. [Google Scholar] [CrossRef]
  55. Song, Y.S.; Hepting, L.; Schweizer, G.; Hartl, L.; Wenzel, G.; Schwarzfischer, A. Mapping of extreme resistance to PVY (Ry (sto)) on chromosome XII using anther-culture-derived primary dihaploid potato lines. Theor. Appl. Genet. 2005, 111, 879–887. [Google Scholar] [CrossRef]
  56. Kasai, K.; Morikawa, Y.; Sorri, V.A.; Valkonen, J.P.; Gebhardt, C.; Watanabe, K.N. Development of SCAR markers to the PVY resistance gene Ryadg based on a common feature of plant disease resistance genes. Genome 2000, 43, 1–8. [Google Scholar] [CrossRef] [PubMed]
  57. Song, Y.S.; Schwarzfischer, A. Development of STS Markers for Selection of Extreme Resistance (Ry sto) to PVY and Maternal Pedigree Analysis of Extremely Resistant Cultivars. Am. J. Potato Res. 2008, 85, 159–170. [Google Scholar] [CrossRef]
  58. Mori, K.; Mukojima, N.; Nakao, T.; Tamiya, S.; Sakamoto, Y.; Sohbaru, N.; Hayashi, K.; Watanuki, H.; Nara, K.; Yamazaki, K.; et al. Germplasm Release: Saikai 35, a Male and Female Fertile Breeding Line Carrying Solanum phureja-Derived Cytoplasm and Potato Cyst Nematode Resistance (H1) and Potato Virus Y Resistance (Rychc) Genes. Am. J. Potato Res. 2012, 89, 63–72. [Google Scholar] [CrossRef]
  59. Voronkova, E.V.; Rusetskiy, N.V.; Luksha, V.I.; Gukasian, O.B.; Zharich, V.M.; Yermishin, A.P. Marker assisted selection of potato breeding lines with combination of PVY resistance genes from different wild species. Plant Biotechnol. Breed. 2019, 2, 6–14. [Google Scholar] [CrossRef]
  60. Pechenkina, V.; Boronnikova, S. Infection With X and Y Viruses of Planting Material of Potato Varieties (Solanum tuberosum L.) Grown in the Perm Krai. Bull. Sci. Pract. 2020, 6, 203–210. [Google Scholar] [CrossRef]
  61. Beketova, M.P.; Chalaya, N.A.; Zoteyeva, N.M.; Gurina, A.A.; Kuznetsova, M.A.; Armstrong, M.; Hein, I.; Drobyazina, P.E.; Khavkin, E.E.; Rogozina, E.V. Combination Breeding and Marker-Assisted Selection to Develop Late Blight Resistant Potato Cultivars. Agronomy 2021, 11, 2192. [Google Scholar] [CrossRef]
  62. Klimenko, N.S.; Antonova, O.Y.; Zheltova, V.V.; Fomina, N.A.; Kostina, L.I.; Mamadbokirova, F.T.; Gavrilenko, T.A. Screening of Russian potato cultivars (Solanum tuberosum L.) with DNA markers linked to the R-genes conferring extreme resistance to potato virus Y. Agric. Biol. 2019, 54, 958–969. [Google Scholar] [CrossRef]
  63. Klimenko, N.S.; Gavrilenko, T.A.; Chukhina, I.G.; Gadzhiev, N.M.; Evdokimova, Z.Z.; Lebedeva, V.A. Nomenclatural standards and genetic passports of potato cultivars bred at the Leningrad Research Institute for Agriculture “Belogorka”. Plant Biotechnol. Breed. 2020, 3, 18–54. [Google Scholar] [CrossRef]
  64. Shanina, E.P.; Sergeeva, L.S. Applying DNA marker to detect R-genes of nematode-resistance among potato varieties and interspecies hybrids. In Proceedings of the International Scientific and Practical Conference “AgroSMART-Smart Solutions for Agriculture” (AgroSMART 2018), Tyumen, Russia, 16–20 July 2018; Volume 151, pp. 636–640. [Google Scholar] [CrossRef]
  65. Shanina, E.P.; Sergeeva, L.B.; Stafeeva, M.A.; Klyukina, E.M. Use of DNA Markers to Examine the Source Breeding Material of Potato. Achiev. Sci. Technol. Agro-Ind. Complex 2018, 32, 47–49. [Google Scholar] [CrossRef]
  66. Shanina, E.P.; Likhodeyevsky, G.A. Evaluation of interspecific potato breeding material with a complex of genes of immunity to potato virus y using molecular markers. Agron. J. 2021, 19, 224–231. [Google Scholar] [CrossRef]
  67. Kacheyo, O.C.; van Dijk, L.C.M.; de Vries, M.E.; Struik, P.C. Augmented descriptions of growth and development stages of potato (Solanum tuberosum L.) grown from different types of planting material. Ann. Appl. Biol. 2021, 178, 549–566. [Google Scholar] [CrossRef]
  68. Bakker, E.; Achenbach, U.; Bakker, J.; van Vliet, J.; Peleman, J.; Segers, B.; van der Heijden, S.; van der Linde, P.; Graveland, R.; Hutten, R.; et al. A high-resolution map of the H1 locus harbouring resistance to the potato cyst nematode Globodera rostochiensis. Theor. Appl. Genet. 2004, 109, 146–152. [Google Scholar] [CrossRef]
  69. Marczewski, W.; Flis, B.; Syller, J.; Schäfer-Pregl, R.; Gebhardt, C. A major quantitative trait locus for resistance to Potato leafroll virus is located in a resistance hotspot on potato chromosome XI and is tightly linked to N-gene-like markers. Mol. Plant-Microbe Interact. 2001, 14, 1420–1425. [Google Scholar] [CrossRef] [PubMed]
  70. Prodhomme, C.; Vos, P.G.; Paulo, M.J.; Tammes, J.E.; Visser, R.G.F.; Vossen, J.H.; van Eck, H.J. Distribution of P1(D1) wart disease resistance in potato germplasm and GWAS identification of haplotype-specific SNP markers. Theor. Appl. Genet. 2020, 133, 1859–1871. [Google Scholar] [CrossRef] [PubMed]
  71. Tan, M.Y.; Hutten, R.C.; Visser, R.G.; van Eck, H.J. The effect of pyramiding Phytophthora infestans resistance genes R Pi-mcd1 and R Pi-ber in potato. Theor. Appl. Genet. 2010, 121, 117–125. [Google Scholar] [CrossRef]
  72. Galek, R.; Rurek, M.; De Jong, W.S.; Pietkiewicz, G.; Augustyniak, H.; Sawicka-Sienkiewicz, E. Application of DNA markers linked to the potato H1 gene conferring resistance to pathotype Ro1 of Globodera rostochiensis. J. Appl. Genet. 2011, 52, 407–411. [Google Scholar] [CrossRef]
  73. R: A Language and Environment for Statistical Computing. Available online: https://www.R-project.org/ (accessed on 18 December 2025).
  74. Meyer, D.; Zeileis, A.; Hornik, K. The Strucplot Framework: Visualizing Multi-way Contingency Tables with vcd. J. Stat. Softw. 2006, 17, 1–48. [Google Scholar] [CrossRef]
  75. epitools: Epidemiology Tools. Available online: https://CRAN.R-project.org/package=epitools (accessed on 18 December 2025).
  76. epiR: Tools for the Analysis of Epidemiological Data. Available online: https://CRAN.R-project.org/package=epiR (accessed on 18 December 2025).
  77. irr: Various Coefficients of Interrater Reliability and Agreement. Available online: https://CRAN.R-project.org/package=irr (accessed on 18 December 2025).
  78. Wickham, H. ggplot2 Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2009; pp. 1–213. [Google Scholar] [CrossRef]
  79. UpSetR: A More Scalable Alternative to Venn and Euler Diagrams for Visualizing Intersecting Sets. Available online: https://CRAN.R-project.org/package=UpSetR (accessed on 18 December 2025).
Ijms 27 00855 g001
Figure 1. Frequency of resistance markers in potato samples across years (2018–2025). The bar charts show the percentage of samples positive for each molecular marker divided by group associated with resistance to fungal, viral and nematode pathogens. The total number of samples analyzed each year is indicated above the corresponding group of bars.
Figure 1. Frequency of resistance markers in potato samples across years (2018–2025). The bar charts show the percentage of samples positive for each molecular marker divided by group associated with resistance to fungal, viral and nematode pathogens. The total number of samples analyzed each year is indicated above the corresponding group of bars.
Ijms 27 00855 g001
Ijms 27 00855 g002
Figure 2. UpSet diagram displaying the distribution and intersections of molecular markers for resistance genes in the studied potato plant collection. The horizontal axis shows the size of individual sets (number of plants carrying each marker), and the vertical axis shows the size of intersections (number of plants with specific marker combinations).
Figure 2. UpSet diagram displaying the distribution and intersections of molecular markers for resistance genes in the studied potato plant collection. The horizontal axis shows the size of individual sets (number of plants carrying each marker), and the vertical axis shows the size of intersections (number of plants with specific marker combinations).
Ijms 27 00855 g002
Ijms 27 00855 g003
Figure 3. An example of high resistance of a new potato cultivar to late blight under Phytophthora infestans epiphytotic conditions. On the right, complete plant death of susceptible potato cultivars is shown. The plant development phase corresponds to stages 3 and 4 according to Kacheyo et al. 2021 [67].
Figure 3. An example of high resistance of a new potato cultivar to late blight under Phytophthora infestans epiphytotic conditions. On the right, complete plant death of susceptible potato cultivars is shown. The plant development phase corresponds to stages 3 and 4 according to Kacheyo et al. 2021 [67].
Ijms 27 00855 g003
Table 1. Total number of resistant plant forms by molecular marker identified over the entire period.
Table 1. Total number of resistant plant forms by molecular marker identified over the entire period.
NL25Rpi-blb1Rpi-sto1N127RYSC3Ry186RyYES3-3RxSPGpa-2-2Gro1-4-1TG689N195
Genotyping results from 2018 to 2025
628113364916275177278341114926493
With full genotypes
444143525491313216919625532446
Table 2. Assessment of pairwise associations of molecular markers: Odds Ratios, Cramér’s V coefficient and p-values for identifying significant linkages between loci.
Table 2. Assessment of pairwise associations of molecular markers: Odds Ratios, Cramér’s V coefficient and p-values for identifying significant linkages between loci.
Marker PairsOR (95% CI)Cramér’s Vp-Value
TG689–N1958.5 (5.1:14.3)0.39<0.001
TG689–N1272.3 (1.3:3.9)0.130.002
N195–N1271.9 (1.2:3.1)0.120.004
Gpa-2-2–RYSC32.5 (1.3:4.7)0.120.003
Gpa-2-2–RxSP16.2 (10.4:25.7)0.57<0.001
RYSC3–RxSP3.5 (1.8:6.5)0.17<0.001
Ry186–RyYES3-322.4 (4.8:209.5)0.23<0.001
RyYES3–3-N1272.8 (1.4:6.3)0.120.003
Table 3. Association of molecular markers with phenotypic resistance.
Table 3. Association of molecular markers with phenotypic resistance.
MarkerNMarker+/Resistance (PPV, %)OR (95% CI)p-ValueSensitivitySpecificityKappa
NL25168135/137 (98.5)48.75 (10.2:233.8)<0.0010.880.870.51
TG689241183/201 (91.0)21.12 (9.3:47.9)<0.0010.930.60.56
N19512083/89 (93.3)9.99 (3.4:29.8)<0.0010.820.680.40
Gro1-4-124124/31 (77.4)0.76 (0.3:1.9)0.740.120.84−0.01
Rpi-sto12012/18 (66.7)n/c0.330.860−0.18
Rpi-blb1201/1 (100.0)n/c0.500.0710.04
n/c—not calculable due to a zero cell in the contingency table.
Table 4. Chromosomal organization of potato resistance genes to pathogens.
Table 4. Chromosomal organization of potato resistance genes to pathogens.
MarkerGene/ResistanceChromosomeSource
TG689
N195		H1 (G. rostochiensis)V[68]
N127PLRV.1 (PLRV)XI[69]
RYSC3Ryadg (PVY)XI[56]
Ry186Rychc (PVY)XI[56]
RyYES3-3Rysto (PVY)XI[14]
Gpa-2-2Gpa2 (G. pallida)XII[47]
RxSPRx1 (PVX)XII[47]
Table 5. List of primers, markers, and their target genes.
Table 5. List of primers, markers, and their target genes.
GeneTraitMarker Product sizePrimer Pairs (5′–3′)Source
Sen1Resistance to potato wart diseaseNL251400F: TATTGTTAATCGTTACTCCCTC
R: AGAGTCGTTTTACCGACTCC		[14]
Rpi-blblResistance to late blight.Rpi-blb1821F: AACCTGTATGGCAGTGGCATG
R: GTCAGAAAAGGGCACTCGTG		[28]
Rpi-sto1Rpi-sto1890F: ACCAAGGCCACAAGATTCTC
R: CCTGCGGTTCGGTTAATACA		[30]
PLRV1Resistance to leaf roll virusNl271164F: TAGAGAGCATTAAGAAGCTGC
R: TTTTGCCTACTCCCGGCATG		[69]
RyadgResistance to PVYRYSC3321F: ATACACTCATCTAAATTTGATGG
R: AGGATATACGGCATCATTTTTCCGA		[56]
RychcRy186587F: TGGTAGGGATATTTTCCTTAGA
R: GCAAATCCTAGGTTATCAACTCA		[1]
RystoYES3-3A341F: TAACTCAAGCGGAATAACCC
R: AATTCACCTGTTTACATGCTTCTTGTG		[5]
Rx1Resistance to PVXRxSP1230F: ATCTTGGTTTGAATACATGG
R: CACAATATTGGAAGGATTCA		[2]
Gpa2-2Resistance to G. pallidaGpa2-2452F: GCACTTAGAGACTCATTCCA
R: ACAGATTGTTGGCAGCGAAA		[4]
Gro1-4Resistance to G. rostochiensisGro1-4-1602F: AAGCCACAACTCTACTGGAG
R: GATATAGTACGTAATCATGCC		[4]
H1TG689141F: TAAAACTCTTGGTTATAGCCTAT
R: CAATAGAATGTGTTGTTTCACCAA		[41]
N195337F: TGGAAATGGCACCCACTA
R: CATCATGGTTTCACTTGTCAC		[4]
GBSSGranule-bound starch synthaseGBSS-3853F: AAAGGAGGCTCTTCAAGCAG
R: TGCAAGAGCTCTAGCAACTG		[4]
BCHBeta-carotene hydroxylaseBCH-2290F: CATGACATAGTTTGAATTTTGAGTC
R: GCTTTGGCGCTGCCGTAAGTT		[72]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lihodeevskiy, G.A.; Shanina, E.P.; Stafeeva, M.A.; Akhmetkhanov, V.F.; Shalaeva, A.V. Marker-Assisted Selection for Disease Resistance in Potato Breeding in the Ural Region of Russia (2018–2025): Comprehensive Genotyping and Validation of Key Resistance Markers. Int. J. Mol. Sci. 2026, 27, 855. https://doi.org/10.3390/ijms27020855

AMA Style

Lihodeevskiy GA, Shanina EP, Stafeeva MA, Akhmetkhanov VF, Shalaeva AV. Marker-Assisted Selection for Disease Resistance in Potato Breeding in the Ural Region of Russia (2018–2025): Comprehensive Genotyping and Validation of Key Resistance Markers. International Journal of Molecular Sciences. 2026; 27(2):855. https://doi.org/10.3390/ijms27020855

Chicago/Turabian Style

Lihodeevskiy, Georgiy A., Elena P. Shanina, Maria A. Stafeeva, Vadim F. Akhmetkhanov, and Arina V. Shalaeva. 2026. "Marker-Assisted Selection for Disease Resistance in Potato Breeding in the Ural Region of Russia (2018–2025): Comprehensive Genotyping and Validation of Key Resistance Markers" International Journal of Molecular Sciences 27, no. 2: 855. https://doi.org/10.3390/ijms27020855

APA Style

Lihodeevskiy, G. A., Shanina, E. P., Stafeeva, M. A., Akhmetkhanov, V. F., & Shalaeva, A. V. (2026). Marker-Assisted Selection for Disease Resistance in Potato Breeding in the Ural Region of Russia (2018–2025): Comprehensive Genotyping and Validation of Key Resistance Markers. International Journal of Molecular Sciences, 27(2), 855. https://doi.org/10.3390/ijms27020855

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop