Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers
Abstract
1. Introduction
2. Results
2.1. Identification of SSR Loci
2.2. EST-SSR Marker Development and Their Effectiveness Among Different Cultivars
2.3. Genetic Assessment via Neighbor-Joining Cluster Analysis
2.4. Genetic Assessment via Population Structure Analysis
2.5. Establishment of a Core Germplasm Repository
3. Discussion
3.1. Genetic Diversity and Genetic Structure in Blackcurrant
3.2. Construction of Core Germplasm Resources
3.3. Genetic Polymorphisms Within the Ribes Genus
4. Materials and Methods
4.1. Plant Materials
4.2. DNA Extraction and Quantification
4.3. Genotyping with EST-SSR Markers
4.4. Statistical Analysis
4.5. Construction of a Core Germplasm Repository
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Weigend, M. Grossulariaceae: Grossulariaceae DC. in Lam. & DC., Fl. Franç., ed. 3., 4, 2: 405 (1805), nom. cons. In Flowering Plants. Eudicots: Berberidopsidales, Buxales, Crossosomatales, Fabales p.p., Geraniales, Gunnerales, Myrtales p.p., Proteales, Saxifragales, Vitales, Zygophyllales, Clusiaceae Alliance, Passifloraceae Alliance, Dilleniaceae, Huaceae, Picramniaceae, Sabiaceae; Springer: Berlin/Heidelberg, Germany, 2007; pp. 168–176. [Google Scholar]
- FAOSTAT. Agricultural Organization of the United Nations (2022). Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 29 January 2024).
- Slimestad, R.; Solheim, H. Anthocyanins from black currants (Ribes nigrum L.). J. Agric. Food Chem. 2002, 50, 3228–3231. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Liu, G.; Yu, Z.; Song, X.; Li, X.; Yang, Y.; Wang, L.; Liu, L.; Dai, J. Purification, characterization and antiglycation activity of a novel polysaccharide from black currant. Food Chem. 2016, 199, 694–701. [Google Scholar] [CrossRef]
- Zhang, J.; Sun, L.; Dong, Y.; Fang, Z.; Nisar, T.; Zhao, T.; Wang, Z.-C.; Guo, Y. Chemical compositions and α-glucosidase inhibitory effects of anthocyanidins from blueberry, blackcurrant and blue honeysuckle fruits. Food Chem. 2019, 299, 125102. [Google Scholar] [CrossRef] [PubMed]
- Barik, S.K.; Russell, W.R.; Moar, K.M.; Cruickshank, M.; Scobbie, L.; Duncan, G.; Hoggard, N. The anthocyanins in black currants regulate postprandial hyperglycaemia primarily by inhibiting α-glucosidase while other phenolics modulate salivary α-amylase, glucose uptake and sugar transporters. J. Nutr. Biochem. 2020, 78, 108325. [Google Scholar] [CrossRef] [PubMed]
- Hui, X.; Wu, G.; Han, D.; Stipkovits, L.; Wu, X.; Tang, S.; Brennan, M.A.; Brennan, C.S. The effects of bioactive compounds from blueberry and blackcurrant powders on the inhibitory activities of oat bran pastes against α-amylase and α-glucosidase linked to type 2 diabetes. Food Res. Int. 2020, 138, 109756. [Google Scholar] [CrossRef]
- Piasecka, I.; Brzezińska, R.; Kalisz, S.; Wiktor, A.; Górska, A. Recovery of antioxidants and oils from blackcurrant and redcurrant wastes by ultrasound-assisted extraction. Food Biosci. 2024, 57, 103511. [Google Scholar] [CrossRef]
- Sovová, H.; Topiař, M.; Pleskač, O. 1,3-Selective hydrolysis of blackcurrant seed oil for the concentration of alpha- and gamma-linolenic acids. J. Supercrit. Fluids 2023, 200, 105999. [Google Scholar] [CrossRef]
- Cortez, R.E.; Gonzalez de Mejia, E. Blackcurrants (Ribes nigrum): A Review on Chemistry, Processing, and Health Benefits. J. Food Sci. 2019, 84, 2387–2401. [Google Scholar] [CrossRef]
- Gopalan, A.; Reuben, S.C.; Ahmed, S.; Darvesh, A.S.; Hohmann, J.; Bishayee, A. The health benefits of blackcurrants. Food Funct. 2012, 3, 795–809. [Google Scholar] [CrossRef]
- Wei, S.; Zhiguo, D.; Junwei, H. Efficient Cultivation Techniques of Blackcurrant; Heilongjiang Science and Technology Press: Harbin, China, 2004; pp. 6–7. [Google Scholar]
- Qin, D.; Huo, J.; Sui, W.; Zhang, Z. Black currant production, breeding and processing in China. Acta Hortic. 2012, 926, 119–122. [Google Scholar]
- Li, Y. Berry Cultivation; China Agriculture Press: Beijing, China, 2023; pp. 173–175. [Google Scholar]
- Li, Q.; Chen, L.; Ding, Q.; Lin, G. The stable isotope signatures of blackcurrant (Ribes nigrum L.) in main cultivation regions of China: Implications for tracing geographic origin. Eur. Food Res. Technol. 2013, 237, 109–116. [Google Scholar] [CrossRef]
- Zhang, W.; Tang, J.; Zhang, S.; Yu, W.; Liu, C.; Gao, H. A Blackcurrant (Ribes nigrum L.) Cultivar: Danjianghei. HortScience 2024, 59, 1065–1066. [Google Scholar] [CrossRef]
- Kumar, S.P.J.; Susmita, C.; Sripathy, K.V.; Agarwal, D.K.; Pal, G.; Singh, A.N.; Kumar, S.; Rai, A.K.; Simal-Gandara, J. Molecular characterization and genetic diversity studies of Indian soybean (Glycine max (L.) Merr.) cultivars using SSR markers. Mol. Biol. Rep. 2022, 49, 2129–2140. [Google Scholar] [CrossRef]
- Agarwal, M.; Shrivastava, N.; Padh, H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep. 2008, 27, 617–631. [Google Scholar] [CrossRef]
- Lanham, P.; Brennan, R.; Hackett, C.; McNicol, R. RAPD fingerprinting of blackcurrant (Ribes nigrum L.) cultivars. Theor. Appl. Genet. 1995, 90, 166–172. [Google Scholar] [CrossRef] [PubMed]
- Lanham, P. Estimation of heterozygosity in Ribes nigrum L. using RAPD markers. Genetica 1996, 98, 193–197. [Google Scholar] [CrossRef]
- Ipek, A.; Barut, E.; Gulen, H.; Ipek, M. Genetic Diversity Among Some Currants (Ribes spp.) Cultivars As Assessed BY AFLP MARKERS. Pak. J. Bot. 2010, 42, 1009–1012. [Google Scholar]
- Mazeikiene, I.; Bendokas, V.; Baniulis, D.; Staniene, G.; Juskyte, D.A.; Sasnauskas, A.; Stanys, V.; Siksnianas, T. Genetic background of resistance to gall mite in Ribes species. Agric. Food Sci. 2017, 26, 111–117. [Google Scholar] [CrossRef][Green Version]
- Brennan, R.; Jorgensen, L.; Woodhead, M.; Russell, J. Development and characterization of SSR markers in Ribes species. Mol. Ecol. Notes 2002, 2, 327–330. [Google Scholar] [CrossRef]
- Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef]
- Taheri, S.; Lee Abdullah, T.; Yusop, M.R.; Hanafi, M.M.; Sahebi, M.; Azizi, P.; Shamshiri, R.R. Mining and development of novel SSR markers using next generation sequencing (NGS) data in plants. Molecules 2018, 23, 399. [Google Scholar] [CrossRef]
- Li, L.; Zhang, H.; Liu, Z.; Cui, X.; Zhang, T.; Li, Y.; Zhang, L. Comparative transcriptome sequencing and de novo analysis of Vaccinium corymbosum during fruit and color development. BMC Plant Biol. 2016, 16, 223. [Google Scholar] [CrossRef]
- Foster, T.M.; Bassil, N.V.; Dossett, M.; Leigh Worthington, M.; Graham, J. Genetic and genomic resources for Rubus breeding: A roadmap for the future. Hortic. Res. 2019, 6, 116. [Google Scholar] [CrossRef]
- Emanuelli, F.; Lorenzi, S.; Grzeskowiak, L.; Catalano, V.; Stefanini, M.; Troggio, M.; Myles, S.; Martinez-Zapater, J.M.; Zyprian, E.; Moreira, F.M.; et al. Genetic diversity and population structure assessed by SSR and SNP markers in a large germplasm collection of grape. BMC Plant Biol. 2013, 13, 39. [Google Scholar] [CrossRef]
- Gómez-Rodríguez, M.V.; Beuzon, C.; González-Plaza, J.J.; Fernández-Ocaña, A.M. Identification of an olive (Olea europaea L.) core collection with a new set of SSR markers. Genet. Resour. Crop Evol. 2021, 68, 117–133. [Google Scholar] [CrossRef]
- Wang, R.; Zhong, Y.; Hong, W.; Luo, H.; Li, D.; Zhao, L.; Zhang, H.; Wang, J. Genetic diversity evaluation and core collection construction of pomegranate (Punica granatum L.) using genomic SSR markers. Sci. Hortic. 2023, 319, 112192. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information (NCBI). Normal RNA-seq of Ribes nigrum L. 2023. Available online: https://www.ncbi.nlm.nih.gov/bioproject/1021373 (accessed on 3 May 2023).
- Edwards, K.; Barker, J.; Daly, A.; Jones, C.; Karp, A. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 1996, 20, 758–760. [Google Scholar] [CrossRef] [PubMed]
- Russell, J.R.; Bayer, M.; Booth, C.; Cardle, L.; Hackett, C.A.; Hedley, P.E.; Jorgensen, L.; Morris, J.A.; Brennan, R.M. Identification, utilisation and mapping of novel transcriptome-based markers from blackcurrant (Ribes nigrum). BMC Plant Biol. 2011, 11, 147. [Google Scholar] [CrossRef]
- Pikunova, A.; Knyazev, S.; Bakhotskaya, A.Y.; Kochumova, A. Microsatellite loci polymorphism in russian black currant (Ribes nigrum L.) varieties from collection of All-Russian Research Institute of Breeding Fruit Crops. Sel’skokhozyaistvennaya Biol. 2015, 50, 46–54. [Google Scholar] [CrossRef]
- Pavlenko, A.; Dolzhikova, M.; Pikunova, A.; Bakhotskaya, A. Use of SSR markers to study genetic polymorphism in members of the Ribes L. genus from the VNIISPK collection. E3S Web Conf. 2021, 254, 02009. [Google Scholar] [CrossRef]
- Bushakra, J.; Alvarez, A.; King, R.; Green, J.; Nyberg, A.; Bassil, N. Developing a simple sequence repeat (SSR) fingerprinting set to characterize the NCGR Ribes collection. In Proceedings of the XIII International Rubus and Ribes Symposium 1388, Portland, OR, USA, 9 June 2023; pp. 107–114. [Google Scholar]
- Lācis, G.; Kārkliņa, K.; Kota-Dombrovska, I.; Strautiņa, S. Evaluation of blackcurrant (Ribes nigrum) germplasm structure by microsatellite-based fingerprinting for the diversification of the breeding material. J. Berry Res. 2021, 11, 497–510. [Google Scholar] [CrossRef]
- Reed, D.H.; Frankham, R. How Closely Correlated Are Molecular and Quantitative Measures of Genetic Variation? A Meta-Analysis. Evolution 2001, 55, 1095–1103. [Google Scholar] [CrossRef] [PubMed]
- Ellegren, H.; Galtier, N. Determinants of genetic diversity. Nat. Rev. Genet. 2016, 17, 422–433. [Google Scholar] [CrossRef] [PubMed]
- Pluta, S.; Mądry, W.; Sieczko, L. Phenotypic diversity for agronomic traits in a collection of blackcurrant (Ribes nigrum L.) cultivars evaluated in Poland. Sci. Hortic. 2012, 145, 136–144. [Google Scholar] [CrossRef]
- Gu, R.; Fan, S.; Wei, S.; Li, J.; Zheng, S.; Liu, G. Developments on Core Collections of Plant Genetic Resources: Do We Know Enough? Forests 2023, 14, 926. [Google Scholar] [CrossRef]
- Brown, A.H.D. Core collections: A practical approach to genetic resources management. Genome 1989, 31, 818–824. [Google Scholar] [CrossRef]
- Frankel, O.H. Genetic perspectives of germplasm conservation. Genet. Manip. Impact Man Soc. 1984, 161, 170. [Google Scholar]
- Guo, Q.; Liu, J.; Li, J.; Cao, S.; Zhang, Z.; Zhang, J.; Zhang, Y.; Deng, Y.; Niu, D.; Su, L.; et al. Genetic diversity and core collection extraction of Robinia pseudoacacia L. germplasm resources based on phenotype, physiology, and genotyping markers. Ind. Crops Prod. 2022, 178, 114627. [Google Scholar] [CrossRef]
- Parra-Quijano, M.; Iriondo, J.M.; de la Cruz, M.; Torres, E. Strategies for the Development of Core Collections Based on Ecogeographical Data. Crop Sci. 2011, 51, 656–666. [Google Scholar] [CrossRef][Green Version]
- Karhu, S.; Antonius, K.; Kaldmäe, H.; Pluta, S.; Rumpunen, K.; Ryliškis, D.; Sasnauskas, A.; Schulte, E.; Strautina, S.; Grout, B. The core collection of the Northern European gene pool of Ribes created by RIBESCO project. Sodininkystė Daržininkystė 2007, 26, 179–186. [Google Scholar]
- Xukuerhan, G.; Ya-li, S.U.N.; Tiemuer, A.; Yeerjiang, H.; Ayoufu, B. Effects of low temperature stress on the content of penetration substance, membrane peroxidation and protective enzyme activity in Ribes rubrum. Xinjiang Agric. Sci. 2019, 56, 685. [Google Scholar]
- Kendir, G.; Süntar, I.; Çeribaşı, A.O.; Köroğlu, A. Activity evaluation on Ribes species, traditionally used to speed up healing of wounds: With special focus on Ribes nigrum. J. Ethnopharmacol. 2019, 237, 141–148. [Google Scholar] [CrossRef]
- Hummer, K.E.; Dale, A. Horticulture of Ribes. For. Pathol. 2010, 40, 251–263. [Google Scholar] [CrossRef]
- Da Silva Pinto, M.; Kwon, Y.-I.; Apostolidis, E.; Lajolo, F.M.; Genovese, M.I.; Shetty, K. Evaluation of Red Currants (Ribes rubrum L.), Black Currants (Ribes nigrum L.), Red and Green Gooseberries (Ribes uva-crispa) for Potential Managentment of Type 2 Diabetes and Hypertension Using in Vitro Models. J. Food Biochem. 2010, 34, 639–660. [Google Scholar] [CrossRef]
- Sun, X.; Zhan, Y.; Li, S.; Liu, Y.; Fu, Q.; Quan, X.; Xiong, J.; Gang, H.; Zhang, L.; Qi, H. Complete chloroplast genome assembly and phylogenetic analysis of blackcurrant (Ribes nigrum), red and white currant (Ribes rubrum), and gooseberry (Ribes uva-crispa) provide new insights into the phylogeny of Grossulariaceae. PeerJ 2023, 11, e16272. [Google Scholar] [CrossRef] [PubMed]
- Lācis, G.; Kārkliņa, K.; Bartulsons, T.; Stalažs, A.; Jundzis, M.; Baļķe, I.; Ruņģis, D.; Strautiņa, S. Genetic structure of a Ribes genetic resource collection: Inter-and intra-specific diversity revealed by chloroplast DNA simple sequence repeats (cpSSRs). Sci. Hortic. 2022, 304, 111285. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
- Lalitha, S. Primer Premier 5. Biotech Softw. Internet Rep. Comput. Softw. J. Sci. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Creste, S.; Neto, A.T.; Figueira, A. Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Mol. Biol. Report. 2001, 19, 299–306. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
- Porras-Hurtado, L.; Ruiz, Y.; Santos, C.; Phillips, C.; Carracedo, Á.; Lareu, M.V. An overview of STRUCTURE: Applications, parameter settings, and supporting software. Front. Genet. 2013, 4, 98. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.-W.; Chung, H.-K.; Cho, G.-T.; Ma, K.-H.; Chandrabalan, D.; Gwag, J.-G.; Kim, T.-S.; Cho, E.-G.; Park, Y.-J. PowerCore: A program applying the advanced M strategy with a heuristic search for establishing core sets. Bioinformatics 2007, 23, 2155–2162. [Google Scholar] [CrossRef]
- Ji, X.; Tang, J.; Zhang, J. Effects of salt stress on the morphology, growth and physiological parameters of Juglans microcarpa L. seedlings. Plants 2022, 11, 2381. [Google Scholar] [CrossRef]




| Primer | Report | Primer 5′-3′ | Tm/°C | Na | Ne | I | Ho | He | PIC |
|---|---|---|---|---|---|---|---|---|---|
| S-3 | (CCG)8 | GCGAAGAAGAAGTTGATCCG GGAGGGTTCTTCGATTCACA | 56.00 | 3 | 1.30 | 0.46 | 0.21 | 0.23 | 0.21 |
| S-18 | (TC)8 | AAGAAGCCTTTCTTGCCTCC ATGAACCATCATGGGGAAAA | 59.00 | 5 | 3.12 | 1.32 | 0.71 | 0.68 | 0.67 |
| S-24 | (TC)8 | TGATGAAAATGGAGGGAAGC GGATCGAGTCCAAAATCGAA | 58.00 | 3 | 1.13 | 0.27 | 0.10 | 0.11 | 0.20 |
| S-43 | (CT)9 | TGATTGCGATAAATCCGACA TGTGAGGCTCGTGTTTCAAG | 57.00 | 3 | 2.82 | 1.10 | 0.59 | 0.65 | 0.57 |
| S-73 | (ACA)6 | AGCTGCCAGTTAGCCATGTT CCGGAAACTGAGTCATGGAT | 58.00 | 3 | 1.58 | 0.59 | 0.46 | 0.37 | 0.31 |
| S-77 | (GCA)7 | CAGAGCCATTGAAGCTCTCC ACACCAGACCTCTCACGACC | 57.00 | 4 | 2.13 | 0.92 | 0.44 | 0.53 | 0.45 |
| S-78 | (GAA)6 | AAACATGAACCTCCCATTCG CTGCCATGCTTGATACTGGA | 57.00 | 3 | 1.99 | 0.81 | 0.26 | 0.50 | 0.60 |
| S-84 | (TCA)6 | CTTTTCCAAGGGTCCAGTGA TCCTGAATCCCTATTCGTGC | 57.00 | 3 | 1.61 | 0.70 | 0.31 | 0.38 | 0.35 |
| S-92 | (CAA)6 | TGTAGGCATTTGTGGCAAGA TGTTTCAAATGCCAAGCAAA | 57.00 | 3 | 1.96 | 0.85 | 0.55 | 0.49 | 0.49 |
| S-94 | (GAC)6 | TTTGAGAGATGGGGGAACAC GAACAGGCTTTACAACCCCA | 57.00 | 2 | 1.38 | 0.45 | 0.12 | 0.28 | 0.25 |
| S-97 | (ACC)6 | GAATCGAAACTTTCCACCGA GCTCATTGCAACTACTGCCA | 57.00 | 2 | 1.53 | 0.53 | 0.39 | 0.35 | 0.40 |
| S-116 | (TCA)7 | ACCACATTCCCAAATTCCAA CTGTCAAATCGAGTGGCTCA | 57.00 | 4 | 2.10 | 0.95 | 0.43 | 0.52 | 0.47 |
| S-120 | (GCA)6 | AGGTGAACACGGTTCTTTGG TCCTCCCTATTTCTGGGCTT | 57.00 | 4 | 1.26 | 0.40 | 0.13 | 0.21 | 0.19 |
| S-132 | (TCC)6 | TCCTAAGCTCTGGTGGTGCT TGTGGGTCATAATGGTGGTG | 57.00 | 3 | 1.59 | 0.72 | 0.29 | 0.37 | 0.34 |
| S-135 | (CTG)6 | GGGAGAATCCTGAATCGACA CAACACTACCAAATGCCACG | 56.00 | 3 | 1.26 | 0.43 | 0.17 | 0.21 | 0.19 |
| S-155 | (AG)8 | CCCTCTTTGCTGTCATGGAT CAAAGGCAAACAAAAAGCGT | 57.00 | 2 | 1.48 | 0.51 | 0.39 | 0.33 | 0.41 |
| S-160 | (AT)9 | AAATTTGCCTATTCACCCCC AGACCGAGATTTGGTTCGTG | 57.00 | 2 | 2.18 | 0.84 | 0.21 | 0.54 | 0.58 |
| S-163 | (CA)7 | GCTGCAGTTTTACCAGAGCC AGGTGTGGGCATGTAGGAAG | 57.00 | 4 | 1.54 | 0.72 | 0.25 | 0.35 | 0.36 |
| S-165 | (CA)8 | AAGCTCACGATGGTGGTGAT ACGTCAAGCTGAGCAAGGTT | 57.00 | 3 | 1.54 | 0.71 | 0.15 | 0.35 | 0.33 |
| S-172 | (CT)6 | TCCTTGACTGGGAAATTCAAA TCAGCCAATCAATTCAATACCA | 57.00 | 2 | 1.13 | 0.23 | 0.09 | 0.12 | 0.14 |
| S-174 | (CT)7 | CCGACTTAAAACCCACTTCC CAAGCTATGCCAAGTGCGTA | 57.00 | 2 | 2.00 | 0.69 | 0.19 | 0.50 | 0.57 |
| S-179 | (GA)10 | GCAAAGCAACACATCAGCAT AGTTGAGGTATGGGGTGGTG | 57.00 | 3 | 2.65 | 1.06 | 0.52 | 0.62 | 0.55 |
| S-184 | (AAG)6 | ATGATGATGACGACGACGAA CGACAACAGCTCCAGAATCA | 57.00 | 3 | 1.56 | 0.66 | 0.42 | 0.36 | 0.33 |
| S-187 | (ACA)5 | GCCTCCCTTAAAACACTCCC CTAGCCTTTGCCCCTTCTCT | 57.00 | 3 | 2.87 | 1.09 | 0.53 | 0.65 | 0.60 |
| S-188 | (ACA)5 | ATGGAAACATGTGACCACCA AAACAGGGTCGATGGTTCTG | 57.00 | 2 | 1.37 | 0.44 | 0.30 | 0.27 | 0.25 |
| S-189 | (ACC)5 | TGCTGATGGCATGTAAGGAG CCGCACGAGGATAATTTTGT | 57.00 | 2 | 1.28 | 0.46 | 0.07 | 0.22 | 0.21 |
| S-210 | (CAA)5 | AGGGTTTGAAGGGTTGCTCT TGCAGTGAAAGCAACTGTGA | 57.00 | 2 | 1.50 | 0.51 | 0.29 | 0.33 | 0.30 |
| S-224 | (AC)8 | AAGCATCCATTGAAGAACCG CTCAGCACACACAGAGGGAA | 57.00 | 2 | 1.15 | 0.25 | 0.10 | 0.13 | 0.22 |
| S-239 | (CGA)7 | TCTGAAAGCACTGACCCTCC TGAAGCCATCATTCACAACC | 57.00 | 4 | 2.65 | 1.13 | 0.53 | 0.62 | 0.56 |
| S-286 | (AG)7 | CTTTCGTCTATGCAGCTCCC GGGTTGACCCACATCCCTAT | 57.00 | 3 | 2.57 | 1.02 | 0.47 | 0.61 | 0.61 |
| S-288 | (TGT)5 | GTTGCTCGCTTTTCGAAGTC AGCCAAGATGAAGAAAGGCA | 57.00 | 4 | 2.50 | 1.13 | 0.43 | 0.60 | 0.57 |
| Mean | 1.83 | 0.71 | 0.33 | 0.40 | 0.40 |
| Source | Degrees of Freedom | Sum of Square | Mean of Square | Est. Var. | % |
|---|---|---|---|---|---|
| Among clusters | 2 | 50.728 | 25.364 | 0.293 | 5% |
| Between blackcurrant cultivars within clusters | 92 | 629.193 | 6.839 | 0.877 | 14% |
| Between cultivars within blackcurrant cultivars | 95 | 483.000 | 5.084 | 5.084 | 81% |
| Total | 189 | 1162.921 | 6.254 | 100% |
| Collection Type | N | Na | A% | Ne | I | Ho | He | PIC |
|---|---|---|---|---|---|---|---|---|
| Initial collection | 95 | 2.935 | 1.749 | 0.652 | 0.335 | 0.374 | 0.354 | |
| PC | 21 | 2.839 | 96.7% | 1.756 | 0.664 | 0.335 | 0.381 | 0.361 |
| CH | 19 | 2.839 | 69.7% | 1.770 | 0.656 | 0.336 | 0.378 | 0.361 |
| IC | 27 | 2.903 | 98.9% | 1.771 | 0.665 | 0.336 | 0.381 | 0.370 |
| NO. | Accessions Name | Species | Origin |
|---|---|---|---|
| 1 | Ben Nevis | Ribes nigrum | Britain |
| 2 | Baldwin | Ribes nigrum | Britain |
| 3 | Mendip Cross | Ribes nigrum | Britain |
| 4 | Big Ben | Ribes nigrum | Britain |
| 5 | Ben Gairn | Ribes nigrum | Britain |
| 6 | Ben Tirran | Ribes nigrum | Britain |
| 7 | Ben Lomond | Ribes nigrum | Britain |
| 8 | Ojebyn | Ribes nigrum | Sweden |
| 9 | Liangyehoupi | Ribes nigrum | Russia |
| 10 | Zusha | Ribes nigrum | Russia |
| 11 | Exotic | Ribes nigrum | Russia |
| 12 | Xielieqinaya | Ribes nigrum | Russia |
| 13 | Vologda | Ribes nigrum | Russia |
| 14 | Globus | Ribes nigrum | Russia |
| 15 | Gejinzige | Ribes nigrum | Russia |
| 16 | Adelinia | Ribes nigrum | Russia |
| 17 | Sophia | Ribes nigrum | Russia |
| 18 | Lama | Ribes nigrum | Russia |
| 19 | Belaruskaja | Ribes nigrum | Russia |
| 20 | Bagira | Ribes nigrum | Russia |
| 21 | Zwiezda | Ribes nigrum | Russia |
| 22 | Gezishiseng | Ribes nigrum | Russia |
| 23 | Kantata | Ribes nigrum | Russia |
| 24 | Nailor | Ribes nigrum | Russia |
| 25 | Primorskij pearl | Ribes nigrum | Russia |
| 26 | E-14 | Ribes nigrum | Russia |
| 27 | E-15 | Ribes nigrum | Russia |
| 28 | Baopifengchan | Ribes nigrum | Russia |
| 29 | Fertodi | Ribes nigrum | Poland |
| 30 | Orville | Ribes nigrum | Poland |
| 31 | Bagada | Ribes nigrum | Poland |
| 32 | Bona | Ribes nigrum | Poland |
| 33 | Roodknop | Ribes nigrum | Netherland |
| 34 | Risager | Ribes nigrum | Denmark |
| 35 | Black smith | Ribes nigrum | Canada |
| 36 | C17 | Ribes nigrum | China |
| 37 | C19 | Ribes nigrum | China |
| 38 | C28 | Ribes nigrum | China |
| 39 | C11 | Ribes nigrum | China |
| 40 | 94-4-13 | Ribes nigrum | China |
| 41 | 17-29 | Ribes nigrum | China |
| 42 | W1-2 | Ribes nigrum | China |
| 43 | E16 | Ribes nigrum | China |
| 44 | 16A | Ribes nigrum | China |
| 45 | 14(17-5) | Ribes nigrum | China |
| 46 | A16 | Ribes nigrum | China |
| 47 | Hanfeng | Ribes nigrum | China |
| 48 | 19C | Ribes nigrum | China |
| 49 | 18C | Ribes nigrum | China |
| 50 | 17B | Ribes nigrum | China |
| 51 | 13C | Ribes nigrum | China |
| 52 | 14C | Ribes nigrum | China |
| 53 | 15C | Ribes nigrum | China |
| 54 | 16C | Ribes nigrum | China |
| 55 | 17C | Ribes nigrum | China |
| 56 | Aw-2 | Ribes nigrum | China |
| 57 | 15-3 | Ribes nigrum | China |
| 58 | 17-29-1 | Ribes nigrum | China |
| 59 | 15-4 | Ribes nigrum | China |
| 60 | BW-2 | Ribes nigrum | China |
| 61 | 15-2 | Ribes nigrum | China |
| 62 | 15-1 | Ribes nigrum | China |
| 63 | Aw-4 | Ribes nigrum | China |
| 64 | Aw-3 | Ribes nigrum | China |
| 65 | Yade-3 | Ribes nigrum | China |
| 66 | 17-29-3 | Ribes nigrum | China |
| 67 | 15-8 | Ribes nigrum | China |
| 68 | Aw-1 | Ribes nigrum | China |
| 69 | 15-10 | Ribes nigrum | China |
| 70 | 17-29-2 | Ribes nigrum | China |
| 71 | 17-29-5 | Ribes nigrum | China |
| 72 | 15-6 | Ribes nigrum | China |
| 73 | BW-3 | Ribes nigrum | China |
| 74 | Yade-1 | Ribes nigrum | China |
| 75 | Yade-2 | Ribes nigrum | China |
| 76 | 15-5 | Ribes nigrum | China |
| 77 | Bw-1 | Ribes nigrum | China |
| 78 | Lw-1 | Ribes nigrum | China |
| 79 | 15-9 | Ribes nigrum | China |
| 80 | 17-29-4 | Ribes nigrum | China |
| 81 | Yade-4 | Ribes nigrum | China |
| 82 | 0A14 | Ribes nigrum | China |
| 83 | Bw-4 | Ribes nigrum | China |
| 84 | 15-7 | Ribes nigrum | China |
| 85 | SU-3 | Ribes nigrum | China |
| 86 | Suiyanyihao | Ribes nigrum | China |
| 87 | Suiyanerhao | Ribes nigrum | China |
| 88 | Danjianghei | Ribes nigrum | China |
| 89 | Suanpanzi | Ribes nigrum | China |
| 90 | Muxuan 2008-6 | Ribes nigrum | China |
| 91 | Muxuan 2012-6 | Ribes nigrum | China |
| 92 | Muxuan 2015-10 | Ribes nigrum | China |
| 93 | Muxuan 2011-14 | Ribes nigrum | China |
| 94 | Muxuan 2013-10 | Ribes nigrum | China |
| 95 | Muxuan 2015-13 | Ribes nigrum | China |
| 96 | Crusader | Ribes rubrum | Russia |
| 97 | ER-1 | Ribes rubrum | Russia |
| 98 | Maer | Ribes rubrum | Russia |
| 99 | Red Spring | Ribes rubrum | Russia |
| 100 | E-RED | Ribes rubrum | Russia |
| 101 | Cherry | Ribes rubrum | Poland |
| 102 | Witte Parel | Ribes rubrum | French |
| 103 | Ussuri | Ribes ussuriensis | Russia |
| 104 | Pixwell | Ribes uva-crispa | Russia |
| 105 | Hongyeheidou | Ribes americanum | America |
| 106 | Xiangchabiaozi | Ribes odoratum | China |
| 107 | Xinganchabiao | Ribes panciflorum | China |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, X.; Fu, Q.; Qin, D.; Xiong, J.; Quan, X.; Guo, H.; Tang, J.; Huo, J.; Zhu, C. Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. Int. J. Mol. Sci. 2025, 26, 2346. https://doi.org/10.3390/ijms26052346
Sun X, Fu Q, Qin D, Xiong J, Quan X, Guo H, Tang J, Huo J, Zhu C. Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. International Journal of Molecular Sciences. 2025; 26(5):2346. https://doi.org/10.3390/ijms26052346
Chicago/Turabian StyleSun, Xinyu, Qiang Fu, Dong Qin, Jinyu Xiong, Xin Quan, Hao Guo, Jiahan Tang, Junwei Huo, and Chenqiao Zhu. 2025. "Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers" International Journal of Molecular Sciences 26, no. 5: 2346. https://doi.org/10.3390/ijms26052346
APA StyleSun, X., Fu, Q., Qin, D., Xiong, J., Quan, X., Guo, H., Tang, J., Huo, J., & Zhu, C. (2025). Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. International Journal of Molecular Sciences, 26(5), 2346. https://doi.org/10.3390/ijms26052346

