Next Article in Journal
Sodium Iodate-Induced Ferroptosis in Photoreceptor-Derived 661W Cells Through the Depletion of GSH
Previous Article in Journal
Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 5
10.3390/ijms26052333
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Aldehyde Dehydrogenase Gene Family in Glycyrrhiza uralensis and Analysis of Expression Pattern Under Drought Stress

by
Mengyuan He
1,
Xu Ouyang
1,
Linyuan Cheng
1,
Yuetao Li
1,
Nana Shi
1,
Hongxia Ma
1,
Yu Sun
1,
Hua Yao
1,2,* and
Haitao Shen
1,2,*
1
Key Laboratory of Xinjiang Phytomedicine Resource and Utilization of Ministry of Education, College of Life Sciences, Shihezi University, Shihezi 832003, China
2
Key Laboratory of Oasis Town and Mountain-Basin System Ecology of Xinjiang Production and Construction Corps, Shihezi University, Shihezi 832003, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(5), 2333; https://doi.org/10.3390/ijms26052333
Submission received: 13 January 2025 / Revised: 18 February 2025 / Accepted: 28 February 2025 / Published: 5 March 2025
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

Aldehyde dehydrogenases (ALDHs) are a gene family that relies on NAD +/NADP + proteins to oxidize toxic aldehydes to non-toxic carboxylic acids, and they play a crucial role in the growth and development of plants, as well as in their ability to withstand stress. This study identified 26 ALDH genes from six Glycyrrhiza uralensis gene families distributed on six chromosomes. By analyzing the phylogeny, gene structure, conserved motifs, cis-regulatory elements, collinearity of homologs, evolutionary patterns, differentiation patterns, and expression variations under drought stress, we found that the ALDH gene is involved in phytohormones and exhibits responsiveness to various environmental stressors by modulating multiple cis-regulatory elements. In addition, GuALDH3H1, GuALDH6B1, GuALDH12A2, and GuALDH12A1 have been identified as playing a crucial role in the response to drought stress. By analyzing the expression patterns of different tissues under drought stress, we discovered that GuALDH3I2 and GuALDH2B2 exhibited the most pronounced impact in relation to the drought stress response, which indicates that they play a positive role in the response to abiotic stress. These findings provide a comprehensive theoretical basis for the ALDH gene family in Glycyrrhiza uralensis and enhance our understanding of the molecular mechanisms underlying ALDH genes in licorice growth, development, and adaptation to drought stress.

1. Introduction

Glycyrrhiza uralensis is commonly found in arid and semi-arid areas in Northwest China. It is a bulk herb used for both medicine and feeding, and it is also a pioneer plant for windbreak and sand fixation. The molecular mechanism of plant response to abiotic stress involves multiple aspects, including sensing, signal transduction, transcription, translation, and modification [1]. Plants can maintain normal growth by regulating their development and structure, synthesizing secondary metabolites to cope with stress, and scavenging free radicals. In this process, the main strategies plants use to cope with stress are removing excessive aldehyde molecules and reducing the production of reactive oxygen species with the aim of protecting the normal functions of cell membranes and proteins [2,3,4].
Aldehydes, as an indispensable intermediate product in the catabolism and biosynthesis pathways of organisms, increase significantly in response to abiotic stress. However, once the accumulation of aldehydes is beyond limits, it can cause a potentially toxic effect on the normal growth of plants [5]. In contrast, the Aldehyde dehydrogenase (ALDH) superfamily possesses the capability to catalyze the conversion of aldehyde compounds into their respective carboxylic acids. Under certain conditions, as an “aldehyde scavenger”, the ALDH enzyme acts as a metabolized active aldehyde of lipid peroxidation-derived aldehydes, which may exhibit toxicity as a result of their high reactivity with nucleophilic substances (e.g., nucleic acids, proteins, and membrane lipids) [6,7].
It has been demonstrated that the ALDH gene family is widely present in eukaryotes and prokaryotes, and 24 distinct gene families have been identified for quite some time [8], of which eukaryotes contain 20 ALDH gene families [9]. Fourteen ALDH families have been mentioned in various species of plants, but the ALDH23 and ALDH24 gene families have only been found in Chlamydomonas reinhardtii, Physcomitrella patens, and Selaginella moellendorffii [10]. Additionally, ALDH proteins are located in the cytoplasm, mitochondria, plastids (chloroplasts, chromatin, and leuplasta), peroxisomes, and microsomes in plants [11].
ALDHs play significant roles in plant growth and development, as well as in the response to phytohormones and environmental stressors. Studies in the model organism Arabidopsis thaliana indicated that 14 ALDH proteins from nine distinct families have been authenticated [12]. The AtALDH3H1 and AtALDH7B4 genes are activated in response to drought, salt stress, and the plant hormone abscisic acid (ABA), contributing to the salt tolerance and drought tolerance observed in Arabidopsis thaliana [6,13]. The 53 ALDH genes classified into 10 families have been documented in soybeans. Notably, the ALDH2 and ALDH3 gene families are crucial for responding to drought stress [14]. Our findings indicate that under drought conditions, the expression of the ALDH7B1 gene is significantly up-regulated in both the roots and leaves of soybean plants; we also observed a marked increase in the expression levels of several other genes, specifically ALDH2B1, ALDH2B2, ALDH3H2, ALDH12A2, and ALDH18B3, in leaf tissues. In peanuts, aggregately, 71 members of the ALDH family were identified across 10 distinct families exhibiting similar structural models and gene architectures. Under drought stress conditions, specific AhALDhs members located in roots—including AhALD10A1, AhALD22A1, AhALD12A1, and AhALD6B2—are actively involved in mediating plant responses to adverse environmental conditions [15].
The 20 ALDH genes found in rice can be categorized into ten gene families based on their protein sequences. Previous studies have demonstrated that the remodeling of rice genome expression under drought, salt, and ABA stresses significantly reflects organ-specific characteristics when exposed to drought and high salinity conditions [16]. The expression levels of five specific genes, OsALDH2-4, OsALDH3-4, OsALDH7, OsALDH18-2, and OsALDH12, were found to be significantly up-regulated by more than two-fold in seedlings subjected to drought stress, thereby confirming the organ specificity of gene expression [17]. In another tissue, the ALDH2B gene exhibited pronounced expression characteristics. However, when OsALDH2B is mutated, this phenomenon leads to the occurrence of premature degradation of pollen mother cells accompanied with their abnormal development [18].
As an important component in regulating the transcriptional expression of biological genes, it activates or inhibits gene expression by interacting with cis-acting elements in the gene promoter region. It participates in the regulation of life activities within biological cells. In previous studies, we found that transcription factors play a significant role in mitigating the adverse effects of drought stress on plants. Among them, MYB, as the most widespread family in plants, can resist the impacts of drought and cold stresses to some extent [19]. The transcription factor bZIP enhances stability and activity after post-translational modifications, allowing it to respond to stimuli inside and outside plant cells [20]. Recent research has shown that in grapes, NAC transcription factors enhance the response of transgenic Arabidopsis to drought and salt stress by regulating the synthesis of jasmonic acid [21]. ALDH proteins have been extensively studied across various plant species and play significant roles in Arabidopsis thaliana (thale cress) [22], Vitis vinifera (grapevine) [23], Sorghum bicolor (sorghum) [24], Oryza sativa (rice) [25], maize [26], Glycine max (soybean) [14], cotton [27], apple [28], and potato [29]. These studies indicate that the ALDH gene plays a crucial role in plants’ tolerance to abiotic stress. The genome-wide study of the ALDH gene family in response to environmental stresses provides a theoretical basis for the precise regulation of Glycyrrhiza uralensis’s tolerance against various environmental stresses. Research on how the ALDH gene family in Glycyrrhiza uralensis responds to environmental stress is still in its early stages. This study utilized wild-type Glycyrrhiza uralensis to examine the protein structure and function of the ALDH gene family and to analyze aspects such as phylogenetic relationships, gene structure characteristics, homology, and cis-regulatory elements. The expression patterns of these genes in various tissues under drought stress were also investigated. Key stress response genes were identified, and their co-expression regulatory networks were analyzed. This research aims to provide a theoretical foundation for the further exploration of the molecular mechanisms by which ALDH contributes to drought stress in Glycyrrhiza uralensis.

2. Results

2.1. The Identification and Analysis of the ALDH Gene in the Whole Genome of Glycyrrhiza uralensis

In the PFAM database, a conserved domain of the ALDH protein (PF00171) was utilized in the Hidden Markov Model (HMM) to screen for ALDH proteins in the complete genome of Glycyrrhiza uralensis. This study identified 26 ALDH proteins in Glycyrrhiza uralensis, which were classified into six families based on the phylogenetic relationships of their protein sequences with those of Arabidopsis ALDH. The fundamental features of these proteins, such as the length of the coding sequence, the length of the amino acids, molecular weight, isoelectric point, and subcellular localization, were examined (Table 1). The amino acid lengths of GuALDH varied between 138 and 727 residues, while the molecular weights were observed to range from 15.39 to 79.45 kDa. The theoretical isoelectric points of GuALDH proteins spanned from 5.13 to 10.06. The majority of GuALDH proteins were found to be localized in the cytoplasm (Table 1). Two of the six ALDH families contained more than five genes (ALDH2, eight genes; ALDH3, nine genes), while the other four families contained no more than five genes (ALDH6, two genes; ALDH10, two genes; ALDH11, three genes; ALDH12, two genes).
The ALDH protein superfamily possesses a conserved domain (PF00171), which is characterized by a structural domain that contains distinct sites for catalysis, cofactor binding, and polymerization. These sites have the capacity to function independently or in concert with one another. Then, multiple sequence alignment was performed using Jalview software (Vers. 2.11.2.4) to confirm the glutamate active site in the GuALDH protein (PS00687). In Glycyrrhiza uralensis, 26 GuALDH proteins contain glutamate active sites (Figure 1). Other proteins lack these active sites, probably because they are incomplete sequences. However, searching for functional domains in the NCBI indicated that these genes are still part of the ALDH superfamily.

2.2. Phylogenetic Analysis of ALDHs

To uncover the genetic evolutionary relationship of ALDH proteins between Glycyrrhiza uralensis and Arabidopsis thaliana, the maximum likelihood method was employed to conduct an analysis of the ALDH proteins in both species, with 1000 bootstrap replicates being conducted (Figure 2). The names of the ALDH proteins in Glycyrrhiza uralensis were according to Arabidopsis, the phylogenetic tree, and the anterior–posterior relationship of their gene IDs (Figure 2).
The phylogenetic tree revealed that ALDH2 (11 members) and ALDH3 (12 members) are the largest clusters, while ALDH10 (3 members), ALDH12 (3 members), and ALDH6 (3 members) are the smallest families. In addition, Glycyrrhiza uralensis contains the highest number of members in the third family. We identified two sets of directly related orthologous genes in the ALDH family of Glycyrrhiza uralensis and the ALDH family of Arabidopsis: GuALDH11A3/AtALDH11A3 and GuALDH12A2/AtALDH12A1. These findings suggest that ALDH family 3 in Glycyrrhiza uralensis may have existed for a considerable duration, and it performs an essential function in the plant’s growth, development, and ability to withstand environmental stresses.

2.3. Analysis of Gene Structure and Conserved Protein Moift of GuALDH Subfamily Members in Glycyrrhiza uralensis

The phylogenetic tree illustrating the expansion of GuALDH subfamily members in Glycyrrhiza uralensis was created using MEGA. In this phylogenetic tree, most of the subfamily members were grouped closely together, except for the 10 th and 12 th families (Figure 3A). The results show that similar structures have similar functions, which further validates the previous analysis (Figur 2). Genomic DNA sequences were utilized to analyze the gene structure of the GuALDH family (Figure 3B). In GuALDHs, they contain 4 to 18 exons. The genomic DNA sequences exhibited a length varying from 3500 bp (GuALDH3F3) to 11,800 bp (GuALDH3H2). Subsequently, the MEME software (Vers. 5.5.1) was employed to investigate the conserved motifs present within the GuALDH protein structure. A total of 10 conserved motifs were identified within the GuALDH protein. Motif 3 represents a conserved glutamate active site (PS00687) (Figure 3C). The conserved distribution order and the number of motifs indicate that the function of the GuALDH subfamily is conserved.

2.4. Genome Localisation, Homology, and Evolutionary Analysis of GuALDHs

To investigate the distribution of GuALDHs on the chromosomes of Glycyrrhiza uralensis, 26 ALDH genes were mapped to six chromosomes. In the genome of Glycyrrhiza uralensis, 2 of the 26 ALDH genes are located on chromosome 2; 6 on chromosome 3; 5 on chromosome 4; 7 on chromosome 6; 3 on chromosome 7; and 3 on chromosome 8 (Figure 4). The above results suggest that ALDH genes on other chromosomes may have expanded based on chromosome 6. Additionally, there are tandemly duplicated gene pairs on some chromosomes, which may lead to the emergence of new biological functions: GuALDH2B1 and GuALDH10A1; GuALDH2C1 and GuALDH2C2. The three tandemly duplicated genes, GuALDH12A2, GuALDH10A2, and GuALDH2B2, are situated on chromosome 6, indicating that this region may have developed new capabilities (Figure 4).
As the most important model plants, the genomic functions of rice, Arabidopsis, alfalfa, and soybean have been well described. Additionally, soybean, alfalfa, and Glycyrrhiza uralensis are affiliated with the legume family. To explore the gene duplication events of ALDHs in rice, Arabidopsis, soybean, alfalfa, and Glycyrrhiza uralensis, we utilized the MCscanX (Vers. 1.0.0) and TBtools software (Vers. 2.056) to establish the homology relationships among these species. The results of the one-to-one comparisons revealed 5 potential homologous gene pairs (Gu-Os) between Glycyrrhiza uralensis and rice, 15 potential homologous gene pairs (Gu-Ath) between Glycyrrhiza uralensis and Arabidopsis, 55 potential homologous gene pairs (Gu-Gm) between Glycyrrhiza uralensis and soybean, 20 potential homologous gene pairs in Gu-Ms, and 10 potential paralogous gene pairs (Gu-Gu) between Glycyrrhiza uralensis and alfalfa. These findings suggest that these genes have a shared ancestral origin (Figure 5 and Figure 6). Notably, soybean and licorice exhibit the closest genetic relationship, indicating that ALDH gene pairs are the most abundant between soybean and Glycyrrhiza uralensis.

2.5. Identifying Cis-Regulatory Elements in the GuALDHs Promoter

In order to investigate the possible biological roles and regulatory mechanisms of GuALDH genes, the promoter regions located 2000 bp upstream of 26 GuALDH genes were examined to find cis-acting regulatory elements utilizing the PlantCare database. Numerous cis-acting elements were identified, including those associated with the metabolism of phytohormones and biotic stress response, such as drought-responsive elements, salt-responsive elements, abscisic acid-responsive elements, jasmonic acid-responsive elements, salicylic acid-responsive elements, auxin-responsive elements, and other response elements (Figure 7).
The total count of significant cis-elements was recorded, and it was found that there were 61 ABREs (ABA-responsive elements) in the GuALDH gene promoter, 30 CGTCA-motifs (jasmonic acid-responsive elements), 9 P-box elements (GA-responsive elements) in the GuALDH gene promoter, 11 TGA elements (auxin response elements), and 16 SA-responsive elements within the GuALDH gene promoter (Figure 7). Furthermore, most GuALDH promoters contained binding sites for MYB transcription factors. The aforementioned findings suggest that the ALDH gene may have been involved in the regulation of phytohormones and the responses to diverse environmental stresses by modulating various cis-regulatory elements.

2.6. Expression Patterns of GuALDH in Different Tissues of Glycyrrhiza uralensis

The mode of expression of GuALDH was analyzed using transcriptome data from various tissue samples of Glycyrrhiza uralensis under drought stress (Figure 8). Based on the expression patterns, GuALDH3F1 and GuALDH2B1 exhibited negligible or no expression in different tissues. On the contrary, GuALDH3I2 and GuALDH2B2 demonstrated high levels of expression in multiple tissues. The above results show that GuALDH had different expression patterns, which endowed these genes with different biological functions.

2.7. Co-Expression Analysis of GuALDHs

The research findings indicate that soybean is closely related to Glycyrrhiza uralensis (Figure 6). Consequently, the co-expressed genes of ALDH in Glycyrrhiza uralensis were identified by matching the string online database with the soybean genome database.
The GuALDH co-expression network consists of 122 nodes and 61 connections (Figure 9). The four genes marked in red, GuALDH12A1, GuALDH3H1, GuALDH6B1, and GuALDH12A2, exhibited a high correlation with other genes (Figure 9), and their expression patterns were elevated in various tissues (Figure 8). These results indicate the importance of GuALDH12A1, GuALDH12A2, GuALDH6B1, and GuALDH3H1 in the response of Glycyrrhiza uralensis to drought stress.

2.8. Response of GuALDH Genes to Drought Stress

To study the role of ALDH in environmental stress tolerance, 45-day-old Glycyrrhiza uralensis seedlings were treated with PEG (Polyethylene glycol) for 2 h and 24 h. The relative expression levels of the GuALDH12A1, GuALDH12A2, GuALDH6B1, and GuALDH3H1 genes in Glycyrrhiza uralensis were analyzed under drought stress for different times (p < 0.01) (Figure 10). At the 24 h mark (p < 0.01), the gene expressions of GuALDH12A1 and GuALDH12A2 showed a substantial increase in response to drought stress when compared to the control samples, while the results were the opposite after 2 h of drought stress. After 2 h of treatment with drought stress, the expression levels of the GuALDH3H1 gene were notably elevated in the treatment group when compared to the control sample (p < 0.01) (Figure 10). The expression levels of the GuALDH12A1 and GuALDH12A2 genes under drought stress for 24 h were significantly higher than those of the control samples (p < 0.01), while the results were the opposite after 2 h of drought stress. The expression level of the GuALDH6B1 gene was significantly higher than that of the control samples after 2 h of drought stress (p < 0.01), while the results were the opposite after 24 h of drought stress. Overall, these results indicate that GuALDH12A1, GuALDH12A2, GuALDH6B1, and GuALDH3H1 respond positively to drought stress by increasing ALDH activity, with GuALDH3H1 playing a more significant role in the response to drought stress.

2.9. Changes in Malondialdehyde Content Under Drought Stress

The changes in the malondialdehyde content among different species of Glycyrrhiza uralensis under the same treatment concentration were analyzed (Figure 11). It was observed that, with an increase in stress duration, there was little difference in the malondialdehyde content between the treatment group and the control group in G.glabra and G. inflata. However, the malondialdehyde content in Glycyrrhiza uralensis under drought stress increased and subsequently decreased. In the treatment group, the malondialdehyde content gradually rose over a short time, but with a prolonged treatment time, it was ultimately found that the malondialdehyde content in the treatment group was lower than that in the control group. The Aldehyde dehydrogenase in Glycyrrhiza uralensis likely plays a crucial role in eliminating the aldehyde molecules produced in the body under drought stress. In comparison to the control group, this observation indicates that the associated regulatory genes in Glycyrrhiza uralensis are up-regulated in response to drought stress, facilitating an increased expression level that helps alleviate the adverse effects of such stress.

3. Discussion

Transcription factors play an active role in plants’ responses to abiotic stress, with various mechanisms interacting and collectively promoting plant growth and development. This viewpoint has been confirmed in studies related to different transcription factors, such as MYB and WRKY [19,30,31,32]. In plants, Aldehyde dehydrogenase (ALDH) serves as a common “aldehyde scavenger”, which can effectively facilitate the oxidation of diverse aldehydes and aliphatic compounds, thereby promoting their transformation into the corresponding carboxylic acids [33]. The ALDH gene family has been studied in a variety of plants, including rice [25], Arabidopsis [22], soybean [14], and potato [29]. Investigations concerning the ALDH gene family in Glycyrrhiza uralensis are limited, although some studies have been conducted on abiotic stress in other leguminous plants.
For example, Wang et al. conducted a study examining the impact of neutral (NS) and alkaline (AS) stresses on the activity of ALDH and the expression of ALDH genes in common beans. They also analyzed the PvALDH gene family using bioinformatics technology [34]. Glycyrrhiza uralensis, a traditional Chinese herbal medicine, plays a significant role in the treatment of various diseases [35] and the regulation of immune activity [36]. A total of 53 genes in 10 ALDH gene families have been identified in other legumes. In this study, six ALDH gene families distributed on six different chromosomes were identified in Glycyrrhiza uralensis, comprising a total of 26 ALDH genes.
Gene replication constitutes a key link in the process of biological evolution and is the main mechanism for the expansion of gene family and the function evolution of new genes [37], whereas fragment replication and tandem replication are the basis of plant gene family amplification [38]. This study found that tandem duplication and genome-wide duplication (WGD) significantly contribute to the expansion of the ALDH gene family in Glycyrrhiza uralensis. Two tandem replication events occurred between GuALDH2B1 and GuALDH10A1, GuALDH2C1, and GuALDH2C2, which may have led to the emergence of new biological functions. In addition, the amplification of GuALDH family members is mainly derived from WGD evolution. An analysis of the conserved activation domain suggests that various members of the gene family served distinct roles. In conclusion, the distribution pattern of GuALDH in the evolutionary process indicates that environmental conditions and metabolic demands may be key factors in the evolution of GuALDH genes.
The expression profiles of genes across different tissues in response to drought stress were examined. It was observed that the expression level of GuALDH3H1 was significantly higher than that of the control group at both 2 h and 24 h under drought conditions (p < 0.01), which aligns with the findings reported for other plant species. In Arabidopsis thaliana, the expression of the AtALDH3H1 gene is up-regulated in response to drought, salinity, and the phytohormone abscisic acid, contributing to its salt tolerance and drought tolerance. In soybean, functional genes related to GmALDH are primarily enriched in the proline catabolic pathway [14], highlighting proline’s critical role in responding to abiotic stress. During ABA signaling and dehydration stress response processes, proline regulates ubiquitination pathways or serves as a mediator within metabolic pathways associated with proline [39]. Furthermore, the overexpression of ScALDH21 in tobacco significantly enhanced reactive oxygen species (ROS) enzyme activity and resulted in the increased accumulation of proline under stress conditions [40].
Under drought stress, ABA acts as a stress signal to regulate gene expression in response to stress. ABER is a cis-acting element of ABA response genes, including the A/GCGT motif [41], which acts as a dehydration-induced promoter in Arabidopsis, rice, and soybean to transcriptionally regulate related genes [42]. Studies have shown that nearly half of ABA regulatory genes are affected by drought stress through transcriptome analysis. At present, 245 genes have been identified in Arabidopsis thaliana [43], and 43 corresponding genes in rice are regulated by ABA and drought stress [44]. In Glycyrrhiza uralensis, GuALDH11A3, GuALDH3H1, GuALDH2B1, GuALDH12A2, and GuALDH11A1 all have more than five ABREs (ABA-responsive elements) and are significantly up-regulated by PEG. The expression of certain genes triggered by ABA was influenced by biotic stress, suggesting that these genes play a role in the stress response through the ABA signaling pathway.
Transcription factors are crucial for plants facing abiotic stress, as various mechanisms interact and work together to promote plant growth and development while responding to external stress. Drought poses a significant barrier to plant growth, involving the interaction between ROS and abscisic acid (ABA) [45]. This study found that the expression levels of GuALDH11A3, GuALDH3H1, GuALDH2B1, GuALDH12A2, and GuALDH11A1 were significantly elevated in the response to drought stress. This suggests that these genes contribute positively to licorice’s ability to withstand abiotic stressors. Different environmental factors restrict the growth and development of plants, and our study establishes a foundational basis for the molecular design and breeding of important traits in Glycyrrhiza uralensis.

4. Materials and Methods

4.1. Genome-Wide Identification of GuALDH Gene in Glycyrrhiza uralensis

To confirm the members of the ALDH family within the genome of Glycyrrhiza uralensis, our research group utilized cDNA, genome, and protein sequences of G. uralensis in conjunction with a Hidden Markov Model (HMM) based on Pfam No. PF00171, which encompasses the conserved ALDH domain. The alignment function available in Cluster software (Vers. 3.0) was employed to eliminate sequences that were not present across all eight chromosomes. Additionally, Jalview software (Vers. 2.11.2.4) was utilized to determine whether a conserved glutamine active site (PS00687) is present in GuALDHs. The molecular weight (MW) and isoelectric point (pI) of the GuALDH protein were determined using ExPaSy (https://web.expasy.org/compute_pi/ (accessed on 8 December 2024)) as a tool, while subcellular localization predictions were made utilizing WoLF PSORT (https://wolfpsort.hgc.jp/ (accessed on 12 December 2024)).

4.2. Sequence Alignment and Construction of Phylogenetic Tree

To analyze ALDH proteins from Glycyrrhiza uralensis in relation to those from the well-researched species Arabidopsis thaliana, the protein sequences were aligned with ClustalW. Subsequently, phylogenetic analyses were conducted employing MEGA through bootstrap analysis via the maximum likelihood method and 1000 replicates. A phylogenetic tree was created using Evolview (https://evolgenius.info//evolview-v2/#login (accessed on 19 December 2024)) and subsequently plotted for visualization [30,46].

4.3. Gene Structure, Motif Recognition, and Physical Location

In order to analyze the structure of the ALDH gene in Glycyrrhiza uralensis, TBtools software (Vers. 2.056) was utilized to create exon–intron maps using genomic sequence and coding sequence data. Additionally, conserved motifs were detected with the help of MEME tools (http://meme-suite.org/tools/meme (accessed on 25 December 2024)) in conjunction with TBtools (Vers. 2.056); furthermore, their physical locations on chromosomes were mapped accordingly [31,32,47].

4.4. Analysis of Cis-Regulatory Elements of Predicted Promoter Sequences

The genomic sequence of 2000 bp located upstream of the gene promoter ATG was examined, and the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 27 December 2024)) was used to identify potential cis-regulatory elements, including stress-responsive, hormone-responsive, or transcription factor binding elements. We counted and plotted heat maps to show the number of these components.

4.5. Homology and Gene Duplication Analysis

To examine the homologous genomic regions, MCScanX (Vers. 1.0.0) in TBtools (Vers. 2.056) was utilized to identify these regions within Glycyrrhiza uralensis in comparison to soybean, Arabidopsis, and alfalfa. TBtools (Vers. 2.056) was utilized to illustrate the homology of genes. We demonstrated the evolutionary connection of expansion genes by identifying co-linear gene pairs [48].

4.6. Gene Co-Expression Networks and Gene Annotation

To analyze the co-expression relationship of GuALDH genes, one co-expression gene network of GuALDH was identified using the string database, and the co-expression regulatory network was constructed using Cytoscape software (Vers. 3.10.2).

4.7. Analysis of ALDH Gene Expression in Glycyrrhiza uralensis Based on RNA-Seq

The expression levels of the ALDH gene in various tissues of G. uralensis under drought stress was analyzed, and the transcriptome data of G.uralensis seedlings treated with 15% polyethylene glycol (PEG6000) were analyzed.

4.8. Plant Materials, Drought Stress, RNA Extraction, and qRT-PCR Analysis

Glycyrrhiza uralensis is a wild medicinal plant in Tacheng, Xinjiang. The licorice seeds were soaked in concentrated sulfuric acid for 1 h, rinsed with sterile water 7 times, and then sown in a flowerpot containing vermiculite. The temperature was 28 °C/25 °C (day/night), and the illumination period was 16 h/8 h (light/dark). At the same time, Glycyrrhiza uralensis roots were gathered and kept for later use at −80 °C. Consistently growing seedlings were chosen, transferred to 300 mL hydroponic bottles, and cultivated for three days in a 1× Hoagland (Na+ removed) nutrient solution before being subjected to an abiotic stress treatment [49]. After being treated with 15% PEG6000 for 2 h and 24 h, the samples were frozen in liquid nitrogen and kept for subsequent use at −80 °C in an ultra-low-temperature refrigerator. The total RNA from the seedlings was extracted utilizing the Tiangen RNA plant extraction kit, and the qRT-PCR (quantitative real-time PCR) reverse transcription kit (Toyobo, Tokyo Japan) was used to convert the RNA into cDNA. Gene-specific primers were employed for the purpose of quantitative real-time polymerase chain reaction (PCR). The 2−(∆∆Ct) technique was utilized to evaluate and visualize the produced qRT-PCR data, with the lectin gene found in licorice serving as a reference gene. Table 2 displays the primers that were utilized.

5. Conclusions

In the current study, 26 GuALDH genes were identified in Glycyrrhiza uralensis, which were classified into six families on six chromosomes. Under abiotic stress, the aspects we examined are as follows: gene structure, conserved motifs, cis-acting elements, homologous genomic regions, evolutionary and differentiation patterns, and expression patterns. To summarize, these results offer a thorough theoretical foundation for the ALDH gene family in Glycyrrhiza uralensis and aid in comprehending the molecular mechanism underlying the ALDH gene’s role in the growth, development, and drought stress adaption of this species.

Author Contributions

Conceptualization, H.S.; validation and investigation, H.S. and H.Y.; methodology, M.H.; resources, X.O., L.C., and Y.L.; formal analysis, L.C. and Y.L.; software, N.S.; data curation, H.M. and Y.S.; writing—original draft preparation, M.H. and X.O.; writing—review and editing M.H. and X.O.; project administration H.S. and H.Y.; funding acquisition H.S. All authors have read and agreed to the published version of the manuscript.

Funding

1. The National Natural Science Foundation of China. Project approval number: 32260083. Project name: Cytokinin-dependent A-GuRRs regulate the synthesis mechanism of flavonoids active ingredients in Glycyrrhiza uralensis. 2. Corps key areas of science and technology research projects-basic research projects. Study on flowering mechanism of licorice early flowering mutant. Item No.: 2023CB008-17. 3. Corps science and technology research projects. Research and application demonstration of key technologies for high yield and high quality licorice breeding and planting in southern Xinjiang. Item No.: 2023AB052. 4. The third Xinjiang comprehensive scientific investigation project of the Ministry of Science and Technology. Investigation of plant germplasm resources and forage economic forest in Tarim River Basin. Project number: 2022xjkkk0201.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article.

Acknowledgments

We thank the Key Laboratory of Xinjiang Phytomedicine Resource and Utilization of Ministry of Education, College of Life Sciences, Shihezi University, Shihezi 832003, China.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations

ALDHs: aldehyde dehydrogenases; ABA, abscisic acid; ROS, reactive oxygen species; HMM, Hidden Markov Model; PEG, polyethylene glycol; RNA-seq, RNA sequencing; qRT-PCR, quantitative real-time PCR; WGD, genome-wide duplication; FPKM, Fragments Per Kilobase of exon model per Million mapped fragments; ORF, open reading frame; aa, amino acid; MW, molecular weight; kDa, kilodalton; pI, isoelectric point.

References

  1. Zhang, H.; Zhu, J.; Gong, Z.; Zhu, J.K. Abiotic stress responses in plants. Nat. Rev. Genet. 2022, 23, 104–119. [Google Scholar] [CrossRef] [PubMed]
  2. Czarnocka, W.; Karpiński, S. Friend or foe? Reactive oxygen species production, scavenging and signaling in plant response to environmental stresses. Free Radic. Biol. Med. 2018, 122, 4–20. [Google Scholar] [CrossRef] [PubMed]
  3. Singh, S.; Brocker, C.; Koppaka, V.; Chen, Y.; Jackson, B.C.; Matsumoto, A.; Thompson, D.C.; Vasiliou, V. Aldehyde dehydrogenases in cellular responses to oxidative/electrophilic stress. Free Radic. Biol. Med. 2013, 56, 89–101. [Google Scholar] [CrossRef]
  4. Stiti, N.; Missihoun, T.D.; Kotchoni, S.O.; Kirch, H.H.; Bartels, D. Aldehyde Dehydrogenases in Arabidopsis thaliana: Biochemical Requirements, Metabolic Pathways, and Functional Analysis. Front. Plant Sci. 2011, 2, 65. [Google Scholar] [CrossRef]
  5. Carmona-Molero, R.; Jimenez-Lopez, J.C.; Caballo, C.; Gil, J.; Millán, T.; Die, J.V. Aldehyde Dehydrogenase 3 Is an Expanded Gene Family with Potential Adaptive Roles in Chickpea. Plants 2021, 10, 2429. [Google Scholar] [CrossRef]
  6. Rodrigues, S.M.; Andrade, M.O.; Gomes, A.P.; Damatta, F.M.; Baracat-Pereira, M.C.; Fontes, E.P. Arabidopsis and tobacco plants ectopically expressing the soybean antiquitin-like ALDH7 gene display enhanced tolerance to drought, salinity, and oxidative stress. J. Exp. Bot. 2006, 57, 1909–1918. [Google Scholar] [CrossRef]
  7. Yoshida, A.; Rzhetsky, A.; Hsu, L.C.; Chang, C. Human Aldehyde dehydrogenase gene family. Eur. J. Biochem. 1998, 251, 549–557. [Google Scholar] [CrossRef]
  8. Vasiliou, V.; Bairoch, A.; Tipton, K.F.; Nebert, D.W. Eukaryotic Aldehyde dehydrogenase (ALDH) genes: Human polymorphisms, and recommended nomenclature based on divergent evolution and chromosomal mapping. Pharmacogenetics 1999, 9, 421–434. [Google Scholar] [PubMed]
  9. Sophos, N.A.; Vasiliou, V. Aldehyde dehydrogenase gene superfamily: The 2002 update. Chem. Biol. Interact. 2003, 143, 5–22. [Google Scholar] [CrossRef]
  10. Brocker, C.; Vasiliou, M.; Carpenter, S.; Carpenter, C.; Zhang, Y.; Wang, X.; Kotchoni, S.O.; Wood, A.J.; Kirch, H.H.; Kopečný, D.; et al. Aldehyde dehydrogenase (ALDH) superfamily in plants: Gene nomenclature and comparative genomics. Planta 2013, 237, 189–210. [Google Scholar] [CrossRef]
  11. Missihoun, T.D.; Schmitz, J.; Klug, R.; Kirch, H.H.; Bartels, D. Betaine Aldehyde dehydrogenase genes from Arabidopsis with different sub-cellular localization affect stress responses. Planta 2011, 233, 369–382. [Google Scholar] [CrossRef] [PubMed]
  12. Kirch, H.H.; Bartels, D.; Wei, Y.; Schnable, P.S.; Wood, A.J. The ALDH gene superfamily of Arabidopsis. Trends Plant Sci. 2004, 9, 371–377. [Google Scholar] [CrossRef]
  13. Kirch, H.H.; Schlingensiepen, S.; Kotchoni, S.; Sunkar, R.; Bartels, D. Detailed expression analysis of selected genes of the Aldehyde dehydrogenase (ALDH) gene superfamily in Arabidopsis thaliana. Plant Mol. Biol. 2005, 57, 315–332. [Google Scholar] [CrossRef]
  14. Wang, W.; Jiang, W.; Liu, J.; Li, Y.; Gai, J.; Li, Y. Genome-wide characterization of the Aldehyde dehydrogenase gene superfamily in soybean and its potential role in drought stress response. BMC Genom. 2017, 18, 518. [Google Scholar] [CrossRef]
  15. Zhang, X.; Zhong, J.; Cao, L.; Ren, C.; Yu, G.; Gu, Y.; Ruan, J.; Zhao, S.; Wang, L.; Ru, H.; et al. Genome-wide characterization of Aldehyde dehydrogenase gene family members in groundnut (Arachis hypogaea) and the analysis under saline-alkali stress. Front. Plant Sci. 2023, 14, 1097001. [Google Scholar] [CrossRef]
  16. Zhou, J.; Wang, X.; Jiao, Y.; Qin, Y.; Liu, X.; He, K.; Chen, C.; Ma, L.; Wang, J.; Xiong, L.; et al. Global genome expression analysis of rice in response to drought and high-salinity stresses in shoot, flag leaf, and panicle. Plant Mol. Biol. 2007, 63, 591–608. [Google Scholar] [CrossRef]
  17. Gao, C.; Han, B. Evolutionary and expression study of the Aldehyde dehydrogenase (ALDH) gene superfamily in rice (Oryza sativa). Gene 2009, 431, 86–94. [Google Scholar] [CrossRef] [PubMed]
  18. Xie, X.; Zhang, Z.; Zhao, Z.; Xie, Y.; Li, H.; Ma, X.; Liu, Y.G.; Chen, L. The mitochondrial Aldehyde dehydrogenase OsALDH2b negatively regulates tapetum degeneration in rice. J. Exp. Bot. 2020, 71, 2551–2560. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, X.; Niu, Y.; Zheng, Y. Multiple Functions of MYB Transcription Factors in Abiotic Stress Responses. Int. J. Mol. Sci. 2021, 22, 6125. [Google Scholar] [CrossRef]
  20. Guo, Z.; Dzinyela, R.; Yang, L.; Hwarari, D. bZIP Transcription Factors: Structure, Modification, Abiotic Stress Responses and Application in Plant Improvement. Plants 2024, 13, 2058. [Google Scholar] [CrossRef]
  21. Fang, L.; Su, L.; Sun, X.; Li, X.; Sun, M.; Karungo, S.K.; Fang, S.; Chu, J.; Li, S.; Xin, H. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis. J. Exp. Bot. 2016, 67, 2829–2845. [Google Scholar] [CrossRef] [PubMed]
  22. Hou, Q.; Bartels, D. Comparative study of the Aldehyde dehydrogenase (ALDH) gene superfamily in the glycophyte Arabidopsis thaliana and Eutrema halophytes. Ann. Bot. 2015, 115, 465–479. [Google Scholar] [CrossRef]
  23. Zhang, Y.; Mao, L.; Wang, H.; Brocker, C.; Yin, X.; Vasiliou, V.; Fei, Z.; Wang, X. Genome-wide identification and analysis of grape Aldehyde dehydrogenase (ALDH) gene superfamily. PLoS ONE 2012, 7, e32153. [Google Scholar] [CrossRef] [PubMed]
  24. Islam, M.S.; Mohtasim, M.; Islam, T.; Ghosh, A. Aldehyde dehydrogenase superfamily in sorghum: Genome-wide identification, evolution, and transcript profiling during development stages and stress conditions. BMC Plant Biol. 2022, 22, 316. [Google Scholar] [CrossRef]
  25. Kotchoni, S.O.; Jimenez-Lopez, J.C.; Gao, D.; Edwards, V.; Gachomo, E.W.; Margam, V.M.; Seufferheld, M.J. Modeling-dependent protein characterization of the rice Aldehyde dehydrogenase (ALDH) superfamily reveals distinct functional and structural features. PLoS ONE 2010, 5, e11516. [Google Scholar] [CrossRef] [PubMed]
  26. Zhou, M.L.; Zhang, Q.; Zhou, M.; Qi, L.P.; Yang, X.B.; Zhang, K.X.; Pang, J.F.; Zhu, X.M.; Shao, J.R.; Tang, Y.X.; et al. Aldehyde dehydrogenase protein superfamily in maize. Funct. Integr. Genom. 2012, 12, 683–691. [Google Scholar] [CrossRef]
  27. Gu, H.; Pan, Z.; Jia, M.; Fang, H.; Li, J.; Qi, Y.; Yang, Y.; Feng, W.; Gao, X.; Ditta, A.; et al. Genome-wide identification and analysis of the cotton ALDH gene family. BMC Genom. 2024, 25, 513. [Google Scholar] [CrossRef]
  28. Li, X.; Guo, R.; Li, J.; Singer, S.D.; Zhang, Y.; Yin, X.; Zheng, Y.; Fan, C.; Wang, X. Genome-wide identification and analysis of the Aldehyde dehydrogenase (ALDH) gene superfamily in apple (Malus × domestica Borkh.). Plant Physiol. Biochem. 2013, 71, 268–282. [Google Scholar] [CrossRef] [PubMed]
  29. Islam, M.S.; Hasan, M.S.; Hasan, M.N.; Prodhan, S.H.; Islam, T.; Ghosh, A. Genome-wide identification, evolution, and transcript profiling of Aldehyde dehydrogenase superfamily in potato during development stages and stress conditions. Sci. Rep. 2021, 11, 18284. [Google Scholar] [CrossRef]
  30. Han, D.; Xu, T.; Han, J.; Liu, W.; Wang, Y.; Li, X.; Sun, X.; Wang, X.; Li, T.; Yang, G. Overexpression of MxWRKY53 increased iron and high salinity stress tolerance in Arabidopsis thaliana. In Vitr. Cell. Dev. Biol. Plant 2022, 58, 266–278. [Google Scholar] [CrossRef]
  31. Han, D.; Zhang, Z.-y.; Ding, H.; Chai, L.; Liu, W.; Li, H.; Yang, G. Isolation and characterization of MbWRKY2 gene involved in enhanced drought tolerance in transgenic tobacco. J. Plant Interact. 2018, 13, 163–172. [Google Scholar] [CrossRef]
  32. Li, W.; Li, P.; Chen, H.; Zhong, J.; Liang, X.; Wei, Y.; Zhang, L.; Wang, H.; Han, D. Overexpression of a Fragaria vesca 1R-MYB Transcription Factor Gene (FvMYB114) Increases Salt and Cold Tolerance in Arabidopsis thaliana. Int. J. Mol. Sci. 2023, 24, 5261. [Google Scholar] [CrossRef]
  33. Kotchoni, S.O.; Jimenez-Lopez, J.C.; Kayodé, A.P.; Gachomo, E.W.; Baba-Moussa, L. The soybean Aldehyde dehydrogenase (ALDH) protein superfamily. Gene 2012, 495, 128–133. [Google Scholar] [CrossRef]
  34. Wang, X.; Wu, M.; Yu, S.; Zhai, L.; Zhu, X.; Yu, L.; Zhang, Y. Comprehensive analysis of the Aldehyde dehydrogenase gene family in Phaseolus vulgaris L. and their response to saline-alkali stress. Front. Plant Sci. 2024, 15, 1283845. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, L.; Zhang, K.; Han, S.; Zhang, L.; Bai, H.; Bao, F.; Zeng, Y.; Wang, J.; Du, H.; Liu, Y.; et al. Constituents Isolated from the Leaves of Glycyrrhiza uralansis and Their Anti-Inflammatory Activities on LPS-Induced RAW264.7 Cells. Molecules 2019, 24, 1923. [Google Scholar] [CrossRef]
  36. Aipire, A.; Li, J.; Yuan, P.; He, J.; Hu, Y.; Liu, L.; Feng, X.; Li, Y.; Zhang, F.; Yang, J.; et al. Glycyrrhiza uralensis water extract enhances dendritic cell maturation and antitumor efficacy of HPV dendritic cell-based vaccine. Sci. Rep. 2017, 7, 43796. [Google Scholar] [CrossRef] [PubMed]
  37. Cannon, S.B.; Mitra, A.; Baumgarten, A.; Young, N.D.; May, G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol. 2004, 4, 10. [Google Scholar] [CrossRef]
  38. Zhu, Y.; Wu, N.; Song, W.; Yin, G.; Qin, Y.; Yan, Y.; Hu, Y. Soybean (Glycine max) expansin gene superfamily origins: Segmental and tandem duplication events followed by divergent selection among subfamilies. BMC Plant Biol. 2014, 14, 93. [Google Scholar] [CrossRef]
  39. Kim, A.R.; Min, J.H.; Lee, K.H.; Kim, C.S. PCA22 acts as a suppressor of atrzf1 to mediate proline accumulation in response to abiotic stress in Arabidopsis. J. Exp. Bot. 2017, 68, 1797–1809. [Google Scholar] [CrossRef]
  40. Yang, H.; Zhang, D.; Li, H.; Dong, L.; Lan, H. Ectopic overexpression of the Aldehyde dehydrogenase ALDH21 from Syntrichia caninervis in tobacco confers salt and drought stress tolerance. Plant Physiol. Biochem. 2015, 95, 83–91. [Google Scholar] [CrossRef]
  41. Hobo, T.; Kowyama, Y.; Hattori, T. A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription. Proc. Natl. Acad. Sci. USA 1999, 96, 15348–15353. [Google Scholar] [CrossRef] [PubMed]
  42. Maruyama, K.; Todaka, D.; Mizoi, J.; Yoshida, T.; Kidokoro, S.; Matsukura, S.; Takasaki, H.; Sakurai, T.; Yamamoto, Y.Y.; Yoshiwara, K.; et al. Identification of cis-acting promoter elements in cold- and dehydration-induced transcriptional pathways in Arabidopsis, rice, and soybean. DNA Res. 2012, 19, 37–49. [Google Scholar] [CrossRef] [PubMed]
  43. Seki, M.; Ishida, J.; Narusaka, M.; Fujita, M.; Nanjo, T.; Umezawa, T.; Kamiya, A.; Nakajima, M.; Enju, A.; Sakurai, T.; et al. Monitoring the expression pattern of around 7,000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct. Integr. Genom. 2002, 2, 282–291. [Google Scholar] [CrossRef]
  44. Rabbani, M.A.; Maruyama, K.; Abe, H.; Khan, M.A.; Katsura, K.; Ito, Y.; Yoshiwara, K.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses. Plant Physiol. 2003, 133, 1755–1767. [Google Scholar] [CrossRef]
  45. Jones, A.M. A new look at stress: Abscisic acid patterns and dynamics at high-resolution. New Phytol. 2016, 210, 38–44. [Google Scholar] [CrossRef]
  46. Han, D.; Du, M.; Zhou, Z.; Wang, S.; Li, T.; Han, J.; Xu, T.; Yang, G. An NAC transcription factor gene from Malus baccata, MbNAC29, increases cold and high salinity tolerance in Arabidopsis. In Vitr. Cell. Dev. Biol. Plant 2020, 56, 588–599. [Google Scholar] [CrossRef]
  47. Han, D.; Hou, Y.; Ding, H.; Zhou, Z.; Li, H.; Yang, G. Isolation and Preliminary Functional Analysis of MbWRKY 4 Gene Involved in Salt Tolerance in Transgenic Tobacco. Int. J. Agric. Biol. 2018, 20, 2045–2052. [Google Scholar]
  48. Chen, C.; Wu, Y.; Xia, R. A painless way to customize Circos plot: From data preparation to visualization using TBtools. iMeta 2022, 1, e35. [Google Scholar] [CrossRef]
  49. Xian, Y.; Wang, F.; Xie, S.; Chen, X.; Shen, H.; Li, H. Identification and Expression Analysis of the CIPK Gene Family in Ural Licorice. J. Biol. 2022, 39, 62–68. [Google Scholar]
Ijms 26 02333 g001
Figure 1. The sequence alignment of the ALDH conserved structural domain of the GuALDH proteins. The conserved ALDH domain (PF00171) of all GuALDH proteins was analyzed. The purple frame indicates the conserved glutamic acid active site (PS00687), and the purple label indicates the conserved active site.
Figure 1. The sequence alignment of the ALDH conserved structural domain of the GuALDH proteins. The conserved ALDH domain (PF00171) of all GuALDH proteins was analyzed. The purple frame indicates the conserved glutamic acid active site (PS00687), and the purple label indicates the conserved active site.
Ijms 26 02333 g001
Ijms 26 02333 g002
Figure 2. Phylogenetic analysis of ALDH members. ALDH proteins were aligned using ClustalW, and phylogenetic analysis was performed with MEGA11 based on maximum likelihood. Resulting tree was categorized into six families, with each background color representing different family and specific name of each ALDH family labeled accordingly. Green star indicates Glycyrrhiza uralensis, and red star indicates Arabidopsis thaliana.
Figure 2. Phylogenetic analysis of ALDH members. ALDH proteins were aligned using ClustalW, and phylogenetic analysis was performed with MEGA11 based on maximum likelihood. Resulting tree was categorized into six families, with each background color representing different family and specific name of each ALDH family labeled accordingly. Green star indicates Glycyrrhiza uralensis, and red star indicates Arabidopsis thaliana.
Ijms 26 02333 g002
Ijms 26 02333 g003
Figure 3. The structure and protein structure of the ALDH gene family in Glycyrrhiza uralensis. (A) The phylogenetic tree was created using MEGA11. (B) A structural analysis of the exons/introns of GuALDH genes. The green box indicates the exon, and the blue box indicates the 3′ or 5′ UTRs (untranslated regions). (C) The motif composition of the ALDH gene in Glycyrrhiza uralensis. Different colored boxes represent different motifs.
Figure 3. The structure and protein structure of the ALDH gene family in Glycyrrhiza uralensis. (A) The phylogenetic tree was created using MEGA11. (B) A structural analysis of the exons/introns of GuALDH genes. The green box indicates the exon, and the blue box indicates the 3′ or 5′ UTRs (untranslated regions). (C) The motif composition of the ALDH gene in Glycyrrhiza uralensis. Different colored boxes represent different motifs.
Ijms 26 02333 g003
Ijms 26 02333 g004
Figure 4. Chromosome distribution of GuALDHs in Glycyrrhiza uralensis.
Figure 4. Chromosome distribution of GuALDHs in Glycyrrhiza uralensis.
Ijms 26 02333 g004
Ijms 26 02333 g005
Figure 5. The distribution of the GuALDH gene chromosomes and the interchromosomal connections. The connection between duplicated genes in GuALDHs is represented by a red line.
Figure 5. The distribution of the GuALDH gene chromosomes and the interchromosomal connections. The connection between duplicated genes in GuALDHs is represented by a red line.
Ijms 26 02333 g005
Ijms 26 02333 g006
Figure 6. The evolutionary relationship between the ALDH gene in Glycyrrhiza uralensis and different species of Arabidopsis thaliana, soybean, rice, and alfalfa.
Figure 6. The evolutionary relationship between the ALDH gene in Glycyrrhiza uralensis and different species of Arabidopsis thaliana, soybean, rice, and alfalfa.
Ijms 26 02333 g006
Ijms 26 02333 g007
Figure 7. An analysis of cis-acting elements on the promoters of the GuALDH gene family in Glycyrrhiza uralensis. The sequence 2000 bp upstream of the ATG in GuALDHs was analyzed for cis-element responsiveness. The heatmap illustrates the quantity of cis-elements, with higher counts represented in red and lower counts in gray.
Figure 7. An analysis of cis-acting elements on the promoters of the GuALDH gene family in Glycyrrhiza uralensis. The sequence 2000 bp upstream of the ATG in GuALDHs was analyzed for cis-element responsiveness. The heatmap illustrates the quantity of cis-elements, with higher counts represented in red and lower counts in gray.
Ijms 26 02333 g007
Ijms 26 02333 g008
Figure 8. Expression patterns of GuALDHs in different tissues. Based on RNA-sequencing (RNA-seq) data of Glycyrrhiza uralensis, the expression patterns were analyzed. A hierarchical clustering heatmap was drawn based on the Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) value. The three expression pattern groups are represented by distinct colors: red indicates a high expression level, while blue indicates a low expression level.
Figure 8. Expression patterns of GuALDHs in different tissues. Based on RNA-sequencing (RNA-seq) data of Glycyrrhiza uralensis, the expression patterns were analyzed. A hierarchical clustering heatmap was drawn based on the Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) value. The three expression pattern groups are represented by distinct colors: red indicates a high expression level, while blue indicates a low expression level.
Ijms 26 02333 g008
Ijms 26 02333 g009
Figure 9. The regulatory network of co-expression for GuALDH in Glycyrrhiza uralensis.
Figure 9. The regulatory network of co-expression for GuALDH in Glycyrrhiza uralensis.
Ijms 26 02333 g009
Ijms 26 02333 g010
Figure 10. Patterns of expression for GuALDH genes in response to drought stress. The relative expression levels of GuALDH genes were examined in Glycyrrhiza uralensis seedlings after being treated with PEG for durations of 2 h and 24 h. The tap water seedlings were used as a reference for the expression of GuALDHs genes at each time point. The data are presented as the mean ± standard deviation. ** p < 0.01 indicate statistically significant differences between the two conditions.
Figure 10. Patterns of expression for GuALDH genes in response to drought stress. The relative expression levels of GuALDH genes were examined in Glycyrrhiza uralensis seedlings after being treated with PEG for durations of 2 h and 24 h. The tap water seedlings were used as a reference for the expression of GuALDHs genes at each time point. The data are presented as the mean ± standard deviation. ** p < 0.01 indicate statistically significant differences between the two conditions.
Ijms 26 02333 g010
Ijms 26 02333 g011
Figure 11. Changes in malondialdehyde content in three kinds of licorice at different times under PEG stress.
Figure 11. Changes in malondialdehyde content in three kinds of licorice at different times under PEG stress.
Ijms 26 02333 g011
Table 1. Basic characteristic of GuALDHs.
Table 1. Basic characteristic of GuALDHs.
FamilyGene NameGene IDORF(aa)MW(kDa)pISub Localization
Family2GuALDH2B1Glycyrrhiza_uralensis_Fisch0104330.149253.766.16Mitochondrion
GuALDH2C1Glycyrrhiza_uralensis_Fisch0121290.150554.635.73Cytoplasm
GuALDH2C2Glycyrrhiza_uralensis_Fisch0121300.149854.135.99Cytoplasm
GuALDH2B2Glycyrrhiza_uralensis_Fisch0205690.154259.328.31Mitochondrion
GuALDH2B3Glycyrrhiza_uralensis_Fisch0227020.149453.515.74Cytoplasm
GuALDH2B4Glycyrrhiza_uralensis_Fisch0269090.153157.487.99Mitochondrion
GuALDH2C3Glycyrrhiza_uralensis_Fisch0284140.150154.436.35Cytoplasm
GuALDH2C4Glycyrrhiza_uralensis_Fisch0284220.150354.965.82Cytoplasm
Family3GuALDH3H1Glycyrrhiza_uralensis_Fisch0061860.149754.488.83Cytoplasm
GuALDH3I1Glycyrrhiza_uralensis_Fisch0091680.154560.187.57Chloroplast
GuALDH3H2Glycyrrhiza_uralensis_Fisch0114530.158164.029.39Peroxisome
GuALDH3F2Glycyrrhiza_uralensis_Fisch0197170.151456.608.53Mitochondrion
GuALDH3F3Glycyrrhiza_uralensis_Fisch0211780.145150.648.45Cytoplasm
GuALDH3F4Glycyrrhiza_uralensis_Fisch0253710.147051.757.02Cytoplasm
GuALDH3F5Glycyrrhiza_uralensis_Fisch0257550.159465.546.26Chloroplast
GuALDH3I2Glycyrrhiza_uralensis_Fisch0125250.154560.076.74Chloroplast
GuALDH3F1Glycyrrhiza_uralensis_Fisch0127260.144950.188.88Nuclear
Family10GuALDH10A2Glycyrrhiza_uralensis_Fisch0205450.150354.485.18Peroxisome
GuALDH10A1Glycyrrhiza_uralensis_Fisch0104500.150354.785.13Peroxisome
Family6GuALDH6B1Glycyrrhiza_uralensis_Fisch0265940.151054.786.34Mitochondrion
GuALDH6B2Glycyrrhiza_uralensis_Fisch0138040.148352.197.09Chloroplast
Family11GuALDH11A1Glycyrrhiza_uralensis_Fisch0065080.151955.607.51Cytoplasm
GuALDH11A2Glycyrrhiza_uralensis_Fisch0113230.113815.3910.06Nuclear
GuALDH11A3Glycyrrhiza_uralensis_Fisch0201600.149653.147.08Cytoplasm
Family12GuALDH12A1Glycyrrhiza_uralensis_Fisch0110500.172779.456.87Cytoplasm
GuALDH12A2Glycyrrhiza_uralensis_Fisch0204970.154460.456.48Mitochondrion
Table 2. Primers used for GuALDH gene expression analysis.
Table 2. Primers used for GuALDH gene expression analysis.
Primer NamePrimer Sequences F (5′-3′)Primer Sequences R (5′-3′)
GuALDH3F4TCTCACCGAGCCTAAGGTCAGACTGAACGCGTCAAACGAG
GuALDH6B1TTGGCATTGGAAGCTGGTCTTTGCTGATGACCGGACCAAG
GuALDH12A1GGTCGCCAAAGGCTCAGATACCACCTCTTCCCACCCTAGA
GuALDH12A2GCCACGGTAGAAGCAGAAGATGACCTTGCCAGGAAACGAA
Gulectinctgatgcagagcttcaaatcgagttcggaaggaaggttgaggtaag
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

He, M.; Ouyang, X.; Cheng, L.; Li, Y.; Shi, N.; Ma, H.; Sun, Y.; Yao, H.; Shen, H. Identification of Aldehyde Dehydrogenase Gene Family in Glycyrrhiza uralensis and Analysis of Expression Pattern Under Drought Stress. Int. J. Mol. Sci. 2025, 26, 2333. https://doi.org/10.3390/ijms26052333

AMA Style

He M, Ouyang X, Cheng L, Li Y, Shi N, Ma H, Sun Y, Yao H, Shen H. Identification of Aldehyde Dehydrogenase Gene Family in Glycyrrhiza uralensis and Analysis of Expression Pattern Under Drought Stress. International Journal of Molecular Sciences. 2025; 26(5):2333. https://doi.org/10.3390/ijms26052333

Chicago/Turabian Style

He, Mengyuan, Xu Ouyang, Linyuan Cheng, Yuetao Li, Nana Shi, Hongxia Ma, Yu Sun, Hua Yao, and Haitao Shen. 2025. "Identification of Aldehyde Dehydrogenase Gene Family in Glycyrrhiza uralensis and Analysis of Expression Pattern Under Drought Stress" International Journal of Molecular Sciences 26, no. 5: 2333. https://doi.org/10.3390/ijms26052333

APA Style

He, M., Ouyang, X., Cheng, L., Li, Y., Shi, N., Ma, H., Sun, Y., Yao, H., & Shen, H. (2025). Identification of Aldehyde Dehydrogenase Gene Family in Glycyrrhiza uralensis and Analysis of Expression Pattern Under Drought Stress. International Journal of Molecular Sciences, 26(5), 2333. https://doi.org/10.3390/ijms26052333

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop