A Leg Cuticle Protein Enhances the Resistance of Anopheles sinensis Mosquitoes to Deltamethrin
Abstract
1. Introduction
2. Results
2.1. Transmission Electron Microscopy (TEM) Analysis of the Tarsus Cuticle of Anopheles sinensis
2.2. Principal Component Analysis (PCA) of Transcriptome Data
2.3. Differential Expression Analysis of Cuticle Protein Genes in the Leg of Resistant Anopheles sinensis
2.4. Expression of Cuticle Protein Genes (CPGs)
2.5. Expression Response of CPGs Under Deltamethrin Exposure
2.6. Insecticide Resistance Bioassays and Examination of Cuticle Structure After RNAi
3. Discussion
4. Materials and Methods
4.1. Mosquito Rearing and Collection
4.2. Insecticide Resistance Bioassay of Field Anopheles sinensis
4.3. Transmission Electron Microscopy (TEM) and Image Analysis
4.4. Transcriptomic Analysis
4.4.1. RNA Extraction, RNA-Seq Library Preparation and Sequencing
4.4.2. RNA Sequencing and Differentially Expressed Gene Analysis
4.5. Quantitative PCR for RNA-seq Data Validation
4.6. Quantitative Analysis of CP Genes in Different Tissues of Anopheles sinensis
4.7. Gene Functional Verification
4.7.1. Response of CP Gene Expression to Deltamethrin Exposure
4.7.2. dsRNA Synthesis and Microinjection
4.7.3. Insecticide Resistance Bioassays After RNAi
4.7.4. Examination of Cuticle Structure After RNAi
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhao, Y.-Q.; Tang, Y.-Y.; Hu, J.-P.; Huang, Y.-Z.; Wan, K.; Zhang, M.-H.; Li, J.-L.; Zhu, G.-D.; Tang, J.-X. An Aquaporin and an Aquaglyceroporin Have Roles in Low Temperature Adaptation of Mosquitoes (Anopheles sinensis). Insect Sci. 2024, 31, 1743–1755. [Google Scholar] [CrossRef] [PubMed]
- Van den Berg, H.; da Silva Bezerra, H.S.; Al-Eryani, S.; Chanda, E.; Nagpal, B.N.; Knox, T.B.; Velayudhan, R.; Yadav, R.S. Recent Trends in Global Insecticide Use for Disease Vector Control and Potential Implications for Resistance Management. Sci. Rep. 2021, 11, 23867. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, S.; Weiss, D.J.; Cameron, E.; Bisanzio, D.; Mappin, B.; Dalrymple, U.; Battle, K.; Moyes, C.L.; Henry, A.; Eckhoff, P.A.; et al. The Effect of Malaria Control on Plasmodium falciparum in Africa between 2000 and 2015. Nature 2015, 526, 207–211. [Google Scholar] [CrossRef] [PubMed]
- Akoton, R.; Sovegnon, P.M.; Djihinto, O.Y.; Medjigbodo, A.A.; Agonhossou, R.; Saizonou, H.M.; Tchigossou, G.M.; Atoyebi, S.M.; Tossou, E.; Zeukeng, F.; et al. Vectorial Competence, Insecticide Resistance in Anopheles funestus and Operational Implications for Malaria Vector Control Strategies in Benin Republic. Malar. J. 2023, 22, 385. [Google Scholar] [CrossRef]
- Jacobs, E.; Chrissian, C.; Rankin-Turner, S.; Wear, M.; Camacho, E.; Broderick, N.A.; McMeniman, C.J.; Stark, R.E.; Casadevall, A. Cuticular Profiling of Insecticide Resistant Aedes aegypti. Sci. Rep. 2023, 13, 10154. [Google Scholar] [CrossRef]
- Meng, L.-W.; Yuan, G.-R.; Chen, M.-L.; Zheng, L.-S.; Dou, W.; Peng, Y.; Bai, W.-J.; Li, Z.-Y.; Vontas, J.; Wang, J.-J. Cuticular Competing Endogenous RNAs Regulate Insecticide Penetration and Resistance in a Major Agricultural Pest. BMC Biol. 2023, 21, 187. [Google Scholar] [CrossRef]
- Cai, T.; Wang, X.; Liu, B.; Zhao, H.; Liu, C.; Zhang, X.; Zhang, Y.; Gao, H.; Schal, C.; Zhang, F. A Cuticular Protein, BgCPLCP1, Contributes to Insecticide Resistance by Thickening the Cockroach Endocuticle. Int. J. Biol. Macromol. 2024, 254, 127642. [Google Scholar] [CrossRef]
- Balabanidou, V.; Grigoraki, L.; Vontas, J. Insect Cuticle: A Critical Determinant of Insecticide Resistance. Curr. Opin. Insect Sci. 2018, 27, 68–74. [Google Scholar] [CrossRef]
- Yan, Z.; Tong, X.; Xiong, G.; Yang, W.; Lu, K.; Yuan, Y.; Han, M.; Hu, H.; Wei, W.; Dai, F. A Blueprint of Microstructures and Stage-Specific Transcriptome Dynamics of Cuticle Formation in Bombyx Mori. Int. J. Mol. Sci. 2022, 23, 5155. [Google Scholar] [CrossRef]
- Ren, Y.; Li, Y.; Ju, Y.; Zhang, W.; Wang, Y. Insect Cuticle and Insecticide Development. Arch. Insect Biochem. Physiol. 2023, 114, e22057. [Google Scholar] [CrossRef]
- Yahouédo, G.A.; Chandre, F.; Rossignol, M.; Ginibre, C.; Balabanidou, V.; Mendez, N.G.A.; Pigeon, O.; Vontas, J.; Cornelie, S. Contributions of Cuticle Permeability and Enzyme Detoxification to Pyrethroid Resistance in the Major Malaria Vector Anopheles Gambiae. Sci. Rep. 2017, 7, 11091. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Guo, J.; Ye, W.; Guo, Q.; Huang, Y.; Ma, L.; Zhou, D.; Shen, B.; Sun, Y.; Zhu, C. Cuticle Genes CpCPR63 and CpCPR47 May Confer Resistance to Deltamethrin in Culex pipiens pallens. Parasitol. Res. 2017, 116, 2175–2179. [Google Scholar] [CrossRef] [PubMed]
- Soh, L.-S.; Veera Singham, G. Cuticle Thickening Associated with Fenitrothion and Imidacloprid Resistance and Influence of Voltage-Gated Sodium Channel Mutations on Pyrethroid Resistance in the Tropical Bed Bug, Cimex Hemipterus. Pest. Manag. Sci. 2021, 77, 5202–5212. [Google Scholar] [CrossRef]
- Xu, Y.; Xu, J.; Zhou, Y.; Li, X.; Meng, Y.; Ma, L.; Zhou, D.; Shen, B.; Sun, Y.; Zhu, C. CPR63 Promotes Pyrethroid Resistance by Increasing Cuticle Thickness in Culex pipiens pallens. Parasit. Vectors 2022, 15, 54. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.; Li, G.; Guo, H.; Li, H.; Tian, M.; Liu, Q.; Wang, Y.; Xu, B.; Guo, X. Identification of the Cuticle Protein AccCPR2 Gene in Apis cerana cerana and Its Response to Environmental Stress. Insect Mol. Biol. 2022, 31, 634–646. [Google Scholar] [CrossRef]
- Zhou, D.; Duan, B.; Sun, Y.; Ma, L.; Zhu, C.; Shen, B. Preliminary Characterization of Putative Structural Cuticular Proteins in the Malaria Vector Anopheles sinensis: Cuticular Proteins in Anopheles sinensis. Pest. Manag. Sci. 2017, 73, 2519–2528. [Google Scholar] [CrossRef]
- Zheng, J.; Wu, P.; Huang, Y.; Zhang, Y.; Qiu, L. Identification of Insect Cuticular Protein Genes LCP17 and SgAbd5 from Helicoverpa armigera and Evaluation Their Roles in Fenvalerate Resistance. Pestic. Biochem. Physiol. 2024, 199, 105775. [Google Scholar] [CrossRef]
- Kefi, M.; Balabanidou, V.; Sarafoglou, C.; Charamis, J.; Lycett, G.; Ranson, H.; Gouridis, G.; Vontas, J. ABCH2 Transporter Mediates Deltamethrin Uptake and Toxicity in the Malaria Vector Anopheles coluzzii. PLoS Pathog. 2023, 19, e1011226. [Google Scholar] [CrossRef]
- Kefi, M.; Charamis, J.; Balabanidou, V.; Ioannidis, P.; Ranson, H.; Ingham, V.A.; Vontas, J. Transcriptomic Analysis of Resistance and Short-Term Induction Response to Pyrethroids, in Anopheles coluzzii Legs. BMC Genom. 2021, 22, 891. [Google Scholar] [CrossRef]
- Matthews, B.J.; McBride, C.S.; DeGennaro, M.; Despo, O.; Vosshall, L.B. The Neurotranscriptome of the Aedes aegypti Mosquito. BMC Genom. 2016, 17, 32. [Google Scholar] [CrossRef]
- Dennis, E.J.; Goldman, O.V.; Vosshall, L.B. Aedes aegypti Mosquitoes Use Their Legs to Sense DEET on Contact. Curr. Biol. 2019, 29, 1551–1556.e5. [Google Scholar] [CrossRef] [PubMed]
- Sparks, J.T.; Vinyard, B.T.; Dickens, J.C. Gustatory Receptor Expression in the Labella and Tarsi of Aedes aegypti. Insect Biochem. Mol. Biol. 2013, 43, 1161–1171. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.W.; Kong, X.Q.; Wu, D. Micronanostructures of the Scales on a Mosquito’s Legs and Their Role in Weight Support. Phys. Rev. E 2007, 76, 017301. [Google Scholar] [CrossRef]
- Balabanidou, V.; Kefi, M.; Aivaliotis, M.; Koidou, V.; Girotti, J.R.; Mijailovsky, S.J.; Juárez, M.P.; Papadogiorgaki, E.; Chalepakis, G.; Kampouraki, A.; et al. Mosquitoes Cloak Their Legs to Resist Insecticides. Proc. R. Soc. B. 2019, 286, 20191091. [Google Scholar] [CrossRef]
- Lilly, D.G.; Latham, S.L.; Webb, C.E.; Doggett, S.L. Cuticle Thickening in a Pyrethroid-Resistant Strain of the Common Bed Bug, Cimex Lectularius L. (Hemiptera: Cimicidae). PLoS ONE 2016, 11, e0153302. [Google Scholar] [CrossRef]
- Saizonou, H.; Impoinvil, L.M.; Derilus, D.; Omoke, D.; Okeyo, S.; Dada, N.; Corredor, C.; Mulder, N.; Lenhart, A.; Ochomo, E.; et al. Transcriptomic Analysis of Anopheles gambiae from Benin Reveals Overexpression of Salivary and Cuticular Proteins Associated with Cross-Resistance to Pyrethroids and Organophosphates. BMC Genom. 2024, 25, 348. [Google Scholar] [CrossRef]
- Vannini, L.; Reed, T.W.; Willis, J.H. Temporal and Spatial Expression of Cuticular Proteins of Anopheles Gambiae Implicated in Insecticide Resistance or Differentiation of M/S Incipient Species. Parasites Vectors 2014, 7, 24. [Google Scholar] [CrossRef]
- Vannini, L.; Willis, J.H. Localization of RR-1 and RR-2 Cuticular Proteins within the Cuticle of Anopheles gambiae. Arthropod Struct. Dev. 2017, 46, 13–29. [Google Scholar] [CrossRef]
- Tang, P.-A.; Hu, H.-Y.; Du, W.-W.; Jian, F.-J.; Chen, E.-H. Identification of Cuticular Protein Genes and Analysis of Their Roles in Phosphine Resistance of the Rusty Grain Beetle Cryptolestes ferrugineus. Pestic. Biochem. Physiol. 2023, 194, 105491. [Google Scholar] [CrossRef]
- Huang, Y.; Guo, Q.; Sun, X.; Zhang, C.; Xu, N.; Xu, Y.; Zhou, D.; Sun, Y.; Ma, L.; Zhu, C.; et al. Culex pipiens pallens Cuticular Protein CPLCG5 Participates in Pyrethroid Resistance by Forming a Rigid Matrix. Parasites Vectors 2018, 11, 6. [Google Scholar] [CrossRef]
- He, C.; Liang, J.; Yang, J.; Xue, H.; Huang, M.; Fu, B.; Wei, X.; Liu, S.; Du, T.; Ji, Y.; et al. Over-Expression of CP9 and CP83 Increases Whitefly Cell Cuticle Thickness Leading to Imidacloprid Resistance. Int. J. Biol. Macromol. 2023, 233, 123647. [Google Scholar] [CrossRef] [PubMed]
- Zoh, M.G.; Bonneville, J.-M.; Laporte, F.; Tutagata, J.; Sadia, C.G.; Fodjo, B.K.; Mouhamadou, C.S.; McBeath, J.; Schmitt, F.; Horstmann, S.; et al. Deltamethrin and Transfluthrin Select for Distinct Transcriptomic Responses in the Malaria Vector Anopheles gambiae. Malar. J. 2023, 22, 256. [Google Scholar] [CrossRef] [PubMed]
- Chen, E.-H.; Hou, Q.-L. Identification and Expression Analysis of Cuticular Protein Genes in the Diamondback Moth, Plutella xylostella (Lepidoptera: Plutellidae). Pestic. Biochem. Physiol. 2021, 178, 104943. [Google Scholar] [CrossRef]
- Liu, B.; Tian, M.; Guo, Q.; Ma, L.; Zhou, D.; Shen, B.; Sun, Y.; Zhu, C. MiR-932 Regulates Pyrethroid Resistance in Culex pipiens pallens (Diptera: Culicidae). J. Med. Entomol. 2016, 53, 1205–1210. [Google Scholar] [CrossRef]
- Xu, Y.; Yang, X.; Sun, X.; Li, X.; Liu, Z.; Yin, Q.; Ma, L.; Zhou, D.; Sun, Y.; Shen, B.; et al. Transcription Factor FTZ-F1 Regulates Mosquito Cuticular Protein CPLCG5 Conferring Resistance to Pyrethroids in Culex pipiens pallens. Parasit. Vectors 2020, 13, 514. [Google Scholar] [CrossRef]
- Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced Stability and Intracellular Transport of dsRNA Contribute to Poor RNAi Response in Lepidopteran Insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef]
- Yoon, J.-S.; Gurusamy, D.; Palli, S.R. Accumulation of dsRNA in Endosomes Contributes to Inefficient RNA Interference in the Fall Armyworm, Spodoptera frugiperda. Insect Biochem. Mol. Biol. 2017, 90, 53–60. [Google Scholar] [CrossRef]
- Zhu, K.Y.; Palli, S.R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef]
- Papandreou, N.C.; Iconomidou, V.A.; Willis, J.H.; Hamodrakas, S.J. A Possible Structural Model of Members of the CPF Family of Cuticular Proteins Implicating Binding to Components Other than Chitin. J. Insect Physiol. 2010, 56, 1420–1426. [Google Scholar] [CrossRef]
- Li, Y.; Li, Y.; Wang, G.; Li, J.; Zhang, M.; Wu, J.; Liang, C.; Zhou, H.; Tang, J.; Zhu, G. Differential Metabolome Responses to Deltamethrin between Resistant and Susceptible Anopheles sinensis. Ecotoxicol. Environ. Saf. 2022, 237, 113553. [Google Scholar] [CrossRef]
- Rueda, L.M.; Kim, H.-C.; Chong, S.-T.; Klein, T.A.; Debboun, M. Biosurveillance and Morphological Variations of Larvae and Pupae of Common Malaria Vectors, Anopheles (Anopheles) hyrcanus Group Species in the Republic of Korea. US Army Med. Dep. J. 2017, 47–54. [Google Scholar]
- World Health Organization Standard Operating Procedure for Testing Insecticide Susceptibility of Adult Mosquitoes in WHO Tube Tests. Available online: https://www.who.int/publications/i/item/9789240043831 (accessed on 7 January 2025).
- Koella, J.C.; Lyimo, E.O. Variability in the Relationship between Weight and Wing Length of Anopheles Gambiae (Diptera: Culicidae). J. Med. Entomol. 1996, 33, 261–264. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Roberts, A.; Trapnell, C.; Donaghey, J.; Rinn, J.L.; Pachter, L. Improving RNA-Seq Expression Estimates by Correcting for Fragment Bias. Genome Biol. 2011, 12, R22. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python Framework to Work with High-Throughput Sequencing Data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- World Health Organization Standard Operating Procedure for Testing Insecticide Susceptibility of Adult Mosquitoes in WHO Bottle Bioassays. Available online: https://www.who.int/publications/i/item/9789240043770 (accessed on 7 January 2025).
Primer Sequence (5′-3′) | |
---|---|
For RT-qPCR | |
AsS7-F | AAGTTCTCCGGCAAGCATGT |
AsS7-R | GGTCGCTTCTGCTTGTTGG |
AsCPF1-F | CCCATGATGGAACCGTCTCG |
AsCPF1-R | GTGATGCGGGTGTCCGACTT |
AsCPF1 ds-F | CATTCAAGTTCGTCGTCTTCCTGG |
AsCPF1 ds-R | CCTGCGAGATGGTGCTGTAGCT |
AsCPF3-F | CGTCTGTCAGCAAGTCCGATGT |
AsCPF3-R | CGGCGTAAGCGTGATGAGC |
AsCPR5-F | GGAGATGTTGTCCAGGGATCGTA |
AsCPR5-R | GTTGTGCGGGTCAGCAGTGTAG |
AsCPR58-F | GAGCCTGTCGTACACGTTGCC |
AsCPR58-R | CATAGTATCCATCGTGGTAGTCA |
For AsCPF1 dsRNA synthesis | |
T7 EGFP ds-F GGATCCTAATACGACTCACTATAGGTGCCCGAAGGTTATGT | |
T7 EGFP ds-R GGATCCTAATACGACTCACTATAGGTGCCGAGTGTAATCCC | |
T7 AsCPF1 ds-F GGATCCTAATACGACTCACTATAGGACACCCGCATCACCAACGAG | |
T7 AsCPF1 ds-R GGATCCTAATACGACTCACTATAGGGGCATAATGGGCATGAGCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, L.; Gu, L.; Tu, L.; Deng, S.-J.; Hu, J.-P.; Zhang, Z.-Y.; Li, J.-L.; Zhang, M.-C.; Cao, J.; Tang, J.-X.; et al. A Leg Cuticle Protein Enhances the Resistance of Anopheles sinensis Mosquitoes to Deltamethrin. Int. J. Mol. Sci. 2025, 26, 2182. https://doi.org/10.3390/ijms26052182
Li L, Gu L, Tu L, Deng S-J, Hu J-P, Zhang Z-Y, Li J-L, Zhang M-C, Cao J, Tang J-X, et al. A Leg Cuticle Protein Enhances the Resistance of Anopheles sinensis Mosquitoes to Deltamethrin. International Journal of Molecular Sciences. 2025; 26(5):2182. https://doi.org/10.3390/ijms26052182
Chicago/Turabian StyleLi, Lin, Ling Gu, Lei Tu, Si-Jia Deng, Ju-Ping Hu, Zi-Ye Zhang, Ju-Lin Li, Mei-Chun Zhang, Jun Cao, Jian-Xia Tang, and et al. 2025. "A Leg Cuticle Protein Enhances the Resistance of Anopheles sinensis Mosquitoes to Deltamethrin" International Journal of Molecular Sciences 26, no. 5: 2182. https://doi.org/10.3390/ijms26052182
APA StyleLi, L., Gu, L., Tu, L., Deng, S.-J., Hu, J.-P., Zhang, Z.-Y., Li, J.-L., Zhang, M.-C., Cao, J., Tang, J.-X., & Zhu, G.-D. (2025). A Leg Cuticle Protein Enhances the Resistance of Anopheles sinensis Mosquitoes to Deltamethrin. International Journal of Molecular Sciences, 26(5), 2182. https://doi.org/10.3390/ijms26052182