The Therapeutic Potential of Gut-Microbiota-Derived Metabolite 4-Phenylbutyric Acid in Escherichia coli-Induced Colitis
Abstract
1. Introduction
2. Results
2.1. Healthy Calves and Diarrheal Calves Exhibited Distinct Differences in Gut Microbiota
2.2. Differences in Fecal Metabolites Between Diarrheal Calves and Healthy Calves
2.3. Oral Administration of 4-PBA Alleviated Inflammatory Damage Caused by E. coli in Mice
2.4. Transplanting Fecal Microbiota from Mice Treated with 4-PBA Can Alleviate Inflammatory Damage Caused by E. coli
3. Discussion
4. Materials and Methods
4.1. Bacteria, Samples, and Experimental Animals
4.2. Mouse Infection and Sample Collection
4.3. DNA Extraction and 16s rRNA Genome Sequencing
4.4. Sequencing Data Analysis
4.5. Untargeted Metabolomics and Analysis
4.6. Histopathological Analysis
4.7. Slice Immunofluorescence
4.8. Western Blotting
4.9. Extraction of Total RNA and Real-Time Quantitative Reverse Transcription PCR (RT-qPCR)
4.10. Data Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cho, Y.-I.; Han, J.-I.; Wang, C.; Cooper, V.; Schwartz, K.; Engelken, T.; Yoon, K.-J. Case–control study of microbiological etiology associated with calf diarrhea. Vet. Microbiol. 2013, 166, 375–385. [Google Scholar] [CrossRef] [PubMed]
- Pinior, B.; Firth, C.L.; Richter, V.; Lebl, K.; Trauffler, M.; Dzieciol, M.; Hutter, S.E.; Burgstaller, J.; Obritzhauser, W.; Winter, P. A systematic review of financial and economic assessments of bovine viral diarrhea virus (BVDV) prevention and mitigation activities worldwide. Prev. Vet. Med. 2017, 137, 77–92. [Google Scholar] [CrossRef] [PubMed]
- Sood, N.K.; Brar, A.P.S.; Sood, R. A brief review on the global prevalence and etiopathology of Bovine Calf Diarrhoea. Indian J. Vet. Med. Vol. 2022, 42, 1–8. [Google Scholar]
- Ajiboye, R.M.; Solberg, O.D.; Lee, B.M.; Raphael, E.; DebRoy, C.; Riley, L.W. Global spread of mobile antimicrobial drug resistance determinants in human and animal Escherichia coli and Salmonella strains causing community-acquired infections. Clin. Infect. Dis. 2009, 49, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Palmela, C.; Chevarin, C.; Xu, Z.; Torres, J.; Sevrin, G.; Hirten, R.; Barnich, N.; Ng, S.C.; Colombel, J.-F. Adherent-invasive Escherichia coli in inflammatory bowel disease. Gut 2018, 67, 574–587. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Yuan, Y.; Zhang, S.; Guo, C.; Li, X.; Li, G.; Xiong, W.; Zeng, Z. Intestinal flora and disease mutually shape the regional immune system in the intestinal tract. Front. Immunol. 2020, 11, 575. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, M.; Nakayama, J. Development of the gut microbiota in infancy and its impact on health in later life. Allergol. Int. 2017, 66, 515–522. [Google Scholar] [CrossRef] [PubMed]
- Vogt, S.L.; Finlay, B.B. Gut microbiota-mediated protection against diarrheal infections. J. Travel. Med. 2017, 24, S39–S43. [Google Scholar] [CrossRef]
- Antunes, L.C.; McDonald, J.A.; Schroeter, K.; Carlucci, C.; Ferreira, R.B.; Wang, M.; Yurist-Doutsch, S.; Hira, G.; Jacobson, K.; Davies, J.; et al. Antivirulence activity of the human gut metabolome. mBio 2014, 5, e01183-01114. [Google Scholar] [CrossRef]
- McKenney, P.T.; Pamer, E.G. From Hype to Hope: The Gut Microbiota in Enteric Infectious Disease. Cell 2015, 163, 1326–1332. [Google Scholar] [CrossRef]
- Yang, J.; Wu, Y.; Si, N.; Liu, S.; Jiang, K.; Li, X. Isolation, identification and biological characteristics of Escherichia coli from diarrhea of calves in a dairy farm in Kunming. Chin. J. Vet. Sci. 2024, 44, 465–471. [Google Scholar]
- Darby, E.M.; Trampari, E.; Siasat, P.; Gaya, M.S.; Alav, I.; Webber, M.A.; Blair, J.M. Molecular mechanisms of antibiotic resistance revisited. Nat. Rev. Microbiol. 2023, 21, 280–295. [Google Scholar] [CrossRef] [PubMed]
- Urban-Chmiel, R.; Marek, A.; Stępień-Pyśniak, D.; Wieczorek, K.; Dec, M.; Nowaczek, A.; Osek, J. Antibiotic resistance in bacteria—A review. Antibiotics 2022, 11, 1079. [Google Scholar] [CrossRef] [PubMed]
- Reijnders, D.; Goossens, G.H.; Hermes, G.D.; Neis, E.P.; van der Beek, C.M.; Most, J.; Holst, J.J.; Lenaerts, K.; Kootte, R.S.; Nieuwdorp, M. Effects of gut microbiota manipulation by antibiotics on host metabolism in obese humans: A randomized double-blind placebo-controlled trial. Cell Metab. 2016, 24, 63–74. [Google Scholar] [CrossRef]
- He, B.; Moreau, R. Lipid-regulating properties of butyric acid and 4-phenylbutyric acid: Molecular mechanisms and therapeutic applications. Pharmacol. Res. 2019, 144, 116–131. [Google Scholar] [CrossRef] [PubMed]
- Maestri, N.E.; Brusilow, S.W.; Clissold, D.B.; Bassett, S.S. Long-term treatment of girls with ornithine transcarbamylase deficiency. N. Engl. J. Med. 1996, 335, 855–859. [Google Scholar] [CrossRef]
- Mercuri, E.; Bertini, E.; Messina, S.; Pelliccioni, M.; D’Amico, A.; Colitto, F.; Mirabella, M.; Tiziano, F.D.; Vitali, T.; Angelozzi, C.; et al. Pilot trial of phenylbutyrate in spinal muscular atrophy. Neuromuscul. Disord. 2004, 14, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Collins, A.F.; Pearson, H.A.; Giardina, P.; McDonagh, K.T.; Brusilow, S.W.; Dover, G.J. Oral sodium phenylbutyrate therapy in homozygous beta thalassemia: A clinical trial. Blood 1995, 85, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Camacho, L.H.; Olson, J.; Tong, W.P.; Young, C.W.; Spriggs, D.R.; Malkin, M.G. Phase I dose escalation clinical trial of phenylbutyrate sodium administered twice daily to patients with advanced solid tumors. Investig. New Drugs 2007, 25, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.; Ghosh, A.; Jana, A.; Liu, X.; Brahmachari, S.; Gendelman, H.E.; Pahan, K. Sodium phenylbutyrate controls neuroinflammatory and antioxidant activities and protects dopaminergic neurons in mouse models of Parkinson’s disease. PLoS ONE 2012, 7, e38113. [Google Scholar] [CrossRef] [PubMed]
- Ono, K.; Ikemoto, M.; Kawarabayashi, T.; Ikeda, M.; Nishinakagawa, T.; Hosokawa, M.; Shoji, M.; Takahashi, M.; Nakashima, M. A chemical chaperone, sodium 4-phenylbutyric acid, attenuates the pathogenic potency in human alpha-synuclein A30P + A53T transgenic mice. Park. Relat. Disord. 2009, 15, 649–654. [Google Scholar] [CrossRef]
- Yuan, S.; Fang, Y.; Tang, M.; Hu, Z.; Rao, C.; Chen, J.; Xia, Y.; Zhang, M.; Yan, J.; Tang, B. Tauroursodeoxycholic acid prevents Burkholderia pseudomallei-induced endoplasmic reticulum stress and is protective during melioidosis in mice. BMC Microbiol. 2021, 21, 137. [Google Scholar] [CrossRef]
- Gunasekera, A.; Ebright, Y.W.; Ebright, R.H. DNA sequence determinants for binding of the Escherichia coli catabolite gene activator protein. J. Biol. Chem. 1992, 267, 14713–14720. [Google Scholar] [CrossRef]
- Plumbridge, J. Expression of ptsG, the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose. Mol. Microbiol. 1998, 29, 1053–1063. [Google Scholar] [CrossRef]
- Alipour, M.J.; Jalanka, J.; Pessa-Morikawa, T.; Kokkonen, T.; Satokari, R.; Hynönen, U.; Iivanainen, A.; Niku, M. The composition of the perinatal intestinal microbiota in cattle. Sci. Rep. 2018, 8, 10437. [Google Scholar] [CrossRef]
- Kuo, W.-T.; Zuo, L.; Odenwald, M.A.; Madha, S.; Singh, G.; Gurniak, C.B.; Abraham, C.; Turner, J.R. The tight junction protein ZO-1 is dispensable for barrier function but critical for effective mucosal repair. Gastroenterology 2021, 161, 1924–1939. [Google Scholar] [CrossRef] [PubMed]
- Yarovinsky, F.; Zhang, D.; Andersen, J.F.; Bannenberg, G.L.; Serhan, C.N.; Hayden, M.S.; Hieny, S.; Sutterwala, F.S.; Flavell, R.A.; Ghosh, S. TLR11 activation of dendritic cells by a protozoan profilin-like protein. Science 2005, 308, 1626–1629. [Google Scholar] [CrossRef] [PubMed]
- Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- Kotlowski, R.; Bernstein, C.N.; Sepehri, S.; Krause, D.O. High prevalence of Escherichia coli belonging to the B2+ D phylogenetic group in inflammatory bowel disease. Gut 2007, 56, 669–675. [Google Scholar] [CrossRef] [PubMed]
- Thielman, N.M.; Guerrant, R.L. Acute infectious diarrhea. N. Engl. J. Med. 2004, 350, 38–47. [Google Scholar] [CrossRef]
- He, Z.; Ma, Y.; Yang, S.; Zhang, S.; Liu, S.; Xiao, J.; Wang, Y.; Wang, W.; Yang, H.; Li, S. Gut microbiota-derived ursodeoxycholic acid from neonatal dairy calves improves intestinal homeostasis and colitis to attenuate extended-spectrum β-lactamase-producing enteroaggregative Escherichia coli infection. Microbiome 2022, 10, 79. [Google Scholar] [CrossRef] [PubMed]
- Akazawa, Y.; Morisaki, T.; Fukuda, H.; Norimatsu, K.; Shiota, J.; Hashiguchi, K.; Tabuchi, M.; Kitayama, M.; Matsushima, K.; Yamaguchi, N. Significance of serum palmitoleic acid levels in inflammatory bowel disease. Sci. Rep. 2021, 11, 16260. [Google Scholar] [CrossRef] [PubMed]
- de Souza, C.O.; Valenzuela, C.A.; Baker, E.J.; Miles, E.A.; Rosa Neto, J.C.; Calder, P.C. Palmitoleic acid has stronger anti-inflammatory potential in human endothelial cells compared to oleic and palmitic acids. Mol. Nutr. Food Res. 2018, 62, 1800322. [Google Scholar] [CrossRef]
- Rooks, M.G.; Garrett, W.S. Gut microbiota, metabolites and host immunity. Nat. Rev. Immunol. 2016, 16, 341–352. [Google Scholar] [CrossRef] [PubMed]
- Sekirov, I.; Russell, S.L.; Antunes, L.C.M.; Finlay, B.B. Gut microbiota in health and disease. Physiol. Rev. 2010, 90, 859–904. [Google Scholar] [CrossRef]
- Wexler, H.M. Bacteroides: The good, the bad, and the nitty-gritty. Clin. Microbiol. Rev. 2007, 20, 593–621. [Google Scholar] [CrossRef]
- Miyauchi, E.; Shimokawa, C.; Steimle, A.; Desai, M.S.; Ohno, H. The impact of the gut microbiome on extra-intestinal autoimmune diseases. Nat. Rev. Immunol. 2023, 23, 9–23. [Google Scholar] [CrossRef] [PubMed]
- Gomez, D.; Arroyo, L.; Costa, M.; Viel, L.; Weese, J. Characterization of the fecal bacterial microbiota of healthy and diarrheic dairy calves. J. Vet. Intern. Med. 2017, 31, 928–939. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yang, Y.; Su, J.; Zheng, X.; Wang, C.; Chen, S.; Liu, J.; Lv, Y.; Fan, S.; Zhao, A.; et al. Age-related compositional changes and correlations of gut microbiome, serum metabolome, and immune factor in rats. Geroscience 2021, 43, 709–725. [Google Scholar] [CrossRef]
- Oikonomou, G.; Teixeira, A.G.; Foditsch, C.; Bicalho, M.L.; Machado, V.S.; Bicalho, R.C. Fecal microbial diversity in pre-weaned dairy calves as described by pyrosequencing of metagenomic 16S rDNA. Associations of Faecalibacterium species with health and growth. PLoS ONE 2013, 8, e63157. [Google Scholar] [CrossRef] [PubMed]
- Imdad, A.; Pandit, N.G.; Zaman, M.; Minkoff, N.Z.; Tanner-Smith, E.E.; Gomez-Duarte, O.G.; Acra, S.; Nicholson, M.R. Fecal transplantation for treatment of inflammatory bowel disease. Cochrane Database Syst. Rev. 2023, 11, CD012774. [Google Scholar]
- Fu, X.; Liu, Z.; Zhu, C.; Mou, H.; Kong, Q. Nondigestible carbohydrates, butyrate, and butyrate-producing bacteria. Crit. Rev. Food Sci. Nutr. 2019, 59, S130–S152. [Google Scholar] [CrossRef]
- Chen, W.; Zhang, S.; Wu, J.; Ye, T.; Wang, S.; Wang, P.; Xing, D. Butyrate-producing bacteria and the gut-heart axis in atherosclerosis. Clin. Chim. Acta 2020, 507, 236–241. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.I.; Ko, D.-H.; Shin, N.; Pyo, C.W.; Choi, S.-Y. Endoplasmic reticulum-associated degradation potentiates the infectivity of influenza A virus by regulating the host redox state. Free Radic. Biol. Med. 2019, 135, 293–305. [Google Scholar] [CrossRef]
- Han, Y.; Wang, C.; Bai, C.; Diao, E.; Yuan, B.; Lu, K.; Dong, X.; Zhang, R.; Han, B.; Liu, H. Bovine parainfluenza virus type 3 infections induce ER stress-mediated autophagy to facilitate virus replication. Vet. Microbiol. 2024, 292, 110051. [Google Scholar] [CrossRef] [PubMed]
- Jeon, J.-H.; Im, S.; Kim, H.S.; Lee, D.; Jeong, K.; Ku, J.-M.; Nam, T.-G. Chemical chaperones to inhibit endoplasmic reticulum stress: Implications in diseases. Drug Des. Devel. Ther. 2022, 4385–4397. [Google Scholar] [CrossRef]
- Yin, S.; Li, L.; Tao, Y.; Yu, J.; Wei, S.; Liu, M.; Li, J. The inhibitory effect of artesunate on excessive endoplasmic reticulum stress alleviates experimental colitis in mice. Front. Pharmacol. 2021, 12, 629798. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Whon, T.W.; Sung, H.; Jeong, Y.-S.; Jung, E.S.; Shin, N.-R.; Hyun, D.-W.; Kim, P.S.; Lee, J.-Y.; Lee, C.H. Longitudinal evaluation of fecal microbiota transplantation for ameliorating calf diarrhea and improving growth performance. Nat. Commun. 2021, 12, 161. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Kaufman, R.J. From endoplasmic-reticulum stress to the inflammatory response. Nature 2008, 454, 455–462. [Google Scholar] [CrossRef]
- Baniyash, M. TCR ζ-chain downregulation: Curtailing an excessive inflammatory immune response. Nat. Rev. Immunol. 2004, 4, 675–687. [Google Scholar] [CrossRef] [PubMed]
- Nataro, J.P.; Kaper, J.B. Diarrheagenic escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed]
- Ehses, J.; Meier, D.; Wueest, S.; Rytka, J.; Boller, S.; Wielinga, P.; Schraenen, A.; Lemaire, K.; Debray, S.; Van Lommel, L. Toll-like receptor 2-deficient mice are protected from insulin resistance and beta cell dysfunction induced by a high-fat diet. Diabetologia 2010, 53, 1795–1806. [Google Scholar] [CrossRef] [PubMed]
- Marciniak, S.J.; Chambers, J.E.; Ron, D. Pharmacological targeting of endoplasmic reticulum stress in disease. Nat. Rev. Drug Discov. 2022, 21, 115–140. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Shen, H.; Li, X.; Wang, H. Endoplasmic reticulum stress in innate immune cells-a significant contribution to non-alcoholic fatty liver disease. Front. Immunol. 2022, 13, 951406. [Google Scholar] [CrossRef] [PubMed]
- Bell, E. TLR4 signalling. Nat. Rev. Immunol. 2008, 8, 241. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Wu, Y.; Wu, A.; Xiao, B.; Liu, X.; Zhang, Q.; Feng, Y.; Yuan, Z.; Yi, J. Endoplasmic reticulum stress promotes oxidative stress, inflammation, and apoptosis: A novel mechanism of citrinin-induced renal injury and dysfunction. Ecotoxicol. Environ. Saf. 2024, 284, 116946. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Xu, F.; Liu, H.; Shen, Y.; Zhang, J.; Hu, L.; Zhu, L. Suppressing endoplasmic reticulum stress alleviates lps-induced acute lung injury via inhibiting inflammation and ferroptosis. Inflammation 2024, 47, 1067–1082. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Liu, S.; Zhao, Q.; Li, X.; Jiang, K. Gut microbiota-related metabolite alpha-linolenic acid mitigates intestinal inflammation induced by oral infection with Toxoplasma gondii. Microbiome 2023, 11, 273. [Google Scholar] [CrossRef]
- Routy, B.; Le Chatelier, E.; Derosa, L.; Duong, C.P.; Alou, M.T.; Daillère, R.; Fluckiger, A.; Messaoudene, M.; Rauber, C.; Roberti, M.P. Gut microbiome influences efficacy of PD-1–based immunotherapy against epithelial tumors. Science 2018, 359, 91–97. [Google Scholar] [CrossRef]
- Ono, K.; Nimura, S.; Hideshima, Y.; Nabeshima, K.; Nakashima, M. Orally administered sodium 4-phenylbutyrate suppresses the development of dextran sulfate sodium-induced colitis in mice. Exp. Ther. Med. 2017, 14, 5485–5490. [Google Scholar] [CrossRef]
- Zhang, Q.; Hu, J.; Feng, J.-W.; Hu, X.-T.; Wang, T.; Gong, W.-X.; Huang, K.; Guo, Y.-X.; Zou, Z.; Lin, X. Influenza infection elicits an expansion of gut population of endogenous Bifidobacterium animalis which protects mice against infection. Genome Biol. 2020, 21, 99. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence | Product Length/bp |
---|---|---|
β-actin | Forward: CATCGTCCACCGCAAAT | 103 |
Reverse: GCCATGCCAATCTCATCTC | ||
IL-1 | Forward: TGCCACCTTTTGACAGTGATG | 138 |
Reverse:TGATGTGCTGCTGCGAGATT | ||
IL-6 | Forward: GCCTTCACTCCATTCGCTGTCTC | 144 |
Reverse: AAGTAGTCTGCCTGGGGTGGTG | ||
TNF-α | Forward: GCTGACGGGCTTTACCTCATCTAC | 145 |
Reverse: GGCTCTTGATGGCAGACAGGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.; Hu, Y.; Wu, Y.; Xu, J.; Zhao, Y.; Yang, J.; Li, X. The Therapeutic Potential of Gut-Microbiota-Derived Metabolite 4-Phenylbutyric Acid in Escherichia coli-Induced Colitis. Int. J. Mol. Sci. 2025, 26, 1974. https://doi.org/10.3390/ijms26051974
Wang K, Hu Y, Wu Y, Xu J, Zhao Y, Yang J, Li X. The Therapeutic Potential of Gut-Microbiota-Derived Metabolite 4-Phenylbutyric Acid in Escherichia coli-Induced Colitis. International Journal of Molecular Sciences. 2025; 26(5):1974. https://doi.org/10.3390/ijms26051974
Chicago/Turabian StyleWang, Kui, Yuan Hu, Yu Wu, Jie Xu, Yiyi Zhao, Jing Yang, and Xiaobing Li. 2025. "The Therapeutic Potential of Gut-Microbiota-Derived Metabolite 4-Phenylbutyric Acid in Escherichia coli-Induced Colitis" International Journal of Molecular Sciences 26, no. 5: 1974. https://doi.org/10.3390/ijms26051974
APA StyleWang, K., Hu, Y., Wu, Y., Xu, J., Zhao, Y., Yang, J., & Li, X. (2025). The Therapeutic Potential of Gut-Microbiota-Derived Metabolite 4-Phenylbutyric Acid in Escherichia coli-Induced Colitis. International Journal of Molecular Sciences, 26(5), 1974. https://doi.org/10.3390/ijms26051974