Molecular Biological Comparison of Pulp Stem Cells from Supernumerary Teeth, Permanent Teeth, and Deciduous Teeth for Endodontic Regeneration
Abstract
1. Introduction
2. Results
2.1. Cell Morphology and Immunophenotype
2.2. Cell Growth and Clonogenic Population
2.3. Cell Migration
2.4. Odontogenic Differentiation Potential
2.5. Cell Vitality After Two Years of Storage
2.6. Cell Senescence and Stemness After Two Years of Storage
2.7. Transcriptomic Characteristics
2.8. Diversity of Signaling Pathways Enriched by DEGs
3. Discussion
4. Materials and Methods
4.1. Source of SNTSCs, DPSCs, and SHED
4.2. Cultivation of SNTSCs, DPSCs, and SHED
4.3. Characterization of SNTSCs, DPSCs, and SHED
4.4. Cell Proliferation Assays
4.5. Assessment of Migration Ability
4.6. Alizarin Red Staining
4.7. Alkaline Phosphatase (ALP) Activity Assay and ALP Staining
4.8. Western Blot Analysis
4.9. Quantitative Real-Time PCR (qRT-PCR)
4.10. Cell Apoptosis Assay
4.11. SA-β-Gal Staining
4.12. RNA Sequencing and Bioinformatic Analyses
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
SNTSCs | Supernumerary tooth-derived pulp stem cells |
MSCs | Mesenchymal stem cells |
DPSCs | Dental pulp stem cells |
SHED | Stem cells from human exfoliated deciduous teeth |
DMSCs | Dental-derived mesenchymal stem cells |
CFU | Colony-forming unit |
CCK-8 | Cell counting kit-8 |
ALP | Alkaline phosphatase |
DSPP | Dentin siolophosphoprotein |
DMP-1 | Dentin matrix protein 1 |
RUNX2 | Runt-related transcription factor 2 |
LPS | Lipopolysaccharide |
SA-β-gal | Senescence-associated β-galactosidase |
OCT4 | Octamer-binding transcription factor 4 |
SOX2 | SRY-box transcription factor 2 |
KLF4 | Krüppel-like transcription factor 4 |
NANOG | Nanog homeobox |
RBL1 | Retinoblastoma-like 1 |
BCL-2 | B-cell lymphoma-2 |
PCA | Principal component analyses |
DEGs | Differential expression genes |
GSEA | Gene set enrichment analysis |
GO | Gene ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
References
- Yamada, Y.; Nakamura-Yamada, S.; Konoki, R.; Baba, S. Promising advances in clinical trials of dental tissue-derived cell-based regenerative medicine. Stem Cell Res. Ther. 2020, 11, 175. [Google Scholar] [CrossRef]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [PubMed]
- Miura, M.; Gronthos, S.; Zhao, M.; Lu, B.; Fisher, L.W.; Robey, P.G.; Shi, S. SHED: Stem cells from human exfoliated deciduous teeth. Proc. Natl. Acad. Sci. USA 2003, 100, 5807–5812. [Google Scholar] [CrossRef]
- Shi, X.; Mao, J.; Liu, Y. Pulp stem cells derived from human permanent and deciduous teeth: Biological characteristics and therapeutic applications. Stem Cells Transl. Med. 2020, 9, 445–464. [Google Scholar] [CrossRef]
- Fardi, A.; Kondylidou-Sidira, A.; Bachour, Z.; Parisis, N.; Tsirlis, A. Incidence of impacted and supernumerary teeth-a radiographic study in a North Greek population. Med. Oral Patol. Oral Cir. Bucal. 2011, 16, e56–e61. [Google Scholar] [CrossRef]
- Campoy, M.D.; Gonzalez-Allo, A.; Moreira, J.; Ustrell, J.; Pinho, T. Dental anomalies in a Portuguese population. Int. Orthod. 2013, 11, 210–220. [Google Scholar] [CrossRef] [PubMed]
- Cammarata-Scalisi, F.; Avendano, A.; Callea, M. Main genetic entities associated with supernumerary teeth. Arch. Argent. Pediatr. 2018, 116, 437–444. [Google Scholar] [PubMed]
- Mallineni, S.K.; Aldhuwayhi, S.; Deeban, Y.; Almutairi, K.S.; Alhabrdi, S.N.; Almidaj, M.A.; Alrumi, B.A.; Assalman, A.S.; Joseph, A.M.; Thakare, A.A.; et al. Prevalence, Occurrence, and Characteristics of Supernumerary Teeth Among the Saudi Arabian Population Using Panoramic Radiographs. Diagnostics 2024, 14, 2542. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Que, G.; Yang, X.; Yan, S.; Luo, S. Prevalence, clinical characteristics, and 3-dimensional radiographic analysis of supernumerary teeth in Guangzhou, China: A retrospective study. BMC Oral Health 2023, 23, 351. [Google Scholar] [CrossRef] [PubMed]
- Sato, M.; Toriumi, T.; Watanabe, N.; Watanabe, E.; Akita, D.; Mashimo, T.; Akiyama, Y.; Isokawa, K.; Shirakawa, T.; Honda, M.J. Characterization of mesenchymal progenitor cells in crown and root pulp from human mesiodentes. Oral Dis. 2015, 21, e86–e97. [Google Scholar] [CrossRef]
- Pippi, R. Odontomas and supernumerary teeth: Is there a common origin? Int. J. Med. Sci. 2014, 11, 1282–1297. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Gong, X.; Xu, X.; Wang, X.; Sun, Y. Tooth number abnormality: From bench to bedside. Int. J. Oral Sci. 2023, 15, 5. [Google Scholar] [CrossRef]
- Wang, X.P.; Fan, J. Molecular genetics of supernumerary tooth formation. Genesis 2011, 49, 261–277. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Cai, W.; Jiang, B.; Xu, L.; Liu, S.; Zhao, S. A novel mutation of adenomatous polyposis coli (APC) gene results in the formation of supernumerary teeth. J. Cell. Mol. Med. 2018, 22, 152–162. [Google Scholar] [CrossRef]
- Panyarat, C.; Nakornchai, S.; Chintakanon, K.; Leelaadisorn, N.; Intachai, W.; Olsen, B.; Tongsima, S.; Adisornkanj, P.; Ngamphiw, C.; Cox, T.C.; et al. Rare Genetic Variants in Human APC Are Implicated in Mesiodens and Isolated Supernumerary Teeth. Int. J. Mol. Sci. 2023, 24, 4225. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Yu, F.; Liu, J.; Cai, W.; Zhao, Y.; Zhao, S.; Liu, S. The epidemiology of supernumerary teeth and the associated molecular mechanism. Organogenesis 2017, 13, 71–82. [Google Scholar] [CrossRef] [PubMed]
- Juuri, E.; Balic, A. The Biology Underlying Abnormalities of Tooth Number in Humans. J. Dent. Res. 2017, 96, 1248–1256. [Google Scholar] [CrossRef]
- Huang, A.H.; Chen, Y.K.; Lin, L.M.; Shieh, T.Y.; Chan, A.W. Isolation and characterization of dental pulp stem cells from a supernumerary tooth. J. Oral Pathol. Med. 2008, 37, 571–574. [Google Scholar] [CrossRef] [PubMed]
- Guerrero-Jimenez, M.; Nic-Can, G.I.; Castro-Linares, N.; Aguilar-Ayala, F.J.; Canul-Chan, M.; Rojas-Herrera, R.A.; Penaloza-Cuevas, R.; Rodas-Junco, B.A. In vitro histomorphometric comparison of dental pulp tissue in different teeth. PeerJ 2019, 7, e8212. [Google Scholar] [CrossRef]
- Ning, J.; Zhang, L.; Xie, H.; Chai, L.; Yao, J. Decoding the multifaceted signatures and transcriptomic characteristics of stem cells derived from apical papilla and dental pulp of human supernumerary teeth. Cell Biol. Int. 2023, 47, 1976–1986. [Google Scholar] [CrossRef] [PubMed]
- Shoi, K.; Aoki, K.; Ohya, K.; Takagi, Y.; Shimokawa, H. Characterization of pulp and follicle stem cells from impacted supernumerary maxillary incisors. Pediatr. Dent. 2014, 36, 79–84. [Google Scholar] [PubMed]
- Lee, S.; An, S.; Kang, T.H.; Kim, K.H.; Chang, N.H.; Kang, S.; Kwak, C.K.; Park, H.S. Comparison of mesenchymal-like stem/progenitor cells derived from supernumerary teeth with stem cells from human exfoliated deciduous teeth. Regen. Med. 2011, 6, 689–699. [Google Scholar]
- Lu, X.; Liu, S.F.; Wang, H.H.; Yu, F.; Liu, J.J.; Zhao, Y.M.; Zhao, S.L. A biological study of supernumerary teeth derived dental pulp stem cells based on RNA-seq analysis. Int. Endod. J. 2019, 52, 819–828. [Google Scholar] [PubMed]
- Shi, S.; Bartold, P.M.; Miura, M.; Seo, B.M.; Robey, P.G.; Gronthos, S. The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod. Craniofac. Res. 2005, 8, 191–199. [Google Scholar]
- Shi, S.; Robey, P.G.; Gronthos, S. Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis. Bone 2001, 29, 532–539. [Google Scholar] [PubMed]
- Nuti, N.; Corallo, C.; Chan, B.M.; Ferrari, M.; Gerami-Naini, B. Multipotent Differentiation of Human Dental Pulp Stem Cells: A Literature Review. Stem Cell Rev. Rep. 2016, 12, 511–523. [Google Scholar]
- Ching, H.S.; Luddin, N.; Rahman, I.A.; Ponnuraj, K.T. Expression of Odontogenic and Osteogenic Markers in DPSCs and SHED: A Review. Curr. Stem Cell Res. Ther. 2017, 12, 71–79. [Google Scholar] [PubMed]
- Winning, L.; El Karim, I.A.; Lundy, F.T. A Comparative Analysis of the Osteogenic Potential of Dental Mesenchymal Stem Cells. Stem Cells Dev. 2019, 28, 1050–1058. [Google Scholar] [PubMed]
- Sabbagh, J.; Ghassibe-Sabbagh, M.; Fayyad-Kazan, M.; Al-Nemer, F.; Fahed, J.C.; Berberi, A.; Badran, B. Differences in osteogenic and odontogenic differentiation potential of DPSCs and SHED. J. Dent. 2020, 101, 103413. [Google Scholar] [PubMed]
- Ren, H.; Sang, Y.; Zhang, F.; Liu, Z.; Qi, N.; Chen, Y. Comparative Analysis of Human Mesenchymal Stem Cells from Umbilical Cord, Dental Pulp, and Menstrual Blood as Sources for Cell Therapy. Stem Cells Int. 2016, 2016, 3516574. [Google Scholar] [PubMed]
- Huang, C.E.; Hu, F.W.; Yu, C.H.; Tsai, L.L.; Lee, T.H.; Chou, M.Y.; Yu, C.C. Concurrent expression of Oct4 and Nanog maintains mesenchymal stem-like property of human dental pulp cells. Int. J. Mol. Sci. 2014, 15, 18623–18639. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Dong, L.; Chen, Y.; Cai, W.; Yang, G.; Wang, Y. Epithelial differentiation of gingival mesenchymal stem cells enhances re-epithelialization for full-thickness cutaneous wound healing. Stem Cell Res. Ther. 2024, 15, 455. [Google Scholar] [CrossRef]
- Yoon, H.S.; Chen, X.; Yang, V.W. Kruppel-like factor 4 mediates p53-dependent G1/S cell cycle arrest in response to DNA damage. J. Biol. Chem. 2003, 278, 2101–2105. [Google Scholar] [CrossRef]
- Wirt, S.E.; Sage, J. p107 in the public eye: An Rb understudy and more. Cell Div. 2010, 5, 9. [Google Scholar] [CrossRef] [PubMed]
- Barone, L.; Cucchiara, M.; Palano, M.T.; Bassani, B.; Gallazzi, M.; Rossi, F.; Raspanti, M.; Zecca, P.A.; De Antoni, G.; Pagiatakis, C.; et al. Dental pulp mesenchymal stem cell (DPSCs)-derived soluble factors, produced under hypoxic conditions, support angiogenesis via endothelial cell activation and generation of M2-like macrophages. J. Biomed. Sci. 2024, 31, 99. [Google Scholar] [CrossRef] [PubMed]
- Lertruangpanya, K.; Roytrakul, S.; Surarit, R.; Horsophonphong, S. Comparative proteomic analysis of dental pulp from supernumerary and normal permanent teeth. Clin. Oral Investig. 2024, 28, 321. [Google Scholar] [CrossRef]
- Makino, Y.; Yamaza, H.; Akiyama, K.; Ma, L.; Hoshino, Y.; Nonaka, K.; Terada, Y.; Kukita, T.; Shi, S.; Yamaza, T. Immune therapeutic potential of stem cells from human supernumerary teeth. J. Dent. Res. 2013, 92, 609–615. [Google Scholar] [CrossRef] [PubMed]
- Fei, Y.; Ling, Z.; Tong, Q.; Wang, J. Apoptotic Extracellular Vesicles from Supernumerary Tooth-Derived Pulp Stem Cells Transfer COL1A1 to Promote Angiogenesis via PI3K/Akt/VEGF Pathway. Int. J. Nanomed. 2024, 19, 6811–6828. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Mu, Q.; Ku, W.; Zheng, Y.; Yi, P.; Lin, L.; Li, P.; Wang, B.; Wu, J.; Yu, D.; et al. Functional extracellular vesicles from SHEDs combined with gelatin methacryloyl promote the odontogenic differentiation of DPSCs for pulp regeneration. J. Nanobiotechnol. 2024, 22, 265. [Google Scholar] [CrossRef] [PubMed]
Accession No. | Forward Primer | Reverse Primer | |
---|---|---|---|
OCT4 | NM_002701 | GTGGAGAGCAACTCCGATG | TGCTCCAGCTTCTCCTTCTC |
SOX2 | NM_003106 | GACTTCACATGTCCCAGCACTA | CTCTTTTGCACCCCTCCCATT |
KLF4 | NM_004235 | CCATCTTTCTCCACGTTCG | AGTCGCTTCATGTGGGAG |
NANOG | NM_024865 | ATGCCTCACACGGAGACTGT | AGGGCTGTCCTGAATAAGCA |
P16 | NM_000077 | CCCCGATTGAAAGAACCAGAGAG | TACGGTAGTGGGGGAAGGCATA |
P21 | NM_001374512 | GAGGCCGGGATGAGTTGGGAGGAG | CAGCCGGCGTTTGGAGTGGTAGAA |
P53 | NR_176326 | GCCCAACAACACCAGCTCCT | CCTGGGCATCCTTGAGTTCC |
RBL1 | NM_002895 | TGGACAGGACTGAACGTCTTG | CCAGCAGGTCAGCAAAGAATTTA |
BCL-2 | NM_000633 | GAGGATTGTGGCCTTCTTTG | GCCGGTTCAGGTACTCAGTC |
DSPP | NM_014208 | CAACCATAGAGAAAGCAAACGCG | TTTCTGTTGCCACTGCTGGGAC |
DMP1 | NM_004407 | CTGAAGAGAGGACGGGTGATT | CGTGTGGTCACTATTTGCCTG |
ALP | NM_001632 | CCTCCTCGGAAGACACTCTG | GCAGTGAAGGGCTTCTTGTC |
RUNX2 | NM_001024630 | CCACTGAACCAAAAAGAAATCCC | GAAAACAACACATAGCCAAACGC |
GAPDH | NM_002046 | GGACACTGAGCAAGAGAGGC | TTATGGGGGTCTGGGATGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, H.; Shi, F.; Wang, B.; Zheng, Y.; Lu, J.; Zeng, B.; Zhao, W. Molecular Biological Comparison of Pulp Stem Cells from Supernumerary Teeth, Permanent Teeth, and Deciduous Teeth for Endodontic Regeneration. Int. J. Mol. Sci. 2025, 26, 1933. https://doi.org/10.3390/ijms26051933
Lu H, Shi F, Wang B, Zheng Y, Lu J, Zeng B, Zhao W. Molecular Biological Comparison of Pulp Stem Cells from Supernumerary Teeth, Permanent Teeth, and Deciduous Teeth for Endodontic Regeneration. International Journal of Molecular Sciences. 2025; 26(5):1933. https://doi.org/10.3390/ijms26051933
Chicago/Turabian StyleLu, Hui, Fangyang Shi, Boqun Wang, Yexin Zheng, Jiaxuan Lu, Binghui Zeng, and Wei Zhao. 2025. "Molecular Biological Comparison of Pulp Stem Cells from Supernumerary Teeth, Permanent Teeth, and Deciduous Teeth for Endodontic Regeneration" International Journal of Molecular Sciences 26, no. 5: 1933. https://doi.org/10.3390/ijms26051933
APA StyleLu, H., Shi, F., Wang, B., Zheng, Y., Lu, J., Zeng, B., & Zhao, W. (2025). Molecular Biological Comparison of Pulp Stem Cells from Supernumerary Teeth, Permanent Teeth, and Deciduous Teeth for Endodontic Regeneration. International Journal of Molecular Sciences, 26(5), 1933. https://doi.org/10.3390/ijms26051933