Next Article in Journal
Calprotectin Expression in Adventitial Layer of Cattle and Sheep Echinococcus granulosus sensu stricto Cysts
Previous Article in Journal
Stratifying ALS Patients by Mode of Inheritance Reveals Transcriptomic Signatures Specific to sALS and fALS
Previous Article in Special Issue
Overexpression of the Transcription Factor GmbZIP60 Increases Salt and Drought Tolerance in Soybean (Glycine max)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 18
10.3390/ijms26189235
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bioinformatics Analysis and Expression Profiling Under Abiotic Stress of the DREB Gene Family in Glycyrrhiza uralensis

by
Linyuan Cheng
1,†,
Nana Shi
1,†,
Xiangrong Du
1,
Teng Huang
1,
Yaxin Zhang
1,
Chenjie Zhao
1,
Kun Zhao
1,
Zirun Lin
1,
Denglin Ma
1,
Qiuling Li
1,
Fei Wang
1,*,
Hua Yao
1,2,* and
Haitao Shen
1,2
1
Key Laboratory of Xinjiang Phytomedicine Resource and Utilization of Ministry of Education, College of Life Sciences, Shihezi University, Shihezi 832003, China
2
Key Laboratory of Oasis Town and Mountain-Basin System Ecology of Xinjiang Production and Construction Corps, Shihezi University, Shihezi 832003, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(18), 9235; https://doi.org/10.3390/ijms26189235
Submission received: 27 July 2025 / Revised: 29 August 2025 / Accepted: 15 September 2025 / Published: 22 September 2025
(This article belongs to the Special Issue Plant Response to Drought, Heat, and Light Stress)
Browse Figures
Review Reports Versions Notes

Abstract

Glycyrrhiza uralensis is an important medicinal plant exhibiting strong tolerance to abiotic stresses, including drought and salinity. DREB (Dehydration-Responsive Element-Binding) transcription factors, key members of the AP2/ERF family, play crucial roles in plant growth, development, and stress responses. Based on transcriptome data, we identified 18 DREB transcription factors in G. uralensis, designated GuDREB1 to GuDREB18. Bioinformatics analysis revealed genomic sequences ranging from 534 to 2864 bp and coding sequence (CDS) lengths between 525 and 1509 bp. All GuDREB proteins contain a single AP2 domain, including the conserved YRG and RAYD elements, and were predicted to localize to the nucleus. Phylogenetic analysis clustered the G. uralensis DREBs with 61 Arabidopsis thaliana DREBs into five subgroups, indicating evolutionary conservation. Promoter analysis detected seventeen stress-responsive cis-acting elements, encompassing hormone-responsive and abiotic stress-responsive motifs, suggesting diverse biological functions. Tissue-specific expression profiling revealed GuDREB transcription in both aerial and underground parts. Drought stress induced varying degrees of GuDREB expression, confirming their involvement in stress responses. Notably, GuDREB10 expression increased significantly in underground parts, while GuDREB15 showed pronounced upregulation in aerial parts under drought; the GuDREB15 promoter contained the highest number of light-responsive elements (23), potentially explaining its aerial tissue specificity. Drought stress significantly increased abscisic acid (ABA) content. Underground parts exhibited higher initial sensitivity to drought, whereas aerial parts displayed a more sustained response; ABA levels overall showed an initial increase followed by a decline. This study expands the G. uralensis DREB gene database, provides a foundation for selecting stress-resistance genes, and offers insights into DREB functional roles in abiotic stress responses in this key medicinal species.

1. Introduction

G. uralensis, a species within the genus Glycyrrhiza Linn. (Fabaceae, Papilionoideae subfamily), is a significant medicinal plant. Its dried roots and rhizomes are used medicinally, exhibiting diverse pharmacological properties including analgesic, anti-inflammatory, anti-ulcerative, antiviral (particularly against hepatitis), anticancer, and anti-HIV activities [1,2,3]. First documented in the ancient Chinese pharmacopeia Shennong Bencao Jing (Classic of Herbal Medicine), where it was classified as a superior herb, G. uralensis is now widely utilized in the food, beverage, and cosmetic industries. Wild G. uralensis populations are primarily distributed across the arid and semi-arid regions of Northwest China [4]. This plant demonstrates considerable resilience to environmental challenges, including drought, cold, and salt–alkali stress, and is valued for its role in windbreak and sand fixation, making it an important ecological and economic crop. During evolution and development, plants are frequently exposed to adverse abiotic stresses such as drought, low temperature, and high salinity. Upon encountering such stresses, plants initiate adaptive responses at morphological, physiological, and transcriptional levels to mitigate the detrimental effects.
Abscisic acid (ABA), a key stress hormone, regulates numerous physiological processes involved in plant stress responses. It modulates stomatal closure, maintains tissue water balance, and controls the expression of specific stress-responsive genes [5]. Under drought stress, numerous stress-resistance genes are highly induced. The expression of these genes can be regulated not only through ABA-dependent signaling pathways but also via ABA-independent pathways. Dehydration-Responsive Element Binding proteins (DREBs) play a crucial role in the latter process.
DREB transcription factors specifically bind to the DRE/CRT (C-repeat/Dehydration Responsive Element) cis-acting element and activate the expression of downstream stress-tolerance genes. AP2/ERF represents the largest family of transcription factors in plants, playing vital roles in diverse biological processes including growth, development, stress responses, and hormone signaling [6]. DREB transcription factors belong to a specific subfamily within the AP2/ERF superfamily, characterized by their ability to bind DRE elements [7]. The AP2 domain, their sole conserved domain, comprises only 57–70 conserved amino acid residues. Within this domain, the valine (V) at position 14 and the glutamic acid (E) at position 19 are critical for the binding affinity of the transcription factor to the cis-acting element [8,9]. This domain typically folds into a characteristic three-dimensional configuration of three anti-parallel β-sheets and one α-helix. Okamuro et al. [10] identified two highly conserved motifs within the AP2 domain: a YRG element near the N-terminus, rich in basic and hydrophobic amino acids, which mediates DNA binding activity; and an approximately 40-amino acid RAYD element, which modulates the binding strength of the YRG element to DNA. Furthermore, members of the DREB family are classified into six subgroups (A1 to A6) based on structural and sequence features, with each subgroup exhibiting distinct functions. The DREB subfamily specifically binds to the DRE/CRT cis-acting elements associated with drought and cold responses, thereby inducing the expression of downstream target genes [11,12]. Subgroup A1 members are primarily involved in cold stress responses, while A2 members are key regulators of drought and high-salt stress responses. The functions of A1 and A2 subgroups have been characterized in species such as Oryza sativa [13], Sorghum bicolor [14], and Polygonum cuspidatum [15]. Subgroups A3 to A6 members are implicated in both plant growth and development and responses to abiotic stresses.
To date, DREB family members have been identified in a wide range of plant species, including Fragaria vesca [16], Triticum aestivum [17], Brassica napus [18], Oryza sativa [19], and Solanum tuberosum [20]. Numerous studies have demonstrated that overexpression of DREB genes in Arabidopsis thaliana or various crops significantly enhances the transgenic plants’ tolerance to diverse abiotic stresses, such as drought, salinity, and low temperature. Although several transcription factors associated with abiotic stress responses have been identified in G. uralensis in recent years, research specifically focusing on DREB transcription factors in this species remains limited. Therefore, the identification of DREB transcription factors in G. uralensis and the analysis of their expression patterns under drought stress are crucial. This work will provide an essential theoretical foundation for further elucidating the functional roles of DREB genes in the drought stress response of G. uralensis. Furthermore, it holds significant potential for guiding transgenic breeding strategies aimed at enhancing stress resistance. Consequently, this study employs transcriptome sequencing and bioinformatic analyses to identify GuDREB genes and characterize their tissue-specific expression profiles under drought stress. The findings will lay a theoretical groundwork for screening elite stress-resistance genes. Moreover, this research is of great importance for investigating the stress tolerance mechanisms of G. uralensis in adverse environments, breeding novel stress-resistant crop varieties, and ultimately improving crop yield.

2. Results

2.1. Impact of Drought Stress on ABA Accumulation in G. uralensis Tissues

Bulleted lists look like this: Drought stress significantly increased ABA content in both underground and aerial parts of G. uralensis (Figure 1). The most pronounced ABA accumulation occurred at 6 h in underground parts (298.97 ng/g FW, 2.33-fold increase vs. control) and at 2 h in aerial parts (294.53 ng/g FW, 1.71-fold increase). ABA predominantly accumulated in underground tissues, exhibiting an initial increase followed by decline, indicating stronger sensitivity and more sustained response to drought stress in underground organs compared to aerial tissues.

2.2. Differential Expression Patterns of the GuDREB Gene Family in Response to Drought Stress

Transcriptome analysis of drought-stressed G. uralensis tissues revealed differential expression patterns among 18 GuDREB genes (Figure 2, Table 1). In aerial parts, seven genes (GuDREB1, GuDREB2, GuDREB4, GuDREB9, GuDREB14, GuDREB15 and GuDREB16) were up-regulated with distinct response kinetics: GuDREB15 showed the earliest and strongest induction (3.07-fold at 2 h), GuDREB4, GuDREB14 and GuDREB16 peaked at 6 h, and GuDREB1, GuDREB2, GuDREB9, GuDREB11 and GuDREB12 increased at 12 h, while GuDREB6, GuDREB11 and GuDREB18 were down-regulated. In underground parts, five genes (GuDREB3, GuDREB5, GuDREB7, GuDREB10 and GuDREB13) exhibited up-regulation, with GuDREB5 responding most rapidly (2 h) but without significant expression change, and GuDREB10 showing the strongest induction (1.70-fold at 6 h). Notably, GuDREB genes displayed tissue-specific drought responses, with no simultaneous activation in both tissues, suggesting organ-functional specialization. GuDREB17 remained unexpressed in both tissues. These results demonstrate that GuDREB genes mobilize distinct regulatory networks to coordinate drought responses.

2.3. Genomic Scaffold Localization and Multiple Sequence Alignment of GuDREB Proteins

The 18 GuDREB genes were mapped to distinct genomic scaffolds (Figure 3A), indicative of uniform chromosomal distribution; multiple sequence alignment revealed two conserved domains: the YRG element (a 20-residue N-terminal basic hydrophilic region facilitating DNA binding) and the RAYD element (42–43 residues at the AP2 domain’s C-terminus regulating DRE cis-element binding affinity) (Figure 3B).

2.4. Physicochemical Characterization and Secondary Structure Prediction of GuDREB Proteins

Screening of the G. uralensis transcriptome database identified 25 putative DREB transcription factors; after removing redundant sequences, those with incomplete ORFs, and proteins containing fragmented conserved domains, 18 non-redundant GuDREB genes (GuDREB1–GuDREB18) were selected for further characterization (Table 2). NCBI BLAST was used to align the DREB protein sequences of Arabidopsis thaliana and G. uralensis. This alignment was validated by CDD and SMART domain analysis and confirmed that all 18 GuDREB proteins contain a single highly conserved AP2 domain. Physicochemical characterization revealed genomic lengths of 534–2864 bp, CDS lengths of 525–1509 bp, and protein lengths of 174–502 aa, with predicted molecular weights ranging from 19,521.95 to 55,106.82 Da and theoretical pI values spanning 4.97–9.32 (GuDREB2, GuDREB5, GuDREB7, GuDREB10 and GuDREB15 classified as alkaline proteins); hydrophobicity analysis showed GRAVY indices (−0.923 to −0.443, confirming hydrophilic properties with GuDREB15 as most hydrophilic), instability indices (49.74–70.74, all indicating stable proteins), and aliphatic indices (35.04–70.13). Subcellular localization predictions (WoLF PSORT) indicated nuclear localization for 14 proteins and dual nuclear/cytoplasmic localization for 4 proteins, demonstrating nuclear-centric functionality for these transcription factors and providing a foundation for functional studies of the GuDREB gene family.
To elucidate structural composition, secondary structures of GuDREB proteins were predicted (Table 3), revealing four components: random coils, α-helices, β-sheets, and extended strands. Each protein exhibited distinct secondary structure proportions: random coils predominated (highest in GuDREB13 at 57.63%, lowest in GuDREB4 at 36.25%); α-helix and extended strand contents were consistently lower than random coils, while extended strands were generally less abundant than α-helices—with the exception of GuDREB5, GuDREB17, and GuDREB18 which showed inverted ratios.

2.5. Phylogenetic Analysis of Plant DREB Family Members

Phylogenetic analysis of the G. uralensis DREB gene family with Arabidopsis thaliana and Glycine max orthologs (Figure 4) classified the 18 GuDREB genes into five subgroups (DREB-A1, A2, A3, A4, A6; excluding A5) according to Arabidopsis thaliana nomenclature: DREB-A1 comprised GuDREB5, GuDREB6, GuDREB11, GuDREB12, GuDREB14, GuDREB17 and GuDREB18; DREB-A2 contained GuDREB1, GuDREB2, GuDREB4, GuDREB7, GuDREB9 and GuDREB16; DREB-A3 solely included GuDREB15, which clustered with Glycine max Gm17; DREB-A4 grouped GuDREB3, GuDREB8 and GuDREB13; and DREB-A6 consisted exclusively of GuDREB10. The evolutionary tree revealed high sequence homology (>80% average identity in AP2 domains) among G. uralensis, Arabidopsis thaliana, and Glycine max, suggesting conserved functional roles in stress-responsive pathways.

2.6. Integrated Analysis of Gene Structures, Conserved Domains, and Motifs in the G. uralensis DREB Gene Family

Analysis of exon-intron structures, conserved domains, and motifs across 18 GuDREB genes—integrated with phylogenetic reconstruction (Figure 5)—revealed conserved and divergent genomic features. Gene structure analysis (Figure 5D) showed three nucleotide sequence components (UTR, introns, exons), where all members exclusively contained exons except GuDREB12 (possessing UTR) and GuDREB5, GuDREB7 and GuDREB12 (containing introns). Domain analysis (Figure 5C) confirmed all 18 proteins harbor only the AP2 domain, consistent with DREB subfamily characteristics. Further motif scanning identified 12 conserved motifs (Figure 5B); Motif 1, Motif 2, Motif 3, and partial Motif 7 constitute the AP2 domain, explaining their universal presence. Motif distribution aligned with phylogenetic relationships, for instance, GuDREB6, GuDREB11, GuDREB12, GuDREB14 and GuDREB18 shared an identical motif profile comprising Motif 1, Motif 2, Motif 3, Motif 5, Motif 7, and Motif 9.

2.7. Analysis of Cis-Regulatory Elements in G. uralensis DREB Subfamily Members

Cis-regulatory element analysis of 2000 bp promoter regions upstream of GuDREB genes (Figure 6 and Figure 7) identified 17 stress-responsive elements, including 251 light-responsive elements, hormone-responsive elements (methyl jasmonate [MeJA], abscisic acid [ABA], salicylic acid [SA], gibberellin [GA], and auxin), and abiotic stress-responsive elements (anaerobic induction, defense/stress, low-temperature, and hypoxia-specific). Additional elements comprised 37 MYB-binding sites, circadian control motifs, zein metabolism regulation, meristem expression, endosperm expression, and cell cycle regulation sites. These results indicate that GuDREB genes mediate G. uralensis development and stress responses through diverse regulatory pathways.

3. Discussion

The synthesis, accumulation, and regulatory mechanisms of abscisic acid (ABA) in G. uralensis remain poorly characterized. Previous studies indicate moderate drought stress enhances accumulation of bioactive compounds (e.g., liquiritin, glycyrrhizic acid) [21]. In this study, 18 GuDREB transcription factors were identified from the G. uralensis transcriptome database. Research confirms that certain transcription factors function as structural components of transcriptional complexes within the nucleus [22]. Subcellular localization predictions demonstrated nuclear targeting for all 18 GuDREB genes, aligning with the established literature and confirming their role as nuclear proteins capable of transcriptional regulation; DREB subfamily proteins exhibit high sequence similarity and functional redundancy.
DREB proteins typically function as key regulators in abiotic stress responses such as low temperature, high temperature, drought, and salt, as well as in plant developmental regulation [23,24,25]. Within the six groups (A1–A6) of the Arabidopsis thaliana DREB subfamily, each exhibits distinct structural and functional characteristics; members of the A2 group, DREB2s (DREB2A/B/C), are primarily associated with the regulation of abiotic stresses including low temperature, high temperature, drought, and salt [26,27,28,29,30]. Similarly, Zea mays ZmDREB2A, Glycine max GmDREB2A, and Broussonetia papyrifera BpDREB2 are induced by temperature, drought, and salt stress [31,32,33]. Bioinformatics analysis revealed that all 18 G. uralensis DREB genes contain only a single conserved AP2 domain (Figure 5C), classifying them within the DREB subgroup of the AP2/ERF transcription factor family. Upon exposure to stresses like drought, plants utilize signal transduction to activate these transcription factors, enabling their binding to corresponding cis-acting elements. This subsequently stimulates the RNA polymerase II catalytic complex to initiate transcription of target genes. The resulting gene products then act within the organism to regulate and elicit responses to internal and external signals [34]. Phylogenetic tree analysis indicated a closer clustering relationship between G. uralensis, Arabidopsis thaliana and soybean. Based on the classification of the Arabidopsis thaliana DREB gene family into six subgroups (A1–A6), the 18 G. uralensis DREB genes were distributed among the A1, A2, A3, A4, and A6 subgroups (Figure 4). The DREB-A6 subgroup in G. uralensis contains only GuDREB10, which clustered with Arabidopsis thaliana RAP2.4 (AT1G22190.1, AT1G78080.1) (Figure 4). Studies demonstrate that DREB-A6 subgroup members AP2.4 and RAP2.4 respond to high salt, drought, and heat [35,36]. Transcriptome analysis in Arabidopsis thaliana showed that drought and salt stress treatments induced the expression of related AP2/DREB transcription factors (RAP2.4, AT1G78080.1) [37]. Lin et al. found that Arabidopsis thaliana overexpressing RAP2.4 exhibited enhanced drought tolerance, although water loss showed no significant difference compared to the wild type [35]. The expression level of GuDREB10 in the underground parts of G. uralensis was 1.70-fold higher at 6 h of drought stress compared to the 0 h group, suggesting that GuDREB10 responds to drought stress in G. uralensis roots. The G. uralensis gene GuDREB15 clustered within the DREB-A3 subgroup, showing close phylogenetic relationships to Arabidopsis thaliana AtERF019 (AT1G22810.1) and Glycine max GmDREB8 (Glyma.17G216100) (Figure 4). The soybean GmDREB8 (Glyma.17G216100) protein localizes to the nucleus. Heterologous expression of GmDREB8 in transgenic Arabidopsis thaliana resulted in shorter roots under mannitol treatments of varying concentrations, indicating increased sensitivity to drought stress [38]. GuDREB15, the gene showing the fastest response to drought stress in the aboveground parts of G. uralensis, exhibited the most significant upregulation at 2 h, with expression levels 3.07-fold higher than the 0 h treatment group, indicating greater sensitivity to drought stress, which aligns with previous research. This suggests that GuDREB15 plays a crucial role in responding to drought stress in the aerial parts of G. uralensis.
Promoter cis-element prediction analysis revealed that DREB genes possess hormone-responsive elements such as those for abscisic acid (ABA), methyl jasmonate (MeJA), salicylic acid (SA), gibberellin (GA), and auxin (Figure 6), along with elements for defense against stress and light response, suggesting that GuDREB genes may participate in ABA response and stress resistance pathways, as well as potentially in plant photoresponse processes. Studies indicate that under certain drought conditions, when plant roots sense soil drought, they produce substantial ABA; acting as a signaling molecule, ABA is transported to the aerial parts, regulating stomatal closure in leaves to enhance water retention and consequently improve plant drought resistance [39,40,41]. This study found that ABA content in G. uralensis under drought stress primarily accumulated in the underground parts (Figure 1), showing an overall trend of initially increasing followed by a decrease; simultaneously, it was observed that the underground parts of G. uralensis responded more sensitively to drought stress, while the aboveground parts exhibited a more sustained response. Given that drought stress rapidly induced the expression of DREB transcription factors, with expression levels significantly higher than the 0 h control group, it is hypothesized that genes regulating DREB transcription exist upstream. The GuDREB15 gene contained the highest number of light-responsive elements (23) (Figure 6 and Figure 7), which may explain its significantly higher expression in aboveground tissues.
This study found that drought stress primarily induced the upregulation of GuDREB genes in the aboveground parts, with GuDREB15 exhibiting the most significant upregulation, reaching 3.07-fold that of the 0 h treatment group; whereas in the underground parts, GuDREB10 expression was significantly upregulated, with its level at 6 h of drought stress being 1.70-fold that of the 0 h group, indicating that this gene family can mobilize related genes for differential expression in response to stress under drought conditions (Figure 2, Table 1). Studies show that DNA binding, protein interactions, nuclear localization, and transcriptional activation activity are associated with the domains or amino acid motifs of transcription factors [42]. Conserved motif analysis of the genes (Figure 3B) revealed that GuDREB15 contains two conserved YRG and RAYD motifs, similar to the structure of DREB genes in other species, which may account for the functional conservation of GuDREB15. The gene structure of GuDREB genes (Figure 5D) showed that GuDREB15 is intronless, potentially because the absence of introns can reduce the time required from transcription to translation, enabling rapid gene expression and functional protein production to trigger corresponding mechanisms within the plant or respond to environmental changes [43]. Subcellular localization results indicated that the GuDREB15 protein localizes to the nucleus (Table 2), suggesting it may play an important transcriptional regulatory role in responding to drought stress, which may also explain the greater sensitivity of the GuDREB15 gene under drought stress. It has been found that the GmDREB8 gene can negatively regulate plant drought resistance through osmotic adjustment and the antioxidant defense system [38], leading to the inference that the GuDREB15 gene may also negatively regulate drought resistance in G. uralensis.
In total, this study identified and screened 18 DREB genes in G. uralensis and conducted bioinformatics analysis along with drought stress treatment. The physicochemical properties and secondary structures of the G. uralensis DREB gene family proteins were predicted. Analyses including the phylogenetic tree, promoter cis-acting elements, gene structure, and chromosomal localization of the G. uralensis DREB genes were performed, leading to the inference of potential biological functions for some genes. However, the specific mechanisms of action require functional validation by cloning the G. uralensis DREB genes and verifying their function through overexpression or suppression of expression in G. uralensis.

4. Materials and Methods

4.1. Plant Material and Data Sources

Plant material of G. uralensis was collected and taxonomically identified by our laboratory. The collection site was the Wetland Reserve in Hebukeser County, Tacheng Prefecture, Xinjiang Uygur Autonomous Region, China. The G. uralensis genome sequence data and corresponding annotation files were obtained from the Gur Genome Project database hosted by RIKEN: https://www.riken.jp/en/ (accessed on 2 May 2025). Protein sequences of DREB transcription factors from Glycine max were downloaded from the SoyBase database (https://www.soybase.org/ (accessed on 3 May 2025)). Protein sequences for the Arabidopsis thaliana DREB gene family were retrieved from The Arabidopsis thaliana Information Resource (TAIR) database (https://www.arabidopsis.org/ (accessed on 3 May 2025)).

4.2. Bioinformatics Analysis of the GuDREB Gene Family

Based on transcriptome sequencing data generated in this study, 18 GuDREB genes possessing complete open reading frames (ORFs) were identified. The deduced protein sequences of DREB transcription factors from Arabidopsis thaliana and G. uralensis were subjected to BLAST analysis using the National Center for Biotechnology Information (NCBI) service. The presence of the “AP2” domain within the G. uralensis protein sequences was confirmed using both the Conserved Domain Database (CDD) and SMART web servers. The physicochemical properties of the proteins encoded by the G. uralensis DREB gene family were predicted using the ExPASy ProtParam tool (https://web.expasy.org/protparam/ (accessed on 8 May 2025)). These properties included protein sequence length, molecular weight (MW), theoretical isoelectric point (pI), grand average of hydropathicity (GRAVY), instability index, and aliphatic index. Subcellular localization predictions were performed using WoLF PSORT (https://wolfpsort.hgc.jp/ (accessed on 9 May 2025)). Multiple sequence alignment of the G. uralensis DREB protein sequences was conducted using Jalview software (Vers. 2.11.2.4). Phylogenetic analysis was performed using MEGA11 software. A neighbor-joining (NJ) phylogenetic tree was constructed with default parameters. The resulting tree file (NWK format) was visualized and annotated using the Interactive Tree Of Life (iTOL) online tool (https://itol.embl.de/ (accessed on 9 May 2025)).
Conserved motifs within the G. uralensis DREB proteins were predicted using the MEME Suite (http://meme-suite.org/ (accessed on 10 May 2025)). Genomic location information for the DREB genes was extracted from the G. uralensis genome annotation files. The conserved motifs, domains, phylogenetic relationships, and exon/intron structures of the GuDREB proteins were integrated and visualized using TBtools software (Vers. 2.056). The genomic positions of the 18 identified GuDREB genes were mapped onto their respective scaffolds within the G. uralensis genome assembly using TBtools. Chromosomal localization visualization was achieved using the MG2C online tool (http://mg2c.iask.in/mg2c_v2.1/ (accessed on 11 May 2025)). To assess cross-species conservation, the amino acid sequences of the conserved AP2 domains from G. uralensis were aligned with their counterparts from Arabidopsis thaliana and Glycine max. Cis-regulatory elements within the 2000 bp promoter region upstream of the predicted transcription start site for each GuDREB gene were identified using the PlantCARE database and subsequently analyzed with TBtools software.

4.3. Plant Material Treatment

In mid-May, collected G. uralensis seeds were manually dehulled and sun-dried for 5 days. To break seed dormancy, the seeds were treated with 98% (w/w) concentrated sulfuric acid for 55 min. Subsequently, seeds were thoroughly rinsed with distilled water to remove residual acid. The treated seeds were sown in pots filled with vermiculite substrate. Five sowing points (hills) were made per pot, with three seeds sown per hill. Trays with a depth of 3 cm were placed beneath the pots. Plants were cultivated under controlled environmental conditions: photosynthetic photon flux density (PPFD) of 360 μmol·m−2·s−1 and a photoperiod of 16 h light/8 h dark. Upon seed germination, 500 mL of half-strength Murashige and Skoog (1/2 MS) nutrient solution was supplied to each pot every 5 days. Additional distilled water was added as needed based on substrate moisture levels. Seedlings were thinned to one plant per hill at 14 days after germination. When plants reached a height of approximately 20 cm, drought stress was simulated by irrigating the pots with MS nutrient solution containing 10% (w/v) PEG 6000. Treated plants were sampled at five time points (0, 2, 6, 12, and 24 h after stress initiation). Sampling was performed by separating the plant at the tiller node: the underground parts (roots and rhizomes) below the node and the aboveground parts (shoots) were collected separately. All samples were immediately flash-frozen in liquid nitrogen and stored at −80 °C until further analysis. These samples were used for both ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) quantification of abscisic acid (ABA) content and transcriptome sequencing.

4.4. Sample Tissue Processing

Fresh tissue samples (aerial and underground parts) of G. uralensis were pulverized in liquid nitrogen to a fine powder. Approximately 1 g of powder (fresh weight, FW) was aliquoted into a centrifuge tube. Subsequently, 5 mL of methanol was added, and the mixture was vortexed vigorously (30 s) to achieve homogeneity. Ultrasoni-assisted extraction was performed under controlled conditions: 25 °C, 1000 W power, and 30 min duration. Following sonication, extracts were incubated at 4 °C for 30 min and centrifuged (10,000× g, 5 min, 4 °C). The supernatant was transferred to a new labeled tube. The residual pellet was re-extracted with 5 mL fresh methanol through repetition of the ultrasonic extraction, incubation, and centrifugation steps. Supernatants from both extractions were combined in the same labeled tube. The combined methanol extracts were stored at 4 °C for subsequent use.

4.5. Standard Curve Preparation

A stock solution of abscisic acid (ABA) standard was prepared at 1 mg/mL by dissolving accurately weighed ABA standard in methanol. Serial dilutions were then performed using methanol to prepare standard working solutions at concentrations of 1, 5, 10, 25, 50, 75, and 100 μg/mL.

4.6. Chromatographic Conditions

Chromatographic separation was performed on an ACQUITY UPLC BEH C18 column (1.7 μm, 2.1 mm × 50 mm; Waters, United States) maintained at 30 °C. The mobile phase consisted of: Eluent A: 0.1% (v/v) formic acid in water; Eluent B: Acetonitrile. The flow rate was 0.3 mL/min and the injection volume was 1.0 μL. The following gradient elution program was employed: 0.0–3.0 min: 20% B to 98% B; 3.0–4.5 min: 98% B (isocratic); 4.5–5.0 min: 98% B to 20% B; 5.0–6.0 min: 20% B (isocratic; column re-equilibration).

4.7. Mass Spectrometry Conditions

Analysis was performed using electrospray ionization (ESI) under the following optimized source parameters: Ion source temperature: 150 °C; Capillary voltage: 3.0 kV; Desolvation gas temperature: 450 °C; Desolvation gas flow: 800 L/h; Cone gas flow: 150 L/h; Nebulizer gas flow: 7.0 Pa. Data acquisition utilized multiple reaction monitoring (MRM) mode. The specific MRM transitions and associated instrument parameters for abscisic acid (ABA) are detailed in Table 4. Representative MRM chromatograms for ABA are presented in Figure 8.

4.8. Linearity Analysis for Abscisic Acid Quantification

The prepared ABA standard solutions were analyzed under the chromatographic and mass spectrometric conditions detailed in Section 2.6 and Section 2.7. A calibration curve was constructed by plotting the peak area (y-axis) against the standard concentration (x-axis). As summarized in Table 5, ABA exhibited excellent linearity (R2 > 0.99) across the tested concentration range.

4.9. RNA Extraction and Transcriptome Sequencing

This part of the work was performed by Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China). The sequencing results were compared and analyzed with the G. uralensis genome (https://www.riken.jp/en/, accessed on 2 May 2025).

4.10. Validation of RNA-Seq Data Using qRT-PCR

To validate the differentially expressed genes obtained from RNA sequencing, the researchers randomly selected four G. uralensis DREB genes for qRT-PCR verification. The experiment was performed using gene-specific primers on a LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland), with the lectin gene found in licorice serving as the internal control (Table 6). Relative expression calculated by 2−ΔΔCt method.

4.11. Statistical Analysis

Data analysis was performed using GraphPad Prism 8.0. Statistical significance between treatment groups was determined by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Significance thresholds were defined as follows: p < 0.05: statistically significant; p < 0.01: highly statistically significant. All experiments included three independent biological replicates. All data collection and calculations were conducted with 3 biological replicates.

5. Conclusions

Currently, cultivated G. uralensis serves as the primary source of commercial G. uralensis, and the quality of cultivated G. uralensis has consistently been one of the main factors restricting its development; consequently, enhancing the quality of cultivated G. uralensis remains a current research hotspot. Moderate abiotic stress can facilitate the synthesis and accumulation of active ingredients in G. uralensis. This study determined the accumulation characteristics of abscisic acid (ABA) in the aboveground and underground parts of G. uralensis under drought stress, as well as the expression characteristics of G. uralensis DREB genes under such stress. It investigated the relationship between the expression of the GuDREB gene family and ABA biosynthesis in G. uralensis and their potential roles, laying a theoretical foundation for further exploration of GuDREB gene functions and potentially providing new perspectives for G. uralensis resistance breeding. This research contributes to revealing the mechanism by which G. uralensis regulates the accumulation of bioactive components through ABA under drought conditions and provides a scientific basis for improving G. uralensis quality.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms26189235/s1.

Author Contributions

Conceptualization, F.W., and H.Y.; methodology, N.S.; software, K.Z.; validation, X.D., T.H., and Z.L.; formal analysis, L.C.; investigation, D.M., Y.Z., and C.Z.; resources, Q.L.; data curation, L.C., and N.S.; writing—original draft preparation, L.C., and N.S.; writing—review and editing, L.C., and N.S.; visualization, L.C., X.D., and N.S.; supervision, F.W., and H.Y.; project administration, H.S.; funding acquisition, H.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science and Technology Plan Project of the Third Division (Grant number: KY2025JBGS03); the National Natural Science Foundation of China (grant number: 32260083); the Science and Technology Project of Bingtuan (grant numbers: 2023AB052 and 2023CB008-17); and the Scientific Research Startup Project for High-Level Talents, Shihezi University (Grant number: RCZK202595).

Data Availability Statement

All data are presented in the article and the Supplementary Materials.

Acknowledgments

Thanks to Shanghai Majorbio Bio-Pharm Technology Co., Ltd., for the sequencing service provided.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zuo, J.; Meng, T.; Wang, Y.; Tang, W. A Review of the Antiviral Activities of Glycyrrhizic Acid, Glycyrrhetinic Acid and Glycyrrhetinic Acid Monoglucuronide. Pharmaceuticals 2023, 16, 641. [Google Scholar] [CrossRef]
  2. Jiang, L.; Akram, W.; Luo, B.; Hu, S.; Faruque, M.O.; Ahmad, S.; Yasin, N.A.; Khan, W.U.; Ahmad, A.; Shikov, A.N.; et al. Metabolomic and Pharmacologic Insights of Aerial and Underground Parts of Glycyrrhiza uralensis Fisch. ex DC. for Maximum Utilization of Medicinal Resources. Front. Pharmacol. 2021, 12, 658670. [Google Scholar] [CrossRef]
  3. Cheng, M.; Ding, L.; Kan, H.; Zhang, H.; Jiang, B.; Sun, Y.; Cao, S.; Li, W.; Koike, K.; Qiu, F. Isolation, structural elucidation and in vitro hepatoprotective activity of flavonoids from Glycyrrhiza uralensis. J. Nat. Med. 2019, 73, 847–854. [Google Scholar] [CrossRef]
  4. Marui, A.; Kotera, A.; Furukawa, Z.; Yasufuku, N.; Omine, K.; Nagano, T.; Tuvshintogtokh, I.; Mandakh, B. Monitoring the Growing Environment of Wild Licorice with Analysis of Satellite Data at a Semi-arid Area in Mongolia (DESERT TECHNOLOGY 11 INTERNATIONAL CONFERENCE). J. Arid. Land Stud. 2014, 24, 99–202. [Google Scholar]
  5. Nakashima, K.; Yamaguchi-Shinozaki, K. ABA signaling in stress-response and seed development. Plant Cell Rep. 2013, 32, 959–970. [Google Scholar] [CrossRef]
  6. Chai, M.; Cheng, H.; Yan, M.; Priyadarshani, S.; Zhang, M.; He, Q.; Huang, Y.; Chen, F.; Liu, L.; Huang, X.; et al. Identification and expression analysis of the DREB transcription factor family in pineapple (Ananas comosus (L.) Merr.). PeerJ 2020, 8, e9006. [Google Scholar] [CrossRef] [PubMed]
  7. Ding, L.; Lu, Z.; Gao, L.; Guo, S.; Shen, Q. Is Nitrogen a Key Determinant of Water Transport and Photosynthesis in Higher Plants Upon Drought Stress? Front. Plant Sci. 2018, 9, 1143. [Google Scholar] [CrossRef] [PubMed]
  8. Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef] [PubMed]
  9. Mei, F.; Chen, B.; Du, L.; Li, S.; Zhu, D.; Chen, N.; Zhang, Y.; Li, F.; Wang, Z.; Cheng, X.; et al. A gain-of-function allele of a DREB transcription factor gene ameliorates drought tolerance in wheat. Plant Cell 2022, 34, 4472–4494. [Google Scholar] [CrossRef]
  10. Okamuro, J.K.; Caster, B.; Villarroel, R.; Van Montagu, M.; Jofuku, K.D. The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc. Natl. Acad. Sci. USA 1997, 94, 7076–7081. [Google Scholar] [CrossRef]
  11. Yamaguchi-Shinozaki, K.; Shinozaki, K. A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 1994, 6, 251–264. [Google Scholar] [CrossRef]
  12. Thomashow, M.F. PLANT COLD ACCLIMATION: Freezing Tolerance Genes and Regulatory Mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 571–599. [Google Scholar] [CrossRef]
  13. Donde, R.; Gupta, M.K.; Gouda, G.; Kumar, J.; Vadde, R.; Sahoo, K.K.; Dash, S.K.; Behera, L. Computational characterization of structural and functional roles of DREB1A, DREB1B and DREB1C in enhancing cold tolerance in rice plant. Amino Acids 2019, 51, 839–853. [Google Scholar] [CrossRef]
  14. Akbudak, M.A.; Filiz, E.; Kontbay, K. DREB2 (dehydration-responsive element-binding protein 2) type transcription factor in sorghum (Sorghum bicolor): Genome-wide identification, characterization and expression profiles under cadmium and salt stresses. 3 Biotech 2018, 8, 426. [Google Scholar] [CrossRef] [PubMed]
  15. Chen, H.; Liu, L.; Wang, L.; Wang, S.; Cheng, X. VrDREB2A, a DREB-binding transcription factor from Vigna radiata, increased drought and high-salt tolerance in transgenic Arabidopsis thaliana. J. Plant Res. 2016, 129, 263–273. [Google Scholar] [CrossRef] [PubMed]
  16. Dong, C.; Xi, Y.; Chen, X.; Cheng, Z.M. Genome-wide identification of AP2/EREBP in Fragaria vesca and expression pattern analysis of the FvDREB subfamily under drought stress. BMC Plant Biol. 2021, 21, 295. [Google Scholar] [CrossRef]
  17. Niu, X.; Luo, T.; Zhao, H.; Su, Y.; Ji, W.; Li, H. Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses. Gene 2020, 740, 144514. [Google Scholar] [CrossRef]
  18. Ghorbani, R.; Zakipour, Z.; Alemzadeh, A.; Razi, H. Genome-wide analysis of AP2/ERF transcription factors family in Brassica napus. Physiol. Mol. Biol. Plants 2020, 26, 1463–1476. [Google Scholar] [CrossRef]
  19. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [PubMed]
  20. Mushtaq, N.; Munir, F.; Gul, A.; Amir, R.; Zafar Paracha, R. Genome-wide analysis, identification, evolution and genomic organization of dehydration responsive element-binding (DREB) gene family in Solanum tuberosum. PeerJ 2021, 9, e11647. [Google Scholar] [CrossRef]
  21. Wang, C.; Wu, D.; Jiang, L.; Liu, X.; Xie, T. Multi-Omics Elucidates Difference in Accumulation of Bioactive Constituents in Licorice (Glycyrrhiza uralensis) under Drought Stress. Molecules 2023, 28, 7042. [Google Scholar] [CrossRef]
  22. Su, J.; Song, S.; Wang, Y.; Zeng, Y.; Dong, T.; Ge, X.; Duan, H. Genome-wide identification and expression analysis of DREB family genes in cotton. BMC Plant Biol. 2023, 23, 169. [Google Scholar] [CrossRef] [PubMed]
  23. Xie, Z.; Nolan, T.M.; Jiang, H.; Yin, Y. AP2/ERF Transcription Factor Regulatory Networks in Hormone and Abiotic Stress Responses in Arabidopsis. Front. Plant Sci. 2019, 10, 228. [Google Scholar] [CrossRef] [PubMed]
  24. Agarwal, P.K.; Gupta, K.; Lopato, S.; Agarwal, P. Dehydration responsive element binding transcription factors and their applications for the engineering of stress tolerance. J. Exp. Bot. 2017, 68, 2135–2148. [Google Scholar] [CrossRef]
  25. Guo, X.; Liu, D.; Chong, K. Cold signaling in plants: Insights into mechanisms and regulation. J. Integr. Plant Biol. 2018, 60, 745–756. [Google Scholar] [CrossRef]
  26. Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AP2/ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2012, 1819, 86–96. [Google Scholar] [CrossRef]
  27. Ohama, N.; Sato, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Transcriptional Regulatory Network of Plant Heat Stress Response. Trends Plant Sci. 2017, 22, 53–65. [Google Scholar] [CrossRef] [PubMed]
  28. Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Qin, F.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 2006, 18, 1292–1309. [Google Scholar] [CrossRef]
  29. Sakuma, Y.; Maruyama, K.; Qin, F.; Osakabe, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heat-stress-responsive gene expression. Proc. Natl. Acad. Sci. USA 2006, 103, 18822–18827. [Google Scholar] [CrossRef] [PubMed]
  30. Lim, C.J.; Hwang, J.E.; Chen, H.; Hong, J.K.; Yang, K.A.; Choi, M.S.; Lee, K.O.; Chung, W.S.; Lee, S.Y.; Lim, C.O. Over-expression of the Arabidopsis DRE/CRT-binding transcription factor DREB2C enhances thermotolerance. Biochem. Biophys. Res. Commun. 2007, 362, 431–436. [Google Scholar] [CrossRef]
  31. Qin, F.; Kakimoto, M.; Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Tran, L.S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Regulation and functional analysis of ZmDREB2A in response to drought and heat stresses in Zea mays L. Plant J. 2007, 50, 54–69. [Google Scholar] [CrossRef]
  32. Mizoi, J.; Ohori, T.; Moriwaki, T.; Kidokoro, S.; Todaka, D.; Maruyama, K.; Kusakabe, K.; Osakabe, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K. GmDREB2A;2, a canonical DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN2-type transcription factor in soybean, is posttranslationally regulated and mediates dehydration-responsive element-dependent gene expression. Plant Physiol. 2013, 161, 346–361. [Google Scholar] [CrossRef] [PubMed]
  33. Sun, J.; Peng, X.; Fan, W.; Tang, M.; Liu, J.; Shen, S. Functional analysis of BpDREB2 gene involved in salt and drought response from a woody plant Broussonetia papyrifera. Gene 2014, 535, 140–149. [Google Scholar] [CrossRef]
  34. Singh, K.; Foley, R.C.; Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef]
  35. Lin, R.C.; Park, H.J.; Wang, H.Y. Role of Arabidopsis RAP2.4 in regulating light- and ethylene-mediated developmental processes and drought stress tolerance. Mol. Plant 2008, 1, 42–57. [Google Scholar] [CrossRef]
  36. Rae, L.; Lao, N.T.; Kavanagh, T.A. Regulation of multiple aquaporin genes in Arabidopsis by a pair of recently duplicated DREB transcription factors. Planta 2011, 234, 429–444. [Google Scholar] [CrossRef]
  37. Feng, J.X.; Liu, D.; Pan, Y.; Gong, W.; Ma, L.G.; Luo, J.C.; Deng, X.W.; Zhu, Y.X. An annotation update via cDNA sequence analysis and comprehensive profiling of developmental, hormonal or environmental responsiveness of the Arabidopsis AP2/EREBP transcription factor gene family. Plant Mol. Biol. 2005, 59, 853–868. [Google Scholar] [CrossRef]
  38. Xu, J.Y.; Lu, Y.; Sun, R.D.; Wang, X.S.; Ding, W.T.; Deng, S.S.; Wang, P.W.; Zhao, J.M.; Guo, N.; Xing, H. Functional analysis of GmDREB8 under drought stress in soybean. J. Nanjing Agric. Univ. 2023, 46, 226–236. [Google Scholar] [CrossRef]
  39. Kuromori, T.; Seo, M.; Shinozaki, K. ABA Transport and Plant Water Stress Responses. Trends Plant Sci. 2018, 23, 513–522. [Google Scholar] [CrossRef] [PubMed]
  40. Christmann, A.; Moes, D.; Himmelbach, A.; Yang, Y.; Tang, Y.; Grill, E. Integration of abscisic acid signalling into plant responses. Plant Biol 2006, 8, 314–325. [Google Scholar] [CrossRef]
  41. Cutler, S.R.; Rodriguez, P.L.; Finkelstein, R.R.; Abrams, S.R. Abscisic acid: Emergence of a core signaling network. Annu. Rev. Plant Biol. 2010, 61, 651–679. [Google Scholar] [CrossRef] [PubMed]
  42. Agarwal, P.K.; Agarwal, P.; Reddy, M.K.; Sopory, S.K. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 2006, 25, 1263–1274. [Google Scholar] [CrossRef] [PubMed]
  43. Chen, M.; Wang, Q.Y.; Cheng, X.G.; Xu, Z.S.; Li, L.C.; Ye, X.G.; Xia, L.Q.; Ma, Y.Z. GmDREB2, a soybean DRE-binding transcription factor, conferred drought and high-salt tolerance in transgenic plants. Biochem. Biophys. Res. Commun. 2007, 353, 299–305. [Google Scholar] [CrossRef] [PubMed]
Ijms 26 09235 g001
Figure 1. ABA content in aerial and underground tissues of G. uralensis under drought stress at different time points. Note: (A) Aerial part of G. uralensis; (B) Underground part of G. uralensis; The figure presents the results of multiple comparisons between all time points; only statistically significant or highly significant differences are indicated; * indicates that the difference between the treatment group and the control group (0 h group) is significant (p < 0.05).
Figure 1. ABA content in aerial and underground tissues of G. uralensis under drought stress at different time points. Note: (A) Aerial part of G. uralensis; (B) Underground part of G. uralensis; The figure presents the results of multiple comparisons between all time points; only statistically significant or highly significant differences are indicated; * indicates that the difference between the treatment group and the control group (0 h group) is significant (p < 0.05).
Ijms 26 09235 g001
Ijms 26 09235 g002
Figure 2. Heatmap of 18 DREB gene expression patterns in aerial and underground tissues of G. uralensis under abiotic stress at different time points. Note: The value in the heat map represents the up−regulation multiple of the expression level of the gene relative to 0 h.
Figure 2. Heatmap of 18 DREB gene expression patterns in aerial and underground tissues of G. uralensis under abiotic stress at different time points. Note: The value in the heat map represents the up−regulation multiple of the expression level of the gene relative to 0 h.
Ijms 26 09235 g002
Ijms 26 09235 g003
Figure 3. Genomic localization and protein sequence alignment of 18 GuDREB genes in G. uralensis. Note: (A) Scaffold mapping of GuDREB genes; (B) Multiple protein sequence alignment with the YRG domain highlighted in red and the RAYD domain in blue.
Figure 3. Genomic localization and protein sequence alignment of 18 GuDREB genes in G. uralensis. Note: (A) Scaffold mapping of GuDREB genes; (B) Multiple protein sequence alignment with the YRG domain highlighted in red and the RAYD domain in blue.
Ijms 26 09235 g003
Ijms 26 09235 g004
Figure 4. Phylogenetic tree analysis of the DREB gene family in G. uralensis, Arabidopsis thaliana, and Glycine max.
Figure 4. Phylogenetic tree analysis of the DREB gene family in G. uralensis, Arabidopsis thaliana, and Glycine max.
Ijms 26 09235 g004
Ijms 26 09235 g005
Figure 5. Comprehensive Analysis of the G. uralensis DREB Gene Family. Note: (A) Phylogenetic tree of protein sequences; (B) Conserved motif distribution; (C) Domain architecture; (D) Exon-intron structure; (E) Motif sequence logos.
Figure 5. Comprehensive Analysis of the G. uralensis DREB Gene Family. Note: (A) Phylogenetic tree of protein sequences; (B) Conserved motif distribution; (C) Domain architecture; (D) Exon-intron structure; (E) Motif sequence logos.
Ijms 26 09235 g005
Ijms 26 09235 g006
Figure 6. Cis-Regulatory element prediction in promoter regions of 18 DREB genes from G. uralensis.
Figure 6. Cis-Regulatory element prediction in promoter regions of 18 DREB genes from G. uralensis.
Ijms 26 09235 g006
Ijms 26 09235 g007
Figure 7. Statistics on thenumber of keycis-acting elementsin thepromoter sequences of 18 G. uralensis DREB genes.
Figure 7. Statistics on thenumber of keycis-acting elementsin thepromoter sequences of 18 G. uralensis DREB genes.
Ijms 26 09235 g007
Ijms 26 09235 g008
Figure 8. MRM chromatogram of Abscisic acid standard.
Figure 8. MRM chromatogram of Abscisic acid standard.
Ijms 26 09235 g008
Table 1. Expression levels (TPM) of 18 GuDREB genes in aerial and underground tissues of G. uralensis under abiotic stress at different time points.
Table 1. Expression levels (TPM) of 18 GuDREB genes in aerial and underground tissues of G. uralensis under abiotic stress at different time points.
Gene NameAerial PartUnderground Part
0 h2 h6 h12 h24 h0 h2 h6 h12 h24 h
GuDREB1 0.89 ± 0.12 0.56 ± 0.08 0.15 ± 0.03 1.22 ± 0.15 0.16 ± 0.02 0.21 ± 0.04 0.09 ± 0.01 0.14 ± 0.02 0.48 ± 0.06 0.43 ± 0.05
GuDREB20.48 ± 0.07 0.08 ± 0.01 0.59 ± 0.08 0.75 ± 0.09 0.13 ± 0.02 0.00 ± 0.00 0.07 ± 0.01 0.07 ± 0.01 0.27 ± 0.03 0.00 ± 0.00
GuDREB34.70 ± 0.62 8.78 ± 1.12 4.01 ± 0.52 8.02 ± 1.03 10.49 ± 1.35 23.53 ± 3.06 21.89 ± 2.84 19.96 ± 2.59 26.92 ± 3.50 13.89 ± 1.81
GuDREB40.16 ± 0.02 0.33 ± 0.04 0.81 ± 0.10 0.13 ± 0.02 0.47 ± 0.06 0.36 ± 0.05 0.09 ± 0.01 0.33 ± 0.04 0.19 ± 0.02 0.11 ± 0.01
GuDREB50.00 ± 0.00 0.07 ± 0.01 0.04 ± 0.01 0.04 ± 0.01 0.00 ± 0.00 0.57 ± 0.07 1.10 ± 0.14 0.39 ± 0.05 0.90 ± 0.12 0.00 ± 0.00
GuDREB62.46 ± 0.32 0.10 ± 0.01 0.26 ± 0.03 0.00 ± 0.00 0.66 ± 0.08 0.00 ± 0.000.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00
GuDREB720.31 ± 2.6422.80 ± 2.9616.98 ± 2.21 21.39 ± 2.78 16.22 ± 2.11 28.85 ± 3.7527.27 ± 3.5522.67 ± 2.95 18.76 ± 2.44 22.44 ± 2.92
GuDREB84.46 ± 0.58 9.50 ± 1.24 1.44 ± 0.19 2.01 ± 0.26 9.38 ± 1.22 6.48 ± 0.84 9.23 ± 1.20 6.64 ± 0.87 4.23 ± 0.55 4.26 ± 0.56
GuDREB90.77 ± 0.10 0.00 ± 0.00 0.47 ± 0.06 1.36 ± 0.180.00 ± 0.00 0.10 ± 0.01 0.06 ± 0.01 0.04 ± 0.01 0.27 ± 0.03 0.00 ± 0.00
GuDREB10 28.90 ± 3.76 26.76 ± 3.48 17.16 ± 2.23 27.77 ± 3.61 44.55 ± 5.7965.70 ± 8.54 64.83 ± 8.43111.64 ± 14.51 76.35 ± 9.9385.10 ± 11.06
GuDREB118.21 ± 1.07 2.75 ± 0.36 1.61 ± 0.21 0.66 ± 0.09 0.97 ± 0.13 1.86 ± 0.24 1.17 ± 0.15 5.04 ± 0.65 0.37 ± 0.050.39 ± 0.05
GuDREB120.39 ± 0.05 0.22 ± 0.03 1.04 ± 0.13 1.03 ± 0.13 0.37 ± 0.05 0.26 ± 0.03 0.58 ± 0.07 0.43 ± 0.05 0.66 ± 0.08 0.73 ± 0.09
GuDREB131.41 ± 0.18 0.78 ± 0.10 0.00 ± 0.00 0.27 ± 0.03 0.48 ± 0.06 13.97 ± 1.825.70 ± 0.74 12.54 ± 1.63 15.38 ± 2.00 8.08 ± 1.05
GuDREB140.26 ± 0.03 0.13 ± 0.02 0.62 ± 0.08 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.08 ± 0.01 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00
GuDREB15 76.38 ± 9.93 234.19 ± 30.44 112.25 ± 14.60 65.57 ± 8.52 106.33 ± 13.8226.10 ± 3.4016.09 ± 2.1033.96 ± 4.41 17.35 ± 2.26 32.92 ± 4.28
GuDREB16 19.04 ± 2.48 16.86 ± 2.20 21.96 ± 2.85 5.36 ± 0.70 1.78 ± 0.23 4.12 ± 0.54 1.85 ± 0.24 4.81 ± 0.62 3.39 ± 0.44 1.38 ± 0.18
GuDREB170.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.000.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.000.00 ± 0.00 0.00 ± 0.00
GuDREB18 3.33 ± 0.43 0.00 ± 0.000.00 ± 0.000.13 ± 0.02 0.16 ± 0.02 0.45 ± 0.06 0.03 ± 0.01 0.85 ± 0.11 0.06 ± 0.01 0.03 ± 0.01
Note: Data are presented as mean ± standard deviation (SD).
Table 2. Physicochemical properties of DREB transcription factor family proteins in G. uralensis.
Table 2. Physicochemical properties of DREB transcription factor family proteins in G. uralensis.
Gene NameGenomic (bp)CDS (bp)Aliphatic Index Average HydrophilicityLength (aa)pIMw (Da)SublocationInstability Index (II)
GuDREB1 85885865.75−0.8602856.4732,149.59nucl53.48
GuDREB253453460.79−0.6721778.4419,521.95cyto, nucl35.04
GuDREB363063068.18−0.4452095.3823,142.96nucl63.95
GuDREB41509150958.86−0.8975026.6455,106.82nucl53.82
GuDREB576276259.41−0.8412538.6128,264.57nucl47.20
GuDREB669069070.74−0.5072295.3225,572.11cyto, nucl56.38
GuDREB7 115860355.20−0.8162009.3021,799.72cyto, nucl43.40
GuDREB8 69369349.74−0.7152305.1624,845.95nucl65.91
GuDREB9 80180169.70−0.4432665.1329,171.77cyto, nucl52.94
GuDREB10 93393363.94−0.6663107.0334,350.45nucl52.27
GuDREB1162462455.85−0.5432075.6822,747.49nucl60.17
GuDREB12286486158.04−0.6982866.1232,225.61nucl64.33
GuDREB1378978956.68−0.7742625.5928,224.83nucl53.50
GuDREB1471171158.39−0.7662365.3726,557.51nucl65.84
GuDREB15 52552560.11−0.9231749.3219,567.12nucl51.94
GuDREB161925121555.57−0.7134044.9743,894.36nucl38.60
GuDREB1772072064.06−0.6282395.1226,568.61nucl52.37
GuDREB18 81981964.96−0.6262725.2130,668.00nucl70.13
Table 3. Predicted secondary structures of GuDREB proteins.
Table 3. Predicted secondary structures of GuDREB proteins.
Gene Nameα-HelixExtended Strandβ-TurnRandom Coil
GuDREB1 29.47%16.84%9.47%44.21%
GuDREB235.03%13.56%9.04%42.37%
GuDREB329.67%15.31%5.74%49.28%
GuDREB444.02%12.55%7.17%36.25%
GuDREB515.02%22.92%7.11%54.94%
GuDREB629.26%25.33%4.80%40.61%
GuDREB7 37.00%13.50%6.00%43.50%
GuDREB8 22.17%21.30%4.35%52.17%
GuDREB9 26.69%18.05%6.77%48.50%
GuDREB10 23.55%15.48%6.45%54.52%
GuDREB1131.88%17.87%7.73%42.51%
GuDREB12 28.32%19.58%5.94%46.15%
GuDREB13 24.81%12.60%4.96%57.63%
GuDREB1433.05%15.25%5.93%45.76%
GuDREB15 33.91%14.94%4.02%47.13%
GuDREB1633.17%12.87%10.15%43.81%
GuDREB1723.85%25.52%7.11%43.51%
GuDREB18 24.63%25.00%8.46%41.91%
Table 4. MRM parameters for quantification of abscisic acid (ABA) in G. uralensis.
Table 4. MRM parameters for quantification of abscisic acid (ABA) in G. uralensis.
CompoundsRetention Time (min)Relative Molecular Weight/DaIonization ModeMS (m/z)MS2 (m/z)Cone- Voltage/VCollision Energy/eV
Abscisic acid2.00264ESI-263.2153.0 *2212
Note: There are two daughter ions with high response efficiency in glycyrrhiza abscisic acid determined by the liquid mass spectrometry system, where * represents the highest response efficiency and is used as the quantitative ion.
Table 5. Linear parameters for the determination of Abscisic acid contents.
Table 5. Linear parameters for the determination of Abscisic acid contents.
ComponentLinear EquationR2Linear Range (ng·mL−1)
Abscisic acidY = 103.72X − 99.050.99561.2~100
Table 6. Primers used for GuDREB gene expression analysis.
Table 6. Primers used for GuDREB gene expression analysis.
Primer NamePrimer Sequences F (5′-3′)Primer Sequences R (5′-3′)
GuDREB3 GCAGCAAGCACCCAGTTTACCTGCCATTTCAGGGGTAGCA
GuDREB 7GAAAGGGAAAGGAGGACCCGTGTTCGGCTCCCGAATTTCA
GuDREB 8AACCATCAAAGGCTCCTCCGACGAACTCGCTATTCGGGTC
GuDREB 15AGTTGGTGCCAGAGTCGATGAGGTCAAGGCAATCTTCGGG
GuLectinCTGATGCAGAGCTTCAAATCGAGTTCGGAAGGAAGGTTGAGGTAAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheng, L.; Shi, N.; Du, X.; Huang, T.; Zhang, Y.; Zhao, C.; Zhao, K.; Lin, Z.; Ma, D.; Li, Q.; et al. Bioinformatics Analysis and Expression Profiling Under Abiotic Stress of the DREB Gene Family in Glycyrrhiza uralensis. Int. J. Mol. Sci. 2025, 26, 9235. https://doi.org/10.3390/ijms26189235

AMA Style

Cheng L, Shi N, Du X, Huang T, Zhang Y, Zhao C, Zhao K, Lin Z, Ma D, Li Q, et al. Bioinformatics Analysis and Expression Profiling Under Abiotic Stress of the DREB Gene Family in Glycyrrhiza uralensis. International Journal of Molecular Sciences. 2025; 26(18):9235. https://doi.org/10.3390/ijms26189235

Chicago/Turabian Style

Cheng, Linyuan, Nana Shi, Xiangrong Du, Teng Huang, Yaxin Zhang, Chenjie Zhao, Kun Zhao, Zirun Lin, Denglin Ma, Qiuling Li, and et al. 2025. "Bioinformatics Analysis and Expression Profiling Under Abiotic Stress of the DREB Gene Family in Glycyrrhiza uralensis" International Journal of Molecular Sciences 26, no. 18: 9235. https://doi.org/10.3390/ijms26189235

APA Style

Cheng, L., Shi, N., Du, X., Huang, T., Zhang, Y., Zhao, C., Zhao, K., Lin, Z., Ma, D., Li, Q., Wang, F., Yao, H., & Shen, H. (2025). Bioinformatics Analysis and Expression Profiling Under Abiotic Stress of the DREB Gene Family in Glycyrrhiza uralensis. International Journal of Molecular Sciences, 26(18), 9235. https://doi.org/10.3390/ijms26189235

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop