Molecular and Cellular Characterization of Primary Endothelial Cells from a Familial Cavernomatosis Patient
Abstract
1. Introduction
2. Results
2.1. Endothelial Cells from Primary Cultures of the CCM1 Patient and Mutation of the CCM1 Case
2.2. Analysis of Endothelial Gene Differential Expression between Control and Mutated Cells from a Patient with Familial Cavernomatosis Type 1
2.3. CCM1 Endothelial Cells Proliferate Less Than Control Cells
2.4. CCM1-BOECs Show Enhanced Actin Stress Fibers in the Cytoskeleton Compared to C-BOECs
2.5. Functional Analysis in Control and CCM1-BOECs: Wound-Healing Tubulogenesis Assays
3. Discussion
4. Materials and Methods
4.1. Ethics
4.2. Human Samples: Blood Outgrowth Endothelial Cells’ Isolation and Cultivation
4.3. RNA Extraction, Reverse Transcription, and Quantitative PCR
4.4. Proliferation Assay
4.5. Western Blot
4.6. Immunofluorescent Microscopy
4.7. Tubulogenesis: Endothelial Cell Tube Formation Assay
4.8. Wound Healing
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Calandriello, L.; Grimaldi, G.; Petrone, G.; Rigante, M.; Petroni, S.; Riso, M.; Savino, G. Cavernous venous malformation (cavernous hemangioma) of the orbit: Current concepts and a review of the literature. Surv. Ophthalmol. 2017, 62, 393–403. [Google Scholar] [CrossRef]
- Sartages, M.; García-Colomer, M.; Iglesias, C.; Howell, B.W.; Macía, M.J.; Peña, P.; Pombo, C.M.; Zalvide, J. GCKIII (Germinal Center Kinase III) Kinases STK24 and STK25 (Serine/Threonine Kinase 24 and 25) Inhibit Cavernoma Development. Stroke 2022, 53, 976–986. [Google Scholar] [CrossRef]
- Moore, S.A.; Brown, R.S.; Christianson, T.J.; Flemming, K.D. Long-term natural history of incidentally discovered cavernous malformations in a single-center cohort. J. Neurosurg. 2014, 120, 1188–1192. [Google Scholar] [CrossRef]
- Labauge, P.; Brunereau, L.; Levy, C.; Laberge, S.; Houtteville, J.P. The natural history of familial cerebral cavernomas: A retrospective MRI study of 40 patients. Neuroradiology 2000, 42, 327–332. [Google Scholar] [CrossRef]
- Horne, M.; Flemming, K.D.; Su, I.; Stapf, C.; Jeon, J.Y.; Li, D.; Maxwell, S.S.; White, P.J.; Christianson, T.J.; Agid, R.; et al. Clinical course of untreated cerebral cavernous malformations: A meta-analysis of individual patient data. Lancet Neurol. 2016, 15, 166–173. [Google Scholar] [CrossRef]
- Scimone, C.; Bramanti, P.; Alafaci, C.; Granata, F.; Piva, F.; Rinaldi, C.; Donato, L.; Greco, F.; Sidoti, A.; D’Angelo, R. Update on Novel CCM Gene Mutations in Patients with Cerebral Cavernous Malformations. J. Mol. Neurosci. 2017, 61, 189–198. [Google Scholar] [CrossRef]
- Glading, A.; Han, J.; Stockton, R.A.; Ginsberg, M.H. KRIT-1/CCM1 is a Rap1 effector that regulates endothelial cell cell junctions. J. Cell Biol. 2007, 179, 247–254. [Google Scholar] [CrossRef]
- Glading, A.; Ginsberg, M.H. Rap1 and its effector KRIT1/CCM1 regulate β-catenin signaling. DMM Dis. Models Mech. 2010, 3, 73–83. [Google Scholar] [CrossRef]
- Sartages, M. Fisiopatología de las Malformaciones Cavernosas Cerebrales: Papel del EGFR y de las GCKIII Quinasas. Ph.D. Thesis, Centro de Investigación en Medicina Molecular y Enfermedades Crónicas (CiMUS), Universidad de Santiago de Compostela, A Coruña, Spain, 1 April 2022. [Google Scholar]
- Van Nieuw Amerongen, G.P.; Koolwijk, P.; Versteilen, A.M.G.; Van Hinsbergh, V.W. Involvement of RhoA/Rho Kinase Signaling in VEGF-Induced Endothelial Cell Migration and Angiogenesis In Vitro. Arterioscler. Thromb. Vasc. Biol. 2023, 23, 211–217. [Google Scholar] [CrossRef]
- Wojciak-Stothard, B.; Potempa, S.; Eichholtz, T.; Ridley, A.J. Rho and Rac but not Cdc42 regulate endothelial cell permeability. J. Cell Sci. 2001, 114, 1343–1355. [Google Scholar] [CrossRef]
- Gunel, M.; Laurans, M.S.; Shin, D.; DiLuna, M.L.; Voorhees, J.; Choate, K.; Nelson-Williams, C.; Lifton, R.P. KRIT1, a gene mutated in cerebral cavernous malformation, encodes a microtubule-associated protein. Proc. Natl. Acad. Sci. USA 2002, 99, 10677–10682. [Google Scholar] [CrossRef]
- Snellings, D.A.; Hong, C.C.; Ren, A.A.; Lopez-Ramirez, M.A.; Girard, R.; Srinath, A.; Marchuk, D.A.; Ginsberg, M.H.; Awad, I.A.; Kahn, M.L. Cerebral Cavernous Malformation: From Mechanism to Therapy. Circ. Res. 2021, 129, 195–215. [Google Scholar] [CrossRef]
- Dejana, E.; Orsenigo, F.; Lampugnani, M.G. The role of adherens junctions and VE-cadherin in the control of vascular permeability. J. Cell Sci. 2008, 121, 2115–2122. [Google Scholar] [CrossRef]
- Dejana, E.; Orsenigo, F.; Molendini, C.; Baluk, P.; McDonald, D.M. Organization and signaling of endothelial cell-to-cell junctions in various regions of the blood and lymphatic vascular trees. Cell Tissue Res. 2009, 335, 17–25. [Google Scholar] [CrossRef]
- Dejana, E. The Role of Wnt Signaling in Physiological and Pathological Angiogenesis. Circ. Res. 2010, 107, 943–952. [Google Scholar] [CrossRef]
- Sun, F.; Hu, K. Krüppel-Like Factor 4 Inhibits the Transforming Growth Factor-β1-Promoted Epithelial-to-Mesenchymal Transition via Downregulating Plasminogen Activator Inhibitor-1 in Lung Epithelial Cells. Dis. Markers 2015, 2015, 473742. [Google Scholar] [CrossRef]
- Goitre, L.; Balzac, F.; Degani, S.; Degan, P.; Marchi, S.; Pinton, P.; Retta, S.F. KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species. PLoS ONE 2010, 5, e11786. [Google Scholar] [CrossRef]
- Koskimaki, J.; Girard, R.; Li, Y.; Saadat, L.; Zeineddine, H.A.; Lightle, R.; Moore, T.; Lyne, S.; Avner, K.; Shenkar, R.; et al. Comprehensive transcriptome analysis of cerebral cavernous malformation across multiple species and genotypes. JCI Insight 2019, 4, e126167. [Google Scholar] [CrossRef]
- Li, Y.; Girard, R.; Srinath, A.; Cruz, A.V.; Ciszewski, C.; Chen, C.; Lightle, R.; Romanos, S.; Sone, J.Y.; Moore, T.; et al. Transcriptomic signatures of individual cell types in cerebral cavernous malformation. Cell Commun. Signal 2024, 22, 23. [Google Scholar] [CrossRef]
- Gore, A.V.; Lampugnani, M.G.; Dye, L.; Dejana, E.; Weinstein, B.M. Combinatorial interaction between CCM pathway genes precipitates hemorrhagic stroke. DMM Dis. Model. Mech. 2008, 1, 275–281. [Google Scholar] [CrossRef]
- Whitehead, K.J.; Chan, A.C.; Navankasattusas, S.; Koh, W.; London, N.R.; Ling, J.; Mayo, A.H.; Drakos, S.G.; Jones, C.A.; Zhu, W.; et al. The cerebral cavernous malformation signaling pathway promotes vascular integrity via Rho GTPases. Nat. Med. 2009, 15, 177–184. [Google Scholar] [CrossRef]
- Bayless, K.J.; Davis, G.E. Microtubule depolymerization rapidly collapses capillary tube networks in vitro and angiogenic vessels in vivo through the small GTPase Rho. J. Biol. Chem. 2004, 279, 11686–11695. [Google Scholar] [CrossRef]
- Girard, R.; Khanna, O.; Shenkar, R.; Zhang, L.; Wu, M.; Jesselson, M.; Zeineddine, H.A.; Gangal, A.; Fam, M.D.; Gibson, C.C. Peripheral plasma vitamin D and non-HDL cholesterol reflect the severity of cerebral cavernous malformation disease. Biomark. Med. 2016, 10, 255–264. [Google Scholar] [CrossRef] [PubMed]
- Polster, S.P.; Cao, Y.; Carroll, T.; Flemming, K.; Girard, R.; Hanley, D.; Hobson, N.; Kim, H.; Koenig, J.; Koskimaki, J. Trial Readiness in Cavernous Angiomas with Symptomatic Hemorrhage (CASH). Neurosurgery 2019, 84, 954–964. [Google Scholar] [CrossRef]
- Polster, S.P.; Stadnik, A.; Akers, A.L.; Cao, Y.; Christoforidis, G.A.; Fam, M.D.; Flemming, K.D.; Girard, R.; Hobson, N.; Koenig, J.I. Atorvastatin Treatment of Cavernous Angiomas with Symptomatic Hemorrhage Exploratory Proof of Concept (AT CASH EPOC) Trial. Neurosurgery 2019, 85, 843–853. [Google Scholar] [CrossRef]
- Cuesta, A.M.; Gallardo-Vara, E.; Casado-Vela, J.; Recio-Poveda, L.; Botella, L.M.; Albiñana, V. The Role of Propranolol as a Repurposed Drug in Rare Vascular Diseases. Int. J. Mol. Sci. 2022, 23, 4217. [Google Scholar] [CrossRef]
- Albiñana, V.; Gallardo-Vara, E.; Casado-Vela, J.; Recio-Poveda, L.; Botella, L.M.; Cuesta, A.M. Propranolol: A “Pick and Roll” Team Player in Benign Tumors and Cancer Therapies. J. Clin. Med. 2022, 11, 4539. [Google Scholar] [CrossRef]
- Fernandez-L, A.; Sanz-Rodriguez, F.; Zarrabeitia, R.; Pérez-Molino, A.; Hebbel, R.P.; Nguyen, J.; Bernabéu, C.; Botella, L. Blood outgrowth endothelial cells from Hereditary Haemorrhagic Telangiectasia patients reveal abnormalities compatible with vascular lesions. Cardiovasc. Res. 2005, 68, 235–248. [Google Scholar] [CrossRef]






| Gene | Fwd 5′–3′ | Rev 5′–3′ |
|---|---|---|
| 18S | CTCAACACGGGAAACCTCAC | CGCTCCACCAACTAAGAACG |
| ENG | AGCCACATCGCTCAGACAC | GCCAATACGACCAAATCC |
| CCM1 | CTGTAAGAACATGCGCTGAAG | TCCATCGTACCTGTTACCAAAC |
| ANGPT2 | TGCAAATGTTCACAAATGCTAA | AAGTTGGAAGGACCACATGC |
| CCNB2 | TGGAAAAGTTGGCTCCAAAG | CTTCCTTCATGGAGACATCCTC |
| PECAM-1 | AGAAAACCACTGCAGAGTACCAG | GGCCTCTTTCTTGTCCAGTGT |
| PTGS2 | TCACGCATCAGTTTTTCAAGA | TCACCGTAAATATGATTTAAGTCCAC |
| KDR | GAGTGAGGAAGGAGGACGAAGG | CCGTAGGATGATGACAAGAAGTAGC |
| NOS3 | GACCCTCACCGCTACAACAT | CCGGGTATCCAGGTCCAT |
| CDH5 | GGAGGAGCTCACTGTGGATT | CTGATGCAGCAAGGACAGC |
| SERPINE-1 | TCCAGCAGCTGAATTCCTG | GCTGGAGACATCTGCATCCT |
| Ki67 | GAAAGAGTGGCAACCTGCCTTC | GCACCAAGTTTTACTACATCTGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lorente-Herraiz, L.; Cuesta, A.M.; Granado, J.; Recio-Poveda, L.; Botella, L.-M.; Albiñana, V. Molecular and Cellular Characterization of Primary Endothelial Cells from a Familial Cavernomatosis Patient. Int. J. Mol. Sci. 2024, 25, 3952. https://doi.org/10.3390/ijms25073952
Lorente-Herraiz L, Cuesta AM, Granado J, Recio-Poveda L, Botella L-M, Albiñana V. Molecular and Cellular Characterization of Primary Endothelial Cells from a Familial Cavernomatosis Patient. International Journal of Molecular Sciences. 2024; 25(7):3952. https://doi.org/10.3390/ijms25073952
Chicago/Turabian StyleLorente-Herraiz, Laura, Angel M. Cuesta, Jaime Granado, Lucía Recio-Poveda, Luisa-María Botella, and Virginia Albiñana. 2024. "Molecular and Cellular Characterization of Primary Endothelial Cells from a Familial Cavernomatosis Patient" International Journal of Molecular Sciences 25, no. 7: 3952. https://doi.org/10.3390/ijms25073952
APA StyleLorente-Herraiz, L., Cuesta, A. M., Granado, J., Recio-Poveda, L., Botella, L.-M., & Albiñana, V. (2024). Molecular and Cellular Characterization of Primary Endothelial Cells from a Familial Cavernomatosis Patient. International Journal of Molecular Sciences, 25(7), 3952. https://doi.org/10.3390/ijms25073952

