Hypolipidemic Effect of Rice Bran Oil Extract Tocotrienol in High-Fat Diet-Induced Hyperlipidemia Zebrafish (Danio Rerio) Induced by High-Fat Diet
Abstract
1. Introduction
2. Results
2.1. T3 Safe Concentration (MNLC) Test
2.1.1. Effects of T3 on Reducing Triglycerides and Cholesterol in Zebrafish Larvae
2.1.2. Detection of Triglycerides and Cholesterol in the Liver of Adult Zebrafish
2.2. Vascular Thickness of the Lens Vascular System in the Eye of Zebrafish Larvae
2.3. Protein Expression Levels of Pparγ and Rxrα in Adult Zebrafish
2.4. Effects of T3 on the mRNA Expression of Lipid Metabolism-Related Genes in the Liver of Adult Zebrafish
2.4.1. Lipid Analysis of the Adult Zebrafish Liver
2.4.2. Comparative Analysis of the Liver Lipid Differences between the HFD Group and T3 Group
3. Discussion
4. Materials and Methods
4.1. Zebrafish Experimental Conditions and T3 Maximal Non-Lethal Concentration (MNLC) Test
4.2. Main Reagents
4.3. Construction and Verification of the Zebrafish T2MD Model
4.4. Effects of T3 on Reducing Triglycerides, Cholesterol, and Vessel Wall Thickness in Zebrafish Larvae
4.5. Effects of T3 on the Lipid Metabolism Pathway in Adult Zebrafish
4.6. Effects of T3 on the Expression of Lipid Metabolism-Related Genes in the Liver of Adult Zebrafish
4.7. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Qiao, W.; Liu, Y.; Zhao, J.; Liu, Q.; Yang, K.; Zhang, M.; Wang, Y.; Liu, Y.; Chen, L. Quantification of phospholipids and glycerides in human milk using ultra-performance liquid chromatography with quadrupole-time-of-flight mass spectrometry. Front. Chem. 2022, 10, 1101557. [Google Scholar] [CrossRef]
- Shi, Y.; Hu, Y.; Wang, Z.; Zhou, J.; Zhang, J.; Zhong, H.; Fu, G.; Zhong, L. The Protective Effect of Taurine on Oxidized Fish-Oil-Induced Liver Oxidative Stress and Intestinal Barrier-Function Impairment in Juvenile Ictalurus punctatus. Antioxidants 2021, 10, 1690. [Google Scholar] [CrossRef] [PubMed]
- Lim, U.; Turner, S.D.; Franke, A.A.; Cooney, R.V.; Wilkens, L.R.; Ernst, T.; Albright, C.L.; Novotny, R.; Chang, L.; Kolonel, L.N.; et al. Predicting total, abdominal, visceral and hepatic adiposity with circulating biomarkers in Caucasian and Japanese American women. PLoS ONE 2012, 7, e43502. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Zhang, P.; Xue, M.; Zhang, M.; Xiao, Z.; Xu, C.; Fan, Y.; Liu, W.; Wu, Y.; Wu, M.; et al. Anti-inflammatory and antioxidant properties of rice bran oil extract in copper sulfate-induced inflammation in zebrafish (Danio rerio). Fish Shellfish Immunol. 2023, 136, 108740. [Google Scholar] [CrossRef]
- Rana, R.; Shearer, A.M.; Fletcher, E.K.; Nguyen, N.; Guha, S.; Cox, D.H.; Abdelmalek, M.; Wang, Y.; Baleja, J.D.; Covic, L.; et al. PAR2 controls cholesterol homeostasis and lipid metabolism in nonalcoholic fatty liver disease. Mol. Metab. 2019, 29, 99–113. [Google Scholar] [CrossRef]
- Fei, H.; Cheng, Y.; Zhang, H.; Yu, X.; Yi, S.; Huang, M.; Yang, S. Effect of Autolyzed Yarrowia lipolytica on the Growth Performance, Antioxidant Capacity, Intestinal Histology, Microbiota, and Transcriptome Profile of Juvenile Largemouth Bass (Micropterus salmoides). Int. J. Mol. Sci. 2022, 23, 10780. [Google Scholar] [CrossRef] [PubMed]
- Reveco-Urzua, F.E.; Hofossæter, M.; Rao Kovi, M.; Mydland, L.T.; Ånestad, R.; Sørby, R.; Press, C.M.; Lagos, L.; Øverland, M. Candida utilis yeast as a functional protein source for Atlantic salmon (Salmo salar L.): Local intestinal tissue and plasma proteome responses. PLoS ONE 2019, 14, e0218360. [Google Scholar] [CrossRef] [PubMed]
- Ge, Y.; Zhang, L.; Chen, W.; Sun, M.; Liu, W.; Li, X. Resveratrol Modulates the Redox Response and Bile Acid Metabolism to Maintain the Cholesterol Homeostasis in Fish Megalobrama amblycephala Offered a High-Carbohydrate Diet. Antioxidants 2023, 12, 121. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Dong, P.Y.; Ma, H.H.; Liang, S.L.; Li, L.; Zhang, X.F. Antioxidant and Biological Activities of the Lotus Root Polysaccharide-Iron (III) Complex. Molecules 2022, 27, 7106. [Google Scholar] [CrossRef]
- Darme, P.; Spalenka, J.; Hubert, J.; Escotte-Binet, S.; Debelle, L.; Villena, I.; Sayagh, C.; Borie, N.; Martinez, A.; Bertaux, B.; et al. Investigation of Antiparasitic Activity of 10 European Tree Bark Extracts on Toxoplasma gondii and Bioguided Identification of Triterpenes in Alnus glutinosa Barks. Antimicrob. Agents Chemother. 2022, 66, e0109821. [Google Scholar] [CrossRef]
- Li, J.; Islam, S.; Guo, P.; Hu, X.; Dong, W. Isolation of Antimicrobial Genes from Oryza rufipogon Griff by Using a Bacillus subtilis Expression System with Potential Antimicrobial Activities. Int. J. Mol. Sci. 2020, 21, 8722. [Google Scholar] [CrossRef]
- Liu, F.; Xiang, N.; Hu, J.G.; Shijuan, Y.; Xie, L.; Brennan, C.S.; Huang, W.; Guo, X. The manipulation of gene expression and the biosynthesis of Vitamin C, E and folate in light-and dark-germination of sweet corn seeds. Sci. Rep. 2017, 7, 7484. [Google Scholar] [CrossRef]
- Shen, B.; Zhou, P.; Jiao, X.; Yao, Z.; Ye, L.; Yu, H. Fermentative production of Vitamin E tocotrienols in Saccharomyces cerevisiae under cold-shock-triggered temperature control. Nat. Commun. 2020, 11, 5155. [Google Scholar] [CrossRef]
- Matsunaga, T.; Shoji, A.; Gu, N.; Joo, E.; Li, S.; Adachi, T.; Yamazaki, H.; Yasuda, K.; Kondoh, T.; Tsuda, K. γ-Tocotrienol attenuates TNF-α-induced changes in secretion and gene expression of MCP-1, IL-6 and adiponectin in 3T3-L1 adipocytes. Mol. Med. Rep. 2012, 5, 905–909. [Google Scholar] [CrossRef]
- Starowicz, M.; Arpaci, S.; Topolska, J.; Wronkowska, M. Phytochemicals and Antioxidant Activity in Oat-Buckwheat Dough and Cookies with Added Spices or Herbs. Molecules 2021, 26, 2267. [Google Scholar] [CrossRef]
- Alvarez, Y.; Cederlund, M.L.; Cottell, D.C.; Bill, B.R.; Ekker, S.C.; Torres-Vazquez, J.; Weinstein, B.M.; Hyde, D.R.; Vihtelic, T.S.; Kennedy, B.N. Genetic determinants of hyaloid and retinal vasculature in zebrafish. BMC Dev. Biol. 2007, 7, 114. [Google Scholar] [CrossRef]
- Zou, J.; Wang, X.; Wei, X. Crb apical polarity proteins maintain zebrafish retinal cone mosaics via intercellular binding of their extracellular domains. Dev. Cell 2012, 22, 1261–1274. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Shan, F.; Liu, M.; Liu, B.; Zhou, Q.; Zheng, X.; Xu, X. High-Fat-Diet-Induced Oxidative Stress in Giant Freshwater Prawn (Macrobrachium rosenbergii) via NF-κB/NO Signal Pathway and the Amelioration of Vitamin E. Antioxidants 2022, 11, 228. [Google Scholar] [CrossRef] [PubMed]
- Brunton, L.A.; Desbois, A.P.; Garza, M.; Wieland, B.; Mohan, C.V.; Häsler, B.; Tam, C.C.; Le, P.N.T.; Phuong, N.T.; Van, P.T.; et al. Identifying hotspots for antibiotic resistance emergence and selection, and elucidating pathways to human exposure: Application of a systems-thinking approach to aquaculture systems. Sci. Total Environ. 2019, 687, 1344–1356. [Google Scholar] [CrossRef] [PubMed]
- Okocha, R.C.; Olatoye, I.O.; Adedeji, O.B. Food safety impacts of antimicrobial use and their residues in aquaculture. Public Health Rev. 2018, 39, 21. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Wang, S.; Tian, Y.; Zhou, N.; Wu, C.; Li, R.; Xu, W.; Xu, T.; Gu, L.; Ji, F.; et al. Effects of Hydroxylated Lecithin on Growth Performance, Serum Enzyme Activity, Hormone Levels Related to Lipid Metabolism and Meat Quality in Jiangnan White Goslings. Front. Vet. Sci. 2022, 9, 829338. [Google Scholar] [CrossRef] [PubMed]
- Rohani, M.F.; Tarin, T.; Hasan, J.; Islam, S.M.M.; Shahjahan, M. Vitamin E supplementation in diet ameliorates growth of Nile tilapia by upgrading muscle health. Saudi J. Biol. Sci. 2023, 30, 103558. [Google Scholar] [CrossRef]
- Liang, X.; Chen, P.; Wu, X.; Xing, S.; Morais, S.; He, M.; Gu, X.; Xue, M. Effects of High Starch and Supplementation of an Olive Extract on the Growth Performance, Hepatic Antioxidant Capacity and Lipid Metabolism of Largemouth Bass (Micropterus salmoides). Antioxidants 2022, 11, 577. [Google Scholar] [CrossRef] [PubMed]
- Cindrova-Davies, T.; Spasic-Boskovic, O.; Jauniaux, E.; Charnock-Jones, D.S.; Burton, G.J. Nuclear factor-kappa B, p38, and stress-activated protein kinase mitogen-activated protein kinase signaling pathways regulate proinflammatory cytokines and apoptosis in human placental explants in response to oxidative stress: Effects of antioxidant vitamins. Am. J. Pathol. 2007, 170, 1511–1520. [Google Scholar]
- Abolfathi, A.A.; Mohajeri, D.; Rezaie, A.; Nazeri, M. Protective Effects of Green Tea Extract against Hepatic Tissue Injury in Streptozotocin-Induced Diabetic Rats. Evid.-Based Complement. Altern. Med. ECAM 2012, 2012, 740671. [Google Scholar] [CrossRef]
- Gu, L.; Surolia, R.; Larson-Casey, J.L.; He, C.; Davis, D.; Kang, J.; Antony, V.B.; Carter, A.B. Targeting Cpt1a-Bcl-2 interaction modulates apoptosis resistance and fibrotic remodeling. Cell Death Differ. 2022, 29, 118–132. [Google Scholar] [CrossRef]
- Yuan, Y.; Naito, H.; Jia, X.; Kitamori, K.; Nakajima, T. Combination of Hypertension Along with a High Fat and Cholesterol Diet Induces Severe Hepatic Inflammation in Rats via a Signaling Network Comprising NF-κB, MAPK, and Nrf2 Pathways. Nutrients 2017, 9, 1018. [Google Scholar] [CrossRef] [PubMed]
- Lai, C.Q.; Parnell, L.D.; Smith, C.E.; Guo, T.; Sayols-Baixeras, S.; Aslibekyan, S.; Tiwari, H.K.; Irvin, M.R.; Bender, C.; Fei, D.; et al. Carbohydrate and fat intake associated with risk of metabolic diseases through epigenetics of CPT1A. Am. J. Clin. Nutr. 2020, 112, 1200–1211. [Google Scholar] [CrossRef]
- Gong, R.; Lv, X.; Liu, F. MiRNA-17 encoded by the miR-17-92 cluster increases the potential for steatosis in hepatoma cells by targeting CYP7A1. Cell. Mol. Biol. Lett. 2018, 23, 16. [Google Scholar] [CrossRef]
- Spracklen, C.N.; Chen, P.; Kim, Y.J.; Wang, X.; Cai, H.; Li, S.; Long, J.; Wu, Y.; Wang, Y.X. Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels. Hum. Mol. Genet. 2017, 26, 1770–1784. [Google Scholar] [CrossRef]
- Huang, L.; Chen, J.; Cao, P.; Pan, H.; Ding, C.; Xiao, T.; Zhang, P.; Guo, J.; Su, Z. Anti-obese effect of glucosamine and chitosan oligosaccharide in high-fat diet-induced obese rats. Mar. Drugs 2015, 13, 2732–2756. [Google Scholar] [CrossRef]
- Narrandes, S.; Huang, S.; Murphy, L.; Xu, W. The exploration of contrasting pathways in Triple Negative Breast Cancer (TNBC). BMC Cancer 2018, 18, 22. [Google Scholar] [CrossRef]
- Zhang, K.; Yang, X.; Zheng, M.; Ning, Y.; Zhang, S. Acetylated-PPARγ expression is regulated by different P53 genotypes associated with the adipogenic differentiation of polyploid giant cancer cells with daughter cells. Cancer Biol. Med. 2023, 20, 56–76. [Google Scholar] [CrossRef]
- Jiang, P.; Zhang, X.; Huang, Y.; Cheng, N.; Ma, Y. Hepatotoxicity Induced by Sophora flavescens and Hepatic Accumulation of Kurarinone, a Major Hepatotoxic Constituent of Sophora flavescens in Rats. Molecules 2017, 22, 1809. [Google Scholar] [CrossRef]
- Le Fol, V.; Brion, F.; Hillenweck, A.; Perdu, E.; Bruel, S.; Aït-Aïssa, S.; Cravedi, J.P.; Zalko, D. Comparison of the In Vivo Biotransformation of Two Emerging Estrogenic Contaminants, BP2 and BPS, in Zebrafish Embryos and Adults. Int. J. Mol. Sci. 2017, 18, 704. [Google Scholar] [CrossRef]
- Kim, K.; Bae, G.D.; Lee, M.; Park, E.Y.; Baek, D.J.; Kim, C.Y.; Jun, H.S.; Oh, Y.S. Allomyrina dichotoma Larva Extract Ameliorates the Hepatic Insulin Resistance of High-Fat Diet-Induced Diabetic Mice. Nutrients 2019, 11, 1522. [Google Scholar] [CrossRef]
- Forsthoefel, D.J.; James, N.P.; Escobar, D.J.; Stary, J.M.; Vieira, A.P.; Waters, F.A.; Newmark, P.A. An RNAi screen reveals intestinal regulators of branching morphogenesis, differentiation, and stem cell proliferation in planarians. Dev. Cell 2012, 23, 691–704. [Google Scholar] [CrossRef] [PubMed]
- Asimakopoulou, A.; Engel, K.M.; Gassler, N.; Bracht, T.; Site, B.; Buhl, E.M.; Kalampoka, S.; Pinoé-Schmidt, M.; van Helden, J.; Schiller, J.; et al. Deletion of Perilipin 5 Protects Against Hepatic Injury in Nonalcoholic Fatty Liver Disease via Missing Inflammasome Activation. Cells 2020, 9, 1346. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Cai, Y.L.; Yang, Y.; Hu, H.M.; Yao, Y.; Yang, J.; Deng, J.J.; Wan, L. Vitamin D ameliorates insulin resistance-induced osteopenia by inactivating the nucleotide-binding oligomerization domain-like receptor protein 3 inflammasome. Heliyon 2023, 9, e13215. [Google Scholar] [CrossRef] [PubMed]
- Heinitz, S.; Basolo, A.; Piomelli, D.; Krakoff, J.; Piaggi, P. Endocannabinoid Anandamide Mediates the Effect of Skeletal Muscle Sphingomyelins on Human Energy Expenditure. J. Clin. Endocrinol. Metab. 2018, 103, 3757–3766. [Google Scholar] [CrossRef]










| Gene Name | Primer F (5′-3′) | Primer R (5′-3′) |
|---|---|---|
| Cpt-1a | TGCGGTCTTGCACTACAGAG | GTGGACAGTCTCCAAGGCTC |
| Hmgcr | TCGTGGAGTGCCTGGTGATTGGT | TGGGTCTGCCTTCTCTGCTCTCTC |
| PPARγ | TGGAGCCCAAGTTTCAGTTCGC | GTATGAGTTGTGCATGTTCGGTC |
| Cyp7a1 | GCTCTACTTCCACCTGATT | ATGTCTTCTGCGTATTCCT |
| β-actin | TGGAGCCCAAGTTTCAGTTCGC | GTATGAGTTGTGCATGTTCGGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, N.; Zhang, P.; Xue, M.; Zhang, M.; Huang, Z.; Xu, C.; Meng, Y.; Fan, Y.; Liu, W.; Zhang, F.; et al. Hypolipidemic Effect of Rice Bran Oil Extract Tocotrienol in High-Fat Diet-Induced Hyperlipidemia Zebrafish (Danio Rerio) Induced by High-Fat Diet. Int. J. Mol. Sci. 2024, 25, 2954. https://doi.org/10.3390/ijms25052954
Liu N, Zhang P, Xue M, Zhang M, Huang Z, Xu C, Meng Y, Fan Y, Liu W, Zhang F, et al. Hypolipidemic Effect of Rice Bran Oil Extract Tocotrienol in High-Fat Diet-Induced Hyperlipidemia Zebrafish (Danio Rerio) Induced by High-Fat Diet. International Journal of Molecular Sciences. 2024; 25(5):2954. https://doi.org/10.3390/ijms25052954
Chicago/Turabian StyleLiu, Naicheng, Peng Zhang, Mingyang Xue, Mengwei Zhang, Zhenyu Huang, Chen Xu, Yan Meng, Yuding Fan, Wei Liu, Feixiang Zhang, and et al. 2024. "Hypolipidemic Effect of Rice Bran Oil Extract Tocotrienol in High-Fat Diet-Induced Hyperlipidemia Zebrafish (Danio Rerio) Induced by High-Fat Diet" International Journal of Molecular Sciences 25, no. 5: 2954. https://doi.org/10.3390/ijms25052954
APA StyleLiu, N., Zhang, P., Xue, M., Zhang, M., Huang, Z., Xu, C., Meng, Y., Fan, Y., Liu, W., Zhang, F., Chen, P., & Zhou, Y. (2024). Hypolipidemic Effect of Rice Bran Oil Extract Tocotrienol in High-Fat Diet-Induced Hyperlipidemia Zebrafish (Danio Rerio) Induced by High-Fat Diet. International Journal of Molecular Sciences, 25(5), 2954. https://doi.org/10.3390/ijms25052954

