Immunomodulatory Effects of SPHK1 and Its Interaction with TFAP2A in Yellow Drum (Nibea albiflora)
Abstract
1. Introduction
2. Results
2.1. Structure and Subcellular Localization Analysis of Ydsphk1
2.2. RNA-Seq Analysis of Ydsphk1 Overexpression Effects
2.3. Promoter Activity of Ydsphk1
2.4. Regulation of Ydsphk1 by TFAP2A
3. Discussion
4. Materials and Methods
4.1. Gene Characterization
4.2. RNA Extraction and cDNA Synthesis
4.3. Subcellular Localization of YDSPHK1
4.4. Transcriptome Sequencing and Differentially Expressed Genes (DGEs) Analysis
4.5. Promoter Analysis of Ydsphk1
4.6. TFAP2A Binding Site Prediction
4.7. Regulatory Effect of TFAP2A on Ydsphk1 Promoter Activity
4.8. Real-Time qRT-PCR
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, G.; Han, Z.; Jiang, D.; Li, W.; Zhang, W.; Ye, K.; Gu, L.; Dong, L.; Fang, M.; Wang, Z. Genome-Wide Association Study Identifies Loci for Traits Related to Swim Bladder in Yellow Drum (Nibea albiflora). Aquaculture 2020, 526, 735327. [Google Scholar] [CrossRef]
- Xiang, J.; Chen, R.; Xu, D.; Sun, Y.; Liu, H. Characterization of Pathological Changes and Immune-Related Gene Expression in Yellow Drum (Nibea albiflora) in Response to Pseudomonas Plecoglossicida and Poly I:C Challenge. Aquac. Rep. 2020, 17, 100350. [Google Scholar] [CrossRef]
- Yin, F.; Liu, W.; Bao, P.; Tang, B. Food Intake, Survival, and Immunity of Nibea Albiflora to Cryptocaryon Irritans Infection. Parasitol. Res. 2018, 117, 2379–2384. [Google Scholar] [CrossRef] [PubMed]
- Luo, S.; Li, W.; Xie, Y.; Wu, B.; Sun, Y.; Tian, Q.; Wang, Z.; Han, F. A Molecular Insight into the Resistance of Yellow Drum to Vibrio Harveyi by Genome-Wide Association Analysis. Aquaculture 2021, 543, 736998. [Google Scholar] [CrossRef]
- Wu, B.; Song, Q.; Li, W.; Xie, Y.; Luo, S.; Tian, Q.; Zhao, R.; Liu, T.; Wang, Z.; Han, F. Characterization and Functional Study of a Chimera Galectin from Yellow Drum Nibea Albiflora. Int. J. Biol. Macromol. 2021, 187, 361–372. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, S.; Milstien, S. Sphingosine-1-Phosphate: An Enigmatic Signalling Lipid. Nat. Rev. Mol. Cell Biol. 2003, 4, 397–407. [Google Scholar] [CrossRef]
- Alemany, R.; van Koppen, C.J.; Danneberg, K.; ter Braak, M.; zu Heringdorf, D.M. Regulation and Functional Roles of Sphingosine Kinases. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2007, 374, 413–428. [Google Scholar] [CrossRef] [PubMed]
- Linn, S.; Kim, H.; Keane, E.; Andras, L.; Wang, E.; Merrill, A. Regulation of de Novo Sphingolipid Biosynthesis and the Toxic Consequences of Its Disruption. Biochem. Soc. Trans. 2001, 29, 831–835. [Google Scholar] [CrossRef] [PubMed]
- Maceyka, M.; Spiegel, S. Sphingolipid Metabolites in Inflammatory Disease. Nature 2014, 510, 58–67. [Google Scholar] [CrossRef]
- Meyer zu Heringdorf, D.; Jakobs, K.H. Lysophospholipid Receptors: Signalling, Pharmacology and Regulation by Lysophospholipid Metabolism. Biochim. Biophys. Acta (BBA) Biomembr. 2007, 1768, 923–940. [Google Scholar] [CrossRef]
- Spiegel, S.; Milstien, S. The Outs and the Ins of Sphingosine-1-Phosphate in Immunity. Nat. Rev. Immunol. 2011, 11, 403–415. [Google Scholar] [CrossRef] [PubMed]
- Maceyka, M.; Harikumar, K.B.; Milstien, S.; Spiegel, S. Sphingosine-1-Phosphate Signaling and Its Role in Disease. Trends Cell Biol. 2012, 22, 50–60. [Google Scholar] [CrossRef]
- Wymann, M.P.; Schneiter, R. Lipid Signalling in Disease. Nat. Rev. Mol. Cell Biol. 2008, 9, 162–176. [Google Scholar] [CrossRef]
- Young, K.; Nahorski, S. Intracellular Sphingosine 1-Phosphate Production: A Novel Pathway for Ca2+ Release. Semin. Cell Dev. Biol. 2001, 12, 19–25. [Google Scholar] [CrossRef]
- Blaho, V.A.; Hla, T. An Update on the Biology of Sphingosine 1-Phosphate Receptors. J. Lipid Res. 2014, 55, 1596–1608. [Google Scholar] [CrossRef] [PubMed]
- Payne, S.G.; Milstien, S.; Spiegel, S. Sphingosine-1-Phosphate: Dual Messenger Functions. FEBS Lett. 2002, 531, 54–57. [Google Scholar] [CrossRef] [PubMed]
- Takuwa, Y.; Takuwa, N.; Sugimoto, N. The Edg Family G Protein-Coupled Receptors for Lysophospholipids: Their Signaling Properties and Biological Activities. J. Biochem. 2002, 131, 767–771. [Google Scholar] [CrossRef]
- Pulkoski-Gross, M.J.; Donaldson, J.C.; Obeid, L.M. Sphingosine-1-Phosphate Metabolism: A Structural Perspective. Crit. Rev. Biochem. Mol. Biol. 2015, 50, 298–313. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Sugiura, M.; Nava, V.E.; Edsall, L.C.; Kono, K.; Poulton, S.; Milstien, S.; Kohama, T.; Spiegel, S. Molecular Cloning and Functional Characterization of a Novel Mammalian Sphingosine Kinase Type 2 Isoform. J. Biol. Chem. 2000, 275, 19513–19520. [Google Scholar] [CrossRef]
- Lavieu, G.; Scarlatti, F.; Sala, G.; Carpentier, S.; Levade, T.; Ghidoni, R.; Botti, J.; Codogno, P. Regulation of autophagy by sphingosine kinase 1 and its role in cell survival during nutrient starvation. J. Biol. Chem. 2006, 281, 8518–8527. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Cai, H.; Ren, L.; Yang, Y.; Yang, H.; Liu, J.; Li, S.; Zhang, Y.; Zheng, X.; Tan, W.; et al. Sphingosine kinase 1 promotes growth of glioblastoma by increasing inflammation mediated by the NF-κB/IL-6/STAT3 and JNK/PTX3 pathways. Acta Pharm. Sin. B. 2022, 12, 4390–4406. [Google Scholar] [CrossRef] [PubMed]
- Wen, M.; Sun, X.; Pan, L.; Jing, S.; Zhang, X.; Liang, L.; Xiao, H.; Liu, P.; Xu, Z.; Zhang, Q.; et al. Dihydromyricetin ameliorates diabetic renal fibrosis via regulating SphK1 to suppress the activation of NF-κB pathway. Eur. J. Pharmacol. 2024, 978, 176799. [Google Scholar] [CrossRef]
- Huang, L.; Han, F.; Huang, Y.; Liu, J.; Liao, X.; Cao, Z.; Li, W. Sphk1 Deficiency Induces Apoptosis and Developmental Defects and Premature Death in Zebrafish. Fish. Physiol. Biochem. 2023, 49, 737–750. [Google Scholar] [CrossRef]
- Zhao, X.; Zhang, Y.; Gao, T.; Song, N. Spleen Transcriptome Profiling Reveals Divergent Immune Responses to LPS and Poly (I:C) Challenge in the Yellow Drum (Nibea albiflora). Int. J. Mol. Sci. 2023, 24, 7735. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Yang, M.; Liu, J.; Zheng, L.; Xu, D.; Chi, C.; Lv, Z.; Liu, H. Identification, functional characterization and expression pattern of myeloid differentiation factor 88 (MyD88) in Nibea albiflora. Fish Shellfish. Immunol. 2022, 124, 380–390. [Google Scholar] [CrossRef] [PubMed]
- Morang, S.; Thapliyal, S.; Upadhyay, V.; Khichi, S.; Mamgain, M.; Gogoi, T.; Bisht, M.; Handu, S. Is Sphingosine Kinase 1 Associated with Hematological Malignancy? A Systematic Review and Meta-Analysis. Asian Pac. J. Cancer Prev. 2024, 25, 2605–2613. [Google Scholar] [CrossRef]
- Kim, K.M.; Shin, E.J.; Yang, J.H.; Ki, S.H. Integrative Roles of Sphingosine Kinase in Liver Pathophysiology. Toxicol. Res. 2023, 39, 549–564. [Google Scholar] [CrossRef]
- Lu, Z.; Xiao, Z.; Yang, Z.; Li, J.; Feng, G.; Chen, F.; Li, Y.; Feng, J.; Gao, Y.; Ye, L.; et al. Hepatitis B Virus X Protein Promotes Human Hepatoma Cell Growth via Upregulation of Transcription Factor AP2α and Sphingosine Kinase 1. Acta Pharmacol. Sin. 2015, 36, 1228–1236. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.; Sun, C.; Chen, X.; Yang, R.; Luan, Y.; Zhao, X.; Yu, P.; Luo, R.; Hou, Y.; Tian, R.; et al. NSUN5/TET2-Directed Chromatin-Associated RNA Modification of 5-Methylcytosine to 5-Hydroxymethylcytosine Governs Glioma Immune Evasion. Proc. Natl. Acad. Sci. USA 2024, 121, e2321611121. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Zhao, F.; Li, J.; Sun, X.; Zhang, X.; Wang, H.; Fan, P.; Lai, L.; Li, Z.; Sui, T. Programmable RNA 5-Methylcytosine (m5C) Modification of Cellular RNAs by dCasRx Conjugated Methyltransferase and Demethylase. Nucleic Acids Res. 2024, 52, 2776–2791. [Google Scholar] [CrossRef] [PubMed]
- Nombela, P.; Miguel-López, B.; Blanco, S. The Role of m6A, m5C and Ψ RNA Modifications in Cancer: Novel Therapeutic Opportunities. Mol. Cancer 2021, 20, 18. [Google Scholar] [CrossRef] [PubMed]
- Zuehlke, A.D.; Beebe, K.; Neckers, L.; Prince, T. Regulation and Function of the Human HSP90AA1 Gene. Gene 2015, 570, 8–16. [Google Scholar] [CrossRef]
- Tian, W.-L.; He, F.; Fu, X.; Lin, J.-T.; Tang, P.; Huang, Y.-M.; Guo, R.; Sun, L. High Expression of Heat Shock Protein 90 Alpha and Its Significance in Human Acute Leukemia Cells. Gene 2014, 542, 122–128. [Google Scholar] [CrossRef]
- Song, K.-H.; Oh, S.J.; Kim, S.-Y.; Cho, H.; Lee, H.-J.; Song, J.S.; Chung, J.-Y.; Cho, E.; Lee, J.; Jeon, S.; et al. HSP90A Inhibition Promotes Anti-Tumor Immunity by Reversing Multi-Modal Resistance and Stem-like Property of Immune-Refractory Tumors. Nat. Commun. 2020, 11, 563. [Google Scholar] [CrossRef]
- Chiosis, G.; Digwal, C.S.; Trepel, J.B.; Neckers, L. Structural and Functional Complexity of HSP90 in Cellular Homeostasis and Disease. Nat. Rev. Mol. Cell Biol. 2023, 24, 797–815. [Google Scholar] [CrossRef]
- Cobine, P.A.; Brady, D.C. Cuproptosis: Cellular and molecular mechanisms underlying copper-induced cell death. Mol. Cell. 2022, 82, 1786–1787. [Google Scholar] [CrossRef]
- Qi, H.; Zhu, D. Oncogenic Role of Copper-induced Cell Death-associated Protein DLD in Human Cancer: A Pan-cancer Analysis and Experimental Verification. Oncol. Lett. 2023, 25, 214. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.; Ye, Z.; Hu, Y.; Wang, Y.; Ye, L.; Gao, L.; Sun, Q.; Tong, S.; Sun, Z.; Yang, J.; et al. FAIM2 Is a Potential Pan-Cancer Biomarker for Prognosis and Immune Infiltration. Front. Oncol. 2022, 12, 998336. [Google Scholar] [CrossRef]
- Liang, P.-I.; Lai, H.-Y.; Chan, T.-C.; Li, W.-M.; Hsing, C.-H.; Huang, S.K.; Hsieh, K.-L.; Tseng, W.-H.; Chen, T.-J.; Li, W.-S.; et al. Upregulation of Dihydropyrimidinase-like 3 (DPYSL3) Protein Predicts Poor Prognosis in Urothelial Carcinoma. BMC Cancer 2023, 23, 599. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB Pathway for the Therapy of Diseases: Mechanism and Clinical Study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB Signaling in Inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
- Capece, D.; Verzella, D.; Flati, I.; Arboretto, P.; Cornice, J.; Franzoso, G. NF-κB: Blending Metabolism, Immunity, and Inflammation. Trends Immunol. 2022, 43, 757–775. [Google Scholar] [CrossRef]
- Huai, W.; Liu, X.; Wang, C.; Zhang, Y.; Chen, X.; Chen, X.; Xu, S.; Thomas, T.; Li, N.; Cao, X. KAT8 Selectively Inhibits Antiviral Immunity by Acetylating IRF3. J. Exp. Med. 2019, 216, 772–785. [Google Scholar] [CrossRef]
- Xie, Y.; Hou, W.; Song, X.; Yu, Y.; Huang, J.; Sun, X.; Kang, R.; Tang, D. Ferroptosis: Process and Function. Cell Death Differ. 2016, 23, 369–379. [Google Scholar] [CrossRef] [PubMed]
- Bell, H.N.; Stockwell, B.R.; Zou, W. Ironing out the Role of Ferroptosis in Immunity. Immunity 2024, 57, 941–956. [Google Scholar] [CrossRef]
- Dixon, S.J.; Olzmann, J.A. The Cell Biology of Ferroptosis. Nat. Rev. Mol. Cell Biol. 2024, 25, 424–442. [Google Scholar] [CrossRef] [PubMed]
- Guo, R.; Fang, X.; Shang, K.; Wen, J.; Ding, K. Induction of ferroptosis: A new strategy for the control of bacterial infections. Microbiol. Res. 2024, 284, 127728. [Google Scholar] [CrossRef]
- Sun, Y.; Weng, S.; Dong, C.; He, J. Ferroptosis and iron mineralization involved in the death and survival of orange-spotted groupers challenged with Pseudomonas plecoglossicida. Anim. Res. One Health 2024, 2, 172–183. [Google Scholar] [CrossRef]
- Yang, M.; Lu, Z.; Li, F.; Shi, F.; Zhan, F.; Zhao, L.; Li, Y.; Li, J.; Lin, L.; Qin, Z. Escherichia coli induced ferroptosis in red blood cells of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2021, 112, 159–167. [Google Scholar] [CrossRef]
- Masaratana, P.; Patel, N.; Latunde-Dada, G.O.; Vaulont, S.; Simpson, R.J.; McKie, A.T. Regulation of Iron Metabolism in Hamp (-/-) Mice in Response to Iron-Deficient Diet. Eur. J. Nutr. 2013, 52, 135–143. [Google Scholar] [CrossRef]
- Fang, X.; Wang, H.; Han, D.; Xie, E.; Yang, X.; Wei, J.; Gu, S.; Gao, F.; Zhu, N.; Yin, X.; et al. Ferroptosis as a Target for Protection against Cardiomyopathy. Proc. Natl. Acad. Sci. USA 2019, 116, 2672–2680. [Google Scholar] [CrossRef]
- Olivera, A.; Spiegel, S. Sphingosine Kinase: A Mediator of Vital Cellular Functions. Prostaglandins Other Lipid Mediat. 2001, 64, 123–134. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Gao, Y.; Yao, S.; Wan, S.; Cai, H. TFAP2A Promotes Cervical Cancer via a Positive Feedback Pathway with PD-L1. Oncol. Rep. 2023, 49, 114. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Luo, Y.; Liang, Z.; Li, X.; Kołat, D.; Zhao, L.; Xiong, W. Crucial Role of the Transcription Factors Family Activator Protein 2 in Cancer: Current Clue and Views. J. Transl. Med. 2023, 21, 371. [Google Scholar] [CrossRef]
- Zheng, X.; Li, W.; Ren, L.; Liu, J.; Pang, X.; Chen, X.; Kang, D.; Wang, J.; Du, G. The Sphingosine Kinase-1/Sphingosine-1-Phosphate Axis in Cancer: Potential Target for Anticancer Therapy. Pharmacol. Ther. 2019, 195, 85–99. [Google Scholar] [CrossRef]
- Alkafaas, S.S.; Elsalahaty, M.I.; Ismail, D.F.; Radwan, M.A.; Elkafas, S.S.; Loutfy, S.A.; Elshazli, R.M.; Baazaoui, N.; Ahmed, A.E.; Hafez, W.; et al. The Emerging Roles of Sphingosine 1-Phosphate and SphK1 in Cancer Resistance: A Promising Therapeutic Target. Cancer Cell Int. 2024, 24, 89. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.; Wang, S.; Zhang, Y.; Wong, K.-C.; Nakatsu, G.; Wang, X.; Wong, S.; Ji, J.; Yu, J. Zinc-Finger Protein 471 Suppresses Gastric Cancer through Transcriptionally Repressing Downstream Oncogenic PLS3 and TFAP2A. Oncogene 2018, 37, 3601–3616. [Google Scholar] [CrossRef]
- Luo, S.; Wu, B.; Li, Q.; Li, W.; Wang, Z.; Song, Q.; Han, F. Identification of Galectin 9 and Its Antibacterial Function in Yellow Drum (Nibea Albiflora). Fish Shellfish Immunol. 2023, 142, 109044. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast Universal RNA-Seq Aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Perțea, M.; Pertea, G.; Antonescu, C.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An Efficient General Purpose Program for Assigning Sequence Reads to Genomic Features. Bioinformatics 2013, 30, 923–930. [Google Scholar] [CrossRef]
- Sun, S.; Song, C.; Han, F.; He, Q.; Liu, J.; Zhang, S.; Han, W.; Ye, K.; Han, Z.; Wang, Z.; et al. Study on Sex-Linked Region and Sex Determination Candidate Gene Using a High-Quality Genome Assembly in Yellow Drum. Aquaculture 2023, 563, 738987. [Google Scholar] [CrossRef]
- Bakali, H.M.A.; Herman, M.D.; Johnson, K.A.; Kelly, A.A.; Wieslander, Å.; Hallberg, B.M.; Nordlund, P. Crystal Structure of YegS, a Homologue to the Mammalian Diacylglycerol Kinases, Reveals a Novel Regulatory Metal Binding Site. J. Biol. Chem. 2007, 282, 19644–19652. [Google Scholar] [CrossRef]
- Fornes, O.; Castro-Mondragon, J.A.; Khan, A.; van der Lee, R.; Zhang, X.; Richmond, P.A.; Modi, B.P.; Correard, S.; Gheorghe, M.; Baranašić, D.; et al. JASPAR 2020: Update of the Open-Access Database of Transcription Factor Binding Profiles. Nucleic Acids Res. 2019, 48, gkz1001. [Google Scholar] [CrossRef] [PubMed]
Group | RIN | Raw Data (Gb) | Clean Data (Gb) | Map Rate (%) |
---|---|---|---|---|
3-1 | 7.20 | 7.56 | 7.32 | 100.00% |
3-2 | 10.00 | 6.84 | 6.59 | 100.00% |
3-3 | 9.80 | 5.93 | 5.66 | 100.00% |
Sphk1-1 | 10.00 | 7.27 | 6.99 | 100.00% |
Sphk1-2 | 10.00 | 6.49 | 6.24 | 100.00% |
Sphk1-3 | 10.00 | 7.60 | 7.25 | 100.00% |
Gene ID | Group | log2(Fold Change) | −log10(Padj) |
---|---|---|---|
Sphk1 | up | 15.042 | 29.567 |
Nsun5 | 5.811 | 20.587 | |
Loxhd1 | 3.919 | 10.389 | |
Kcnk10 | 3.718 | 1.323 | |
Hamp | 2.710 | 1.827 | |
Vwde | 2.609 | 3.877 | |
Hsp90aa1 | 2.484 | 3.877 | |
Faim2 | 2.136 | 5.869 | |
Bag3 | 1.569 | 3.422 | |
Dld | 1.557 | 1.448 | |
Tpcn1 | 1.444 | 5.046 | |
Dnajb1 | 1.440 | 1.340 | |
Dpys | 1.086 | 1.842 | |
Hmox | down | −3.998 | 9.778 |
Cmpk2 | −3.538 | 0.048 | |
Herc4 | −2.487 | 1.532 | |
Herc5 | −2.325 | 2.990 | |
Dcx | −2.180 | 1.660 | |
Nfkbia | −1.975 | 2.936 | |
Prdm1 | −1.837 | 1.794 | |
Tap2 | −1.822 | 1.323 | |
Kat8 | −1.424 | 1.320 | |
Gsto1 | −1.415 | 3.191 | |
Gnl | −1.306 | 2.115 | |
Blvrb | −1.279 | 1.519 |
Gene Name | Primer Name | Primer Sequence (5′-3′) | PCR Product Length (bp) | Purpose |
---|---|---|---|---|
SPHK1 | pEGFP-SPHK1-F | ctaccggactcagatCTCGAGATGGAGAAAGACGCATCTGAACC | 1731 | Subcellular localization |
pEGFP-SPHK1-R | gtaccgtcgactgcaGAATTCCTCCACATATAAGTCTGGCCAGTCC | |||
SPHK1 | PcDNA3.1-SPHK1-F | aacgggccctctagaCTCGAGATGGAGAAAGACGCATCTGAACC | 1730 | Overexpression |
PcDNA3.1-SPHK1-R | tagtccagtgtggtgGAATTCGTCCACATATAAGTCTGGCCAGTCC | |||
TFAP2A | pcDNA3.1-TFAP2A-F | aacgggccctctagaCTCGAGATGTTAGTGCACAGTTTTTCCGC | 1316 | |
pcDNA3.1-TFAP2A-R | tagtccagtgtggtgGAATTCCTTTCTGTGCTTCTCGTCTTTGTC | |||
β-ACTIN | q-β-actin-F | TTATGAAGGCTATGCCCTGCC | 107 | RT-qPCR analysis |
q-β-actin-R | TGAAGGAGTAGCCACGCTCTGT | |||
NSUN5 | q-nsun5-F | AGGACGAAGCAGGAGA | 196 | |
q-nsun5-R | TGAGATGAGCAGGGAAT | |||
KCNK10 | q-kcnk10-F | GGCTATGACCCTAAGACA | 177 | |
q-kcnk10-R | CAGGTAGAGCACGACAAC | |||
HAMP | q-hamp-F | ACTCGTGCTCGCCTTTA | 220 | |
q-hamp-R | ACCGCAGCCTTTGTTC | |||
HSP90A | q-hsp90a-F | TCTGGACCCGTAACCC | 222 | |
q-hsp90a-R | TGAAGACCCTGCGAAC | |||
FAIM2 | q-faim2-F | AGGACGACATACAGGC | 213 | |
q-faim2-R | TTACGGATGAAGACCC | |||
DLD | q-dld-F | ACAATGACGGCTATAAGT | 239 | |
q-dld-R | GTTCACCAGGTCCACA | |||
DPYSL3 | q-dpysl3-F | ATGACAGCATAAAGCAGGAG | 135 | |
q-dpysl3-R | CCGCCAAGAAGGTAAAGA | |||
LAT8 | q-kat8-F | GGGAGCAAGAAGTGTCG | 110 | |
q-kat8-R | GCCCTCCTGTTCATTCA | |||
TAP2 | q-tap2-F | TCTGATTCCCGAGTGT | 147 | |
q-tap2-R | ATCGAGCTGGTAGTTGA | |||
NFKBIA | q-nfkbia-F | CTCGCCTCCATCGTGT | 235 | |
q-nfkbia-R | CGCCGTAGTTAAAGCAGT | |||
HMOX | q-hmox-F | AACGCCTCCCATCCAG | 196 | |
q-hmox-R | CGTGAGCGACCAACAG |
Segment Name | Primer Name | Primer Sequences (5′-3′) | Length (bp) |
---|---|---|---|
pGL3-SPHK1-R | atcgcagatctcgagCCCGGGTCGTTGAGCATGTCGGTGAA | ||
pGL3-SPHK1-P1 | pGL3-SPHK1-F1 | ctatcgataggtaccGAGCTCCGGCTCGTGTGTAACAAACT | 2023 |
pGL3-SPHK1-P2 | pGL3-SPHK1-F2 | ctatcgataggtaccGAGCTCTACAGTCAAGTCAACCATCAGG | 1769 |
pGL3-SPHK1-P3 | pGL3-SPHK1-F3 | ctatcgataggtaccGAGCTCTGAAGCCTGCCAGCCTCTA | 1505 |
pGL3-SPHK1-P4 | pGL3-SPHK1-F4 | ctatcgataggtaccGAGCTCAACATTCTGCGTTCCACACTG | 1156 |
pGL3-SPHK1-P5 | pGL3-SPHK1-F5 | ctatcgataggtaccGAGCTCGTGACACCACATTGTTCTACCA | 794 |
pGL3-SPHK1-P6 | pGL3-SPHK1-F6 | ctatcgataggtaccGAGCTCAAGTCCGTGGTGAGTTCTTCT | 511 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, Y.; Luo, S.; Wu, B.; Li, Q.; Han, F.; Wang, Z. Immunomodulatory Effects of SPHK1 and Its Interaction with TFAP2A in Yellow Drum (Nibea albiflora). Int. J. Mol. Sci. 2024, 25, 13641. https://doi.org/10.3390/ijms252413641
Cui Y, Luo S, Wu B, Li Q, Han F, Wang Z. Immunomodulatory Effects of SPHK1 and Its Interaction with TFAP2A in Yellow Drum (Nibea albiflora). International Journal of Molecular Sciences. 2024; 25(24):13641. https://doi.org/10.3390/ijms252413641
Chicago/Turabian StyleCui, Yu, Shuai Luo, Baolan Wu, Qiaoying Li, Fang Han, and Zhiyong Wang. 2024. "Immunomodulatory Effects of SPHK1 and Its Interaction with TFAP2A in Yellow Drum (Nibea albiflora)" International Journal of Molecular Sciences 25, no. 24: 13641. https://doi.org/10.3390/ijms252413641
APA StyleCui, Y., Luo, S., Wu, B., Li, Q., Han, F., & Wang, Z. (2024). Immunomodulatory Effects of SPHK1 and Its Interaction with TFAP2A in Yellow Drum (Nibea albiflora). International Journal of Molecular Sciences, 25(24), 13641. https://doi.org/10.3390/ijms252413641