Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose
Abstract
1. Introduction
2. Results
2.1. Identification of PvMAPK Genes and Characterization of PvMAPK Proteins in P. vulgaris
2.2. Phylogenetic and Collinearity Analyses of the P. vulgaris MAPK Gene Family
2.3. Conserved Domains, Conserved Motifs, and Gene Structures of the PvMAPKs
2.4. Identification of Cis-Acting Elements in the PvMAPK Promoters
2.5. Expression of the PvMAPKs in Different P. vulgaris Tissues
2.6. Expression of PvMAPKs in Seven Oil Bean Varieties Under Anthracnose Stress
3. Discussion
4. Materials and Methods
4.1. MAPK Gene Identification and Protein Characterization
4.2. Analyses of Protein Phylogeny and Gene Collinearity
4.3. Protein Motifs and Gene Structures of the PvMAPKs
4.4. Identification of Cis-Acting Promoter Elements
4.5. Expression of PvMAPKs in Different Tissues and in Response to Anthracnose Infection
4.6. Expression of PvMAPKs in Seven Oil Bean Varieties Under Anthracnose Stress
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xin, Y.; Xu, L.; Tian, S.; Yang, W. Oil bean curd, an endemic vegetable species in Northeast China. Spec. Econ. Plants Anim. 2020, 23, 30–32. [Google Scholar]
- Wu, H. Occurrence and control of anthracnose on kidney beans in the open field. Northwest Hortic. 2022, 44–45. [Google Scholar]
- Melotto, M.; Balardin, R.S.; Kelly, J.D. Host–Interaction and variability of Colletotrichum lindemuthianum. In Colletotrichum Host Specificity, Pathology, Host–Pathogen Interaction; APS Press: St. Paul, MN, USA, 2000; pp. 346–361. [Google Scholar]
- Kang, F. Occurrence and control of major diseases of kidney bean. Mod. Rural Sci. Technol. 2014, 31. [Google Scholar]
- Liu, J.; Zou, X.Y.; Ma, J.F.; Wang, Y.F.; Dong, Z.P.; Li, Z.Y.; Bai, H. Identification of MAPK family members in cereal grains and analysis of their response to biotic stresses. Crop J. 2023, 49, 1480–1495. [Google Scholar]
- Ichimura, K.; Shinozaki, K.; Tena, G.; Sheen, J.; Henry, Y.; Champion, A.; Kreis, M.; Zhang, S.; Hirt, H.; Wilson, C.; et al. Mitogen-activated protein kinase cascades in plants: A new nomenclature. Trends Plant Sci. 2002, 7, 301–308. [Google Scholar]
- Chuang, H.C.; Wang, X.; Tan, T.H. MAP4K family kinases in immunity and inflammation. Adv. Immunol. 2016, 129, 277–314. [Google Scholar]
- Majeed, Y.; Zhu, X.; Zhang, N.; Ul-Ain, N.; Raza, A.; Haider, F.U.; Si, H. Harnessing the role of mitogen-activated protein kinases against abiotic stresses in plants. Front. Plant Sci. 2023, 14, 932923. [Google Scholar] [CrossRef]
- Colcombet, J.; Hirt, H. Arabidopsis MAPKs: A complex signalling network involved in multiple biological processes. Biochem. J. 2008, 413, 217–226. [Google Scholar] [CrossRef]
- Chen, L.; Hu, W.; Tan, S.; Wang, M.; Ma, Z.; Zhou, S.; Deng, X.; Zhang, Y.; Huang, C.; Yang, G.; et al. Genome-wide identification and analysis of MAPK and MAPK gene families in Brachypodium distachyon. PLoS ONE 2012, 7, e46744. [Google Scholar] [CrossRef]
- Liu, Y.K.; Zhang, D.; Wang, L.; Li, D.Q. Genome-wide analysis of mitogen-activated protein kinase gene family in maize. Plant Mol. Biol. Rep. 2013, 316, 1446–1460. [Google Scholar] [CrossRef]
- Cui, L.; Yang, G.; Yan, J.; Pan, Y.; Nie, X. Genome-wide identification, expression profiles and regulatory network of MAPK cascade gene family in barley. BMC Genom. 2019, 20, 750. [Google Scholar] [CrossRef] [PubMed]
- Zhan, H.; Yue, H.; Zhao, X.; Wang, M.; Song, W.; Nie, X. Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Bread Wheat (Triticum aestivum L.). Genes 2017, 8, 284. [Google Scholar] [CrossRef] [PubMed]
- Reyna, N.S.; Yang, Y. Molecular analysis of the rice MAP kinase gene family in relation to Magnaporthe grisea infection. Mol. Plant–Microbe Interact. 2006, 19, 530–540. [Google Scholar] [CrossRef]
- Lu, W.; Chu, X.; Li, Y.; Wang, C.; Guo, X. Cotton GhMKK1 induces the tolerance of salt and drought stress, and mediates defence responses to pathogen infection in transgenic Nicotiana benthamiana. PLoS ONE 2013, 8, e68503. [Google Scholar] [CrossRef]
- Zhang, X.M.; Wu, G.Q.; Wei, M. Role of MAPK in plant response to adversity stress. J. Grass Ind. 2024, 33, 182–197. [Google Scholar]
- Li, N.; Yang, Z.; Li, J.; Xie, W.; Qin, X.; Kang, Y.; Zhang, Q.; Li, X.; Xiao, J.; Ma, H.; et al. Two VQ Proteins are Substrates of the OsMPKK6-OsMPK4 Cascade in Rice Defense Against Bacterial Blight. Rice 2021, 14, 39. [Google Scholar] [CrossRef]
- Wang, C.; He, X.; Li, Y.; Wang, L.; Guo, X.; Guo, X. The cotton MAPK kinase GhMPK20 negatively regulates resistance to Fusarium oxysporum by mediating the MKK4-MPK20-WRKY40 cascade. Mol. Plant Pathol. 2018, 19, 1624–1638. [Google Scholar] [CrossRef]
- Song, Q.M. Identification, Expression Pattern and Functional Analysis of MAPK and MAPKK Family Genes in Watermelon; Zhejiang University: Hangzhou, China, 2015; p. 298. [Google Scholar]
- Lian, K.; Gao, F.; Sun, T.; van Wersch, R.; Ao, K.; Kong, Q.; Nitta, Y.; Wu, D.; Krysan, P.; Zhang, Y. MKK6 Functions in Two Parallel MAP Kinase Cascades in Immune Signaling. Plant Physiol. 2018, 178, 1284–1295. [Google Scholar] [CrossRef]
- O’Rourke, J.A.; Iniguez, L.P.; Fu, F.; Bucciarelli, B.; Miller, S.S.; Jackson, S.A.; McClean, P.E.; Li, J.; Dai, X.; Zhao, P.X.; et al. An RNA-Seq based gene expression atlas of the common bean. BMC Genom. 2014, 15, 866. [Google Scholar] [CrossRef]
- XIHX Cloning and Functional Analysis of Wheat TaNCED3 Gene; Liaoning Normal University: Dalian, China, 2015.
- Li, H.Y. Research on Transcriptional Regulation of Tobacco Under External Application of Abscisic Acid and Salt Stress; Shandong Agricultural University: Taian, China, 2019. [Google Scholar]
- Zhang, L.; Li, Y.; Lu, W.; Meng, F.; Wu, C.A.; Guo, X. Cotton GhMKK5 affects disease resistance, induces HR-like cell death, and reduces the tolerance to salt and drought stress in transgenic Nicotiana benthamiana. J. Exp. Bot. 2012, 63, 3935–3951. [Google Scholar] [CrossRef]
- Wang, S.; Xie, X.; Che, X.; Lai, W.; Ren, Y.; Fan, X.; Hu, W.; Tang, M.; Chen, H. Host- and virus-induced gene silencing of HOG1-MAPK cascade genes in Rhizophagus irregularis inhibit arbuscule development and reduce resistance of plants to drought stress. Plant Biotechnol. J. 2023, 21, 866–883. [Google Scholar] [CrossRef] [PubMed]
- Pedley, K.F.; Martin, G.B. Role of mitogen-activated protein kinases in plant immunity. Curr. Opin. Plant Biol. 2005, 8, 541–547. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Nath, O.; Singh, S.; Kumar, S.; Singh, I.K. Genome-wide identification of the MAPK gene family in chickpea and expression analysis during development and stress response. Plant Gene 2017, 13, 25–35. [Google Scholar] [CrossRef]
- Zhou, M.; Zhao, B.; Li, H.; Ren, W.; Zhang, Q.; Liu, Y.; Zhao, J. Comprehensive analysis of MAPK cascade genes in sorghum (Sorghum bicolor L.) reveals SbMPK14 as a potential target for drought sensitivity regulation. Genomics 2022, 114, 110311. [Google Scholar] [CrossRef]
- Wang, Z.; Wan, Y.; Meng, X.; Zhang, X.; Yao, M.; Miu, W.; Zhu, D.; Yuan, D.; Lu, K.; Li, J.; et al. Genome-Wide Identification and Analysis of MKK and MAPK Gene Families in Brassica Species and Response to Stress in Brassica napus. Int. J. Mol. Sci. 2021, 22, 544. [Google Scholar] [CrossRef]
- Mohanta, T.K.; Arora, P.K.; Mohanta, N.; Parida, P.; Bae, H. Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants. BMC Genom. 2015, 16, 58. [Google Scholar] [CrossRef]
- Berriri, S.; Garcia, A.V.; dit Frey, N.F.; Rozhon, W.; Pateyron, S.; Leonhardt, N.; Montillet, J.L.; Leung, J.; Hirt, H.; Colcombet, J. Constitutively active mitogen-activated protein kinase versions reveal functions of Arabidopsis MPK4 in pathogen defense signalling. Plant Cell 2012, 24, 4281–4293. [Google Scholar] [CrossRef]
- Ali, A.; Chu, N.; Ma, P.; Javed, T.; Zaheer, U.; Huang, M.T.; Fu, H.Y.; Gao, S.J. Genome-wide analysis of mitogen-activated protein (MAP) kinase gene family expression in response to biotic and abiotic stresses in sugarcane. Physiol. Plant. 2021, 171, 86–107. [Google Scholar] [CrossRef]
- Zhang, X.; Xu, X.; Yu, Y.; Chen, C.; Wang, J.; Cai, C.; Guo, W. Integration analysis of MKK and MAPK family members highlights potential MAPK signalling modules in cotton. Sci. Rep. 2016, 6, 29781. [Google Scholar]
- Chen, L.; Song, H.; Xin, J.; Dong, G.; Xu, F.; Su, Y.; Yang, M.; Sun, H. Comprehensive genome-wide identification and functional characterization of MAPK cascade gene families in Nelumbo. Int. J. Biol. Macromol. 2023, 233, 123543. [Google Scholar] [CrossRef]
- Chen, X.; Sun, Y.; Yang, Y.; Zhao, Y.; Zhang, C.; Fang, X.; Gao, H.; Zhao, M.; He, S.; Song, B.; et al. The EIN3 transcription factor GmEIL1 improves soybean resistance to Phytophthora sojae. Mol. Plant Pathol. 2024, 25, e13452. [Google Scholar] [CrossRef] [PubMed]
- Kozyulina, P.Y.; Pavlova, O.A.; Kantsurova, E.S.; Bovin, A.D.; Shirobokova, S.A.; Dolgikh, A.V.; Dymo, A.M.; Dolgikh, E.A. Transcriptomic analysis of pea plant responses to chitooligosaccharides’ treatment revealed stimulation of mitogen-activated protein kinase cascade. Front. Plant Sci. 2023, 14, 1092013. [Google Scholar] [CrossRef] [PubMed]
- Ali, S.; Mir, Z.A.; Tyagi, A.; Bhat, J.A.; Chandrashekar, N.; Papolu, P.K.; Rawat, S.; Grover, A. Identification and comparative analysis of Brassica juncea pathogenesis-related genes in response to hormonal, biotic and abiotic stresses. Acta Physiol. Plant 2017, 39, 268. [Google Scholar] [CrossRef]
- Li, Y.; Qin, L.; Zhao, J.; Muhammad, T.; Cao, H.; Li, H.; Zhang, Y.; Liang, Y. SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV) by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum). PLoS ONE 2017, 12, e0172466. [Google Scholar] [CrossRef]
- Jalmi, S.K.; Sinha, A.K. Functional Involvement of a Mitogen Activated Protein Kinase Module, OsMKK3-OsMPK7-OsWRK30 in Mediating Resistance against Xanthomonas oryzae in Rice. Sci. Rep. 2016, 6, 37974. [Google Scholar] [CrossRef]
- Xue, P.; Zhang, L.; Fan, R.; Li, Y.; Han, X.; Qi, T.; Zhao, L.; Yu, D.; Shen, Q.H. HvMPK4 phosphorylates HvWRKY1 to enhance its suppression of barley immunity to powdery mildew fungus. J. Genet. Genom. 2024, 51, 313–325. [Google Scholar] [CrossRef]
- Wang, Z.; Li, X.; Yao, X.; Ma, J.; Lu, K.; An, Y.; Sun, Z.; Wang, Q.; Zhou, M.; Qin, L.; et al. MYB44 regulates PTI by promoting the expression of EIN2 and MPK3/6 in Arabidopsis. Plant Commun. 2023, 4, 100628. [Google Scholar] [CrossRef]
- Goyal, R.K.; Tulpan, D.; Chomistek, N.; González-Peña Fundora, D.; West, C.; Ellis, B.E.; Frick, M.; Laroche, A.; Foroud, N.A. Analysis of MAPK and MAPKK gene families in wheat and related Triticeae species. BMC Genom. 2018, 19, 178. [Google Scholar] [CrossRef]
- Zhu, X.; Duan, H.; Zhang, G.; Jin, H.; Xu, C.; Chen, S.; Zhou, C.; Chen, Z.; Tang, J.; Zhang, Y. StMAPK1 functions as a thermos-tolerant gene in regulating heat stress tolerance in potato (Solanum tuberosum). Front. Plant Sci. 2023, 14, 1218962. [Google Scholar] [CrossRef]
- Jiang, C.; Zu, C.; Lu, D.; Zheng, Q.; Shen, J.; Wang, H.; Li, D. Effect of exogenous selenium supply on photosynthesis, Na+ accumulation and antioxidative capacity of maize (Zea mays L.) under salinity stress. Sci. Rep. 2017, 7, 42039. [Google Scholar] [CrossRef]
- Jagodzik, P.; Tajdel-Zielinska, M.; Ciesla, A.; Marczak, M.; Ludwikow, A. Mitogen-Activated Protein Kinase Cascades in Plant Hormone Signaling. Front. Plant Sci. 2018, 9, 1387. [Google Scholar] [CrossRef]
- Gao, Z.; Zhang, D.; Wang, X.; Zhang, X.; Wen, Z.; Zhang, Q.; Li, D.; Dinesh-Kumar, S.P.; Zhang, Y. Coat proteins of necroviruses target 14-3-3a to subvert MAPKKKα-mediated antiviral immunity in plants. Nat. Commun. 2022, 13, 716. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, M.L.; de Lima Silva, C.C.; Abe, V.Y.; Costa, M.G.; Cernadas, R.A.; Benedetti, C.E. Increased resistance against citrus canker mediated by a citrus mitogen-activated protein kinase. Mol. Plant-Microbe Interact. 2013, 26, 1190–1199. [Google Scholar] [CrossRef] [PubMed]
- Wilson, C.; Eller, N.; Gartner, A.; Vicente, O.; Heberle-Bors, E. Isolation and characterization of a tobacco cDNA clone encoding a putative MAP kinase. Plant Mol. Biol. 1993, 23, 543–551. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Klessig, D.F. Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 1997, 9, 809–824. [Google Scholar] [PubMed]
- Hoyos, M.E.; Zhang, S. Calcium-independent activation of salicylic acid-induced protein kinase and a 40-kilodalton protein kinase by hyperosmotic stress. Plant Physiol. 2000, 122, 1355–1364. [Google Scholar] [CrossRef]
- Nie, S.; Xu, H. Riboflavin-Induced Disease Resistance Requires the Mitogen-Activated Protein Kinases 3 and 6 in Arabidopsis thaliana. PLoS ONE 2016, 11, e0153175. [Google Scholar] [CrossRef]
- Lin, H.; Wang, M.; Chen, Y.; Nomura, K.; Hui, S.; Gui, J.; Zhang, X.; Wu, Y.; Liu, J.; Li, Q.; et al. An MKP-MAPK protein phosphorylation cascade controls vascular immunity in plants. Sci. Adv. 2022, 8, eabg8723. [Google Scholar] [CrossRef]
















| Gene Name | Gene ID | Number of Amino Acids (aa) | Molecular Weight (kD) | Isoelectric Point (pI) | Subcellular Location | Signal Peptide |
|---|---|---|---|---|---|---|
| PvMAPK01 | PAC:27140243 | 374 | 42.86 | 6.14 | cyto | NO |
| PvMAPK02 | PAC:27142484 | 395 | 45.06 | 5.57 | cyto | NO |
| PvMAPK03 | PAC:27144563 | 570 | 64.7 | 8.94 | cyto | NO |
| PvMAPK04 | PAC:27150399 | 607 | 68.97 | 9.21 | nucl | NO |
| PvMAPK05 | PAC:27151651 | 372 | 42.65 | 5.65 | cyto | NO |
| PvMAPK06 | PAC:27155619 | 614 | 69.98 | 9.15 | nucl | NO |
| PvMAPK07 | PAC:27158371 | 506 | 57.75 | 6.17 | cyto | NO |
| PvMAPK08 | PAC:27165246 | 603 | 68.41 | 8.97 | cyto | NO |
| PvMAPK09 | PAC:27166653 | 564 | 64.11 | 8.82 | cyto | NO |
| PvMAPK10 | PAC:27167601 | 369 | 42.48 | 8.28 | cyto | NO |
| PvMAPK11 | PAC:27170661 | 382 | 43.66 | 6.4 | cyto | NO |
| PvMAPK12 | PAC:27170962 | 373 | 42.9 | 5.83 | cyto | NO |
| PvMAPK13 | PAC:27171377 | 583 | 66.11 | 7.09 | cyto | NO |
| Gene 1 | Gene 2 | Non-Synonymous (Ka) | Synonymous (Ks) | Ka/Ks |
|---|---|---|---|---|
| PvMAPK12 | PvMAPK11 | 0.083641093 | 0.756503346 | 0.110562754 |
| PvMAPK11 | PvMAPK01 | 0.123021052 | 1.646005777 | 0.074739137 |
| PvMAPK12 | PvMAPK01 | 0.130405085 | 1.952985631 | 0.066772168 |
| PvMAPK03 | PvMAPK09 | 0.052767243 | 0.608554437 | 0.086709159 |
| PvMAPK08 | PvMAPK06 | 0.092142646 | 0.6611902 | 0.139358759 |
| Gene | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
|---|---|---|
| Pv-Actin | GAAGTTCTCTTCCAACCATCC | TTTCCTTGCTCATTCTGTCCG |
| PvMAPK01 | TGGTGGACGCTACATTCAGT | TGCATGATCCATGTGCCGAA |
| PvMAPK02 | GTTGCGTCTGCTTATGGAGC | GTGCCAGGGCATCTTCAACA |
| PvMAPK03 | GACGGAGAAGAGCCAACAGG | AAAGGAGGCCTGGTCATTGG |
| PvMAPK04 | CCAGAACTGTGTGGCTCCTT | TGCAGTAGACGAAGTGCCAA |
| PvMAPK05 | CTTCTTGGTACCCCAACCGA | AGTGCTTCTTCAACTGTAATTCTTT |
| PvMAPK06 | ACAGACAATCCTGCCCCAAG | TCTGTTGCTGTTGCTGACCT |
| PvMAPK07 | ACCACCGGAGAAATCGATGC | AGGGAAGCAACCTTCTGTGT |
| PvMAPK08 | AAACCGACCAACTGCTGAGG | TAAGCTGGGGGAACAGGTTG |
| PvMAPK09 | AGACCCCCTAGCTCTTCGTT | ATCCGGCGTCTCTCAAACTC |
| PvMAPK10 | AAGTCCTCGCAGCCACTTTC | GTTCGTGCAAGCCCAAAGTC |
| PvMAPK11 | TTCCACAGTACCGGAAGCAA | CTGGGACAGACTGGCTCATC |
| PvMAPK12 | GACCTCCCAGAAAGGATGCC | CACCGGGTGACCACATACTC |
| PvMAPK13 | CGCGCAGTTGTCTTCCATTC | GTGAGCATCAACGGCAGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Wang, D.; Wang, Z.; Zhao, T.; Zhang, J.; Wang, Y.; Qiao, H.; Han, Y. Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. Int. J. Mol. Sci. 2024, 25, 13101. https://doi.org/10.3390/ijms252313101
Liu H, Wang D, Wang Z, Zhao T, Zhang J, Wang Y, Qiao H, Han Y. Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. International Journal of Molecular Sciences. 2024; 25(23):13101. https://doi.org/10.3390/ijms252313101
Chicago/Turabian StyleLiu, Huiling, Da Wang, Zhenyu Wang, Tong Zhao, Jingying Zhang, Yan Wang, Hongyu Qiao, and Yuzhu Han. 2024. "Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose" International Journal of Molecular Sciences 25, no. 23: 13101. https://doi.org/10.3390/ijms252313101
APA StyleLiu, H., Wang, D., Wang, Z., Zhao, T., Zhang, J., Wang, Y., Qiao, H., & Han, Y. (2024). Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. International Journal of Molecular Sciences, 25(23), 13101. https://doi.org/10.3390/ijms252313101

