Integrated Analysis of Neuroendocrine and Neurotransmission Pathways Following Developmental Atrazine Exposure in Zebrafish
Abstract
1. Introduction
2. Results
2.1. Embryonic Atrazine Exposure Impacts on Estradiol Concentrations
2.2. Embryonic Atrazine Exposure Impacts on Dopamine Concentrations
2.3. Gene Expression Alterations in Neuroendocrine Pathways
3. Discussion
4. Materials and Methods
4.1. Chemical Preparation and Concentration Confirmation
4.2. Zebrafish Husbandry and Atrazine Dosing Confirmation
4.3. Estradiol Levels in Whole Eleuthero Embryos and Adult Brains
4.4. Dopamine Concentrations in Whole Eleuthero Embryos and Adult Brains
4.5. Gene Expression Analysis for Embryonic (1–72 hpf) or Larval (72–120 hpf) Atrazine Exposures
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Parlakidis, P.; Rodriguez, M.S.; Gikas, G.D.; Alexoudis, C.; Perez-Rojas, G.; Perez-Villanueva, M.; Carrera, A.P.; Fernández-Cirelli, A.; Vryzas, Z. Occurrence of Banned and Currently Used Herbicides, in Groundwater of Northern Greece: A Human Health Risk Assessment Approach. Int. J. Environ. Res. Public Health 2022, 19, 8877. [Google Scholar] [CrossRef] [PubMed]
 - Wirbisky, S.E.; Freeman, J.L. Atrazine Exposure and Reproductive Dysfunction through the Hypothalamus-Pituitary-Gonadal (HPG) Axis. Toxics 2015, 3, 414–450. [Google Scholar] [CrossRef] [PubMed]
 - Almberg, K.S.; Turyk, M.E.; Jones, R.M.; Rankin, K.; Freels, S.; Stayner, L.T. Atrazine Contamination of Drinking Water and Adverse Birth Outcomes in Community Water Systems with Elevated Atrazine in Ohio, 2006–2008. Int. J. Environ. Res. Public Health 2018, 15, 1889. [Google Scholar] [CrossRef] [PubMed]
 - Ochoa-Acuña, H.; Frankenberger, J.; Hahn, L.; Carbajo, C. Drinking-Water Herbicide Exposure in Indiana and Prevalence of Small-for-Gestational-Age and Preterm Delivery. Environ. Health Perspect. 2009, 117, 1619–1624. [Google Scholar] [CrossRef]
 - Beaulieu, M.; Cabana, H.; Taranu, Z.; Huot, Y. Predicting Atrazine Concentrations in Waterbodies across the Contiguous United States: The Importance of Land Use, Hydrology, and Water Physicochemistry. Limnol. Oceanogr. 2020, 65, 2966–2983. [Google Scholar] [CrossRef]
 - Bexfield, L.M.; Belitz, K.; Lindsey, B.D.; Toccalino, P.L.; Nowell, L.H. Pesticides and Pesticide Degradates in Groundwater Used for Public Supply across the United States: Occurrence and Human-Health Context. Environ. Sci. Technol. 2021, 55, 362–372. [Google Scholar] [CrossRef]
 - Ahkin Chin Tai, J.K.; Horzmann, K.A.; Jenkins, T.L.; Akoro, I.N.; Stradtman, S.; Aryal, U.K.; Freeman, J.L. Adverse Developmental Impacts in Progeny of Zebrafish Exposed to the Agricultural Herbicide Atrazine during Embryogenesis. Environ. Int. 2023, 180, 108213. [Google Scholar] [CrossRef]
 - Ahkin Chin Tai, J.K.; Horzmann, K.A.; Franco, J.; Jannasch, A.S.; Cooper, B.R.; Freeman, J.L. Developmental Atrazine Exposure in Zebrafish Produces the Same Major Metabolites as Mammals along with Altered Behavioral Outcomes. Neurotoxicology Teratol. 2021, 85, 106971. [Google Scholar] [CrossRef]
 - Foradori, C.D.; Zimmerman, A.D.; Hinds, L.R.; Zuloaga, K.L.; Breckenridge, C.B.; Handa, R.J. Atrazine Inhibits Pulsatile Gonadotropin-Releasing Hormone (GnRH) Release Without Altering GnRH Messenger RNA or Protein Levels in the Female Rat1. Biol. Reprod. 2013, 88, 1–7. [Google Scholar] [CrossRef]
 - Foradori, C.D.; Hinds, L.R.; Hanneman, W.H.; Handa, R.J. Effects of Atrazine and Its Withdrawal on Gonadotropin-Releasing Hormone Neuroendocrine Function in the Adult Female Wistar Rat1. Biol. Reprod. 2009, 81, 1099–1105. [Google Scholar] [CrossRef]
 - Horzmann, K.A.; Lin, L.F.; Taslakjian, B.; Yuan, C.; Freeman, J.L. Embryonic Atrazine Exposure and Later in Life Behavioral and Brain Transcriptomic, Epigenetic, and Pathological Alterations in Adult Male Zebrafish. Cell Biol. Toxicol. 2021, 37, 421–439. [Google Scholar] [CrossRef] [PubMed]
 - Horzmann, K.A.; Reidenbach, L.S.; Thanki, D.H.; Winchester, A.E.; Qualizza, B.A.; Ryan, G.A.; Egan, K.E.; Hedrick, V.E.; Sobreira, T.J.P.; Peterson, S.M.; et al. Embryonic Atrazine Exposure Elicits Proteomic, Behavioral, and Brain Abnormalities with Developmental Time Specific Gene Expression Signatures. J. Proteom. 2018, 186, 71–82. [Google Scholar] [CrossRef] [PubMed]
 - Munger, R.; Isacson, P.; Hu, S.; Burns, T.; Hanson, J.; Lynch, C.F.; Cherryholmes, K.; Van Dorpe, P.; Hausler, W.J. Intrauterine Growth Retardation in Iowa Communities with Herbicide-Contaminated Drinking Water Supplies. Environ. Health Perspect. 1997, 105, 308–314. [Google Scholar] [CrossRef]
 - Ochoa-Acuña, H.; Carbajo, C. Risk of Limb Birth Defects and Mother’s Home Proximity to Cornfields. Sci. Total Environ. 2009, 407, 4447–4451. [Google Scholar] [CrossRef] [PubMed]
 - Rinsky, J.L.; Hopenhayn, C.; Golla, V.; Browning, S.; Bush, H.M. Atrazine Exposure in Public Drinking Water and Preterm Birth. Public Health Rep. 2012, 127, 72–80. [Google Scholar] [CrossRef]
 - Stayner, L.T.; Almberg, K.; Jones, R.; Graber, J.; Pedersen, M.; Turyk, M. Atrazine and Nitrate in Drinking Water and the Risk of Preterm Delivery and Low Birth Weight in Four Midwestern States. Environ. Res. 2017, 152, 294–303. [Google Scholar] [CrossRef]
 - Villanueva, C.; Durand, G.; Coutte, M.; Chevrier, C.; Cordier, S. Atrazine in Municipal Drinking Water and Risk of Low Birth Weight, Preterm Delivery, and Small-for-Gestational-Age Status. Occup. Environ. Med. 2005, 62, 400–405. [Google Scholar] [CrossRef]
 - Winchester, P.D.; Huskins, J.; Ying, J. Agrichemicals in Surface Water and Birth Defects in the United States. Acta Paediatr. 2009, 98, 664–669. [Google Scholar] [CrossRef]
 - Trentacoste, S.V.; Friedmann, A.S.; Youker, R.T.; Breckenridge, C.B.; Zirkin, B.R. Atrazine Effects on Testosterone Levels and Androgen-Dependent Reproductive Organs in Peripubertal Male Rats. J. Androl. 2001, 22, 142–148. [Google Scholar] [CrossRef]
 - Griffiths, M.J.; Winship, A.L.; Stringer, J.M.; Swindells, E.O.; Harper, A.P.; Finger, B.J.; Hutt, K.J.; Green, M.P. Prolonged Atrazine Exposure Beginning in Utero and Adult Uterine Morphology in Mice. J. Dev. Orig. Health Dis. 2022, 13, 39–48. [Google Scholar] [CrossRef]
 - Yun, Y.; Lee, S.; So, C.; Manhas, R.; Kim, C.; Wibowo, T.; Hori, M.; Hunter, N. Oocyte Development and Quality in Young and Old Mice Following Exposure to Atrazine. Environ. Health Perspect. 2022, 130, 117007. [Google Scholar] [CrossRef] [PubMed]
 - Govers, L.C.; Harper, A.P.; Finger, B.J.; Mattiske, D.M.; Pask, A.J.; Green, M.P. Atrazine Induces Penis Abnormalities Including Hypospadias in Mice. J. Dev. Orig. Health Dis. 2020, 11, 246–249. [Google Scholar] [CrossRef] [PubMed]
 - Wirbisky, S.E.; Weber, G.J.; Sepúlveda, M.S.; Lin, T.-L.; Jannasch, A.S.; Freeman, J.L. An Embryonic Atrazine Exposure Results in Reproductive Dysfunction in Adult Zebrafish and Morphological Alterations in Their Offspring. Sci. Rep. 2016, 6, 21337. [Google Scholar] [CrossRef] [PubMed]
 - Cook, L.E.; Chen, Y.; Renfree, M.B.; Pask, A.J. Long-Term Maternal Exposure to Atrazine in the Drinking Water Reduces Penis Length in the Tammar Wallaby Macropus Eugenii. Reprod. Fertil. Dev. 2020, 32, 1099–1107. [Google Scholar] [CrossRef]
 - Hayes, T.B.; Anderson, L.L.; Beasley, V.R.; de Solla, S.R.; Iguchi, T.; Ingraham, H.; Kestemont, P.; Kniewald, J.; Kniewald, Z.; Langlois, V.S.; et al. Demasculinization and Feminization of Male Gonads by Atrazine: Consistent Effects across Vertebrate Classes. J. Steroid Biochem. Mol. Biol. 2011, 127, 64–73. [Google Scholar] [CrossRef]
 - Li, Y.-S.; He, X.; Ma, K.; Wu, Y.-P.; Li, B.-X. The Effect of Exposure to Atrazine on Dopaminergic Development in Pubertal Male SD Rats. Birth Defects Res. Part B Dev. Reprod. Toxicol. 2015, 104, 184–189. [Google Scholar] [CrossRef]
 - Sun, Y.; Li, Y.-S.; Yang, J.-W.; Yu, J.; Wu, Y.-P.; Li, B.-X. Exposure to Atrazine during Gestation and Lactation Periods: Toxicity Effects on Dopaminergic Neurons in Offspring by Downregulation of Nurr1 and VMAT2. Int. J. Mol. Sci. 2014, 15, 2811–2825. [Google Scholar] [CrossRef]
 - Li, Y.; Sun, Y.; Yang, J.; Wu, Y.; Yu, J.; Li, B. Age-Dependent Dopaminergic Dysfunction Following Fetal Exposure to Atrazine in SD Rats. Environ. Toxicol. Pharmacol. 2014, 37, 1275–1282. [Google Scholar] [CrossRef]
 - Filipov, N.M.; Stewart, M.A.; Carr, R.L.; Sistrunk, S.C. Dopaminergic Toxicity of the Herbicide Atrazine in Rat Striatal Slices. Toxicology 2007, 232, 68–78. [Google Scholar] [CrossRef]
 - Szawka, R.E.; Ribeiro, A.B.; Leite, C.M.; Helena, C.V.V.; Franci, C.R.; Anderson, G.M.; Hoffman, G.E.; Anselmo-Franci, J.A. Kisspeptin Regulates Prolactin Release through Hypothalamic Dopaminergic Neurons. Endocrinology 2010, 151, 3247–3257. [Google Scholar] [CrossRef]
 - Shan, W.; Hu, W.; Wen, Y.; Ding, X.; Ma, X.; Yan, W.; Xia, Y. Evaluation of Atrazine Neurodevelopment Toxicity In Vitro-Application of hESC-Based Neural Differentiation Model. Reprod. Toxicol. 2021, 103, 149–158. [Google Scholar] [CrossRef] [PubMed]
 - Urbán, N.; Guillemot, F. Neurogenesis in the Embryonic and Adult Brain: Same Regulators, Different Roles. Front. Cell. Neurosci. 2014, 8, 396. [Google Scholar] [CrossRef] [PubMed]
 - Mills, E.G.A.; Dhillo, W.S.; Comninos, A.N. Kisspeptin and the Control of Emotions, Mood and Reproductive Behaviour. J. Endocrinol. 2018, 239, R1–R12. [Google Scholar] [CrossRef] [PubMed]
 - Ozawa, H. Kisspeptin Neurons as an Integration Center of Reproductive Regulation: Observation of Reproductive Function Based on a New Concept of Reproductive Regulatory Nervous System. Reprod. Med. Biol. 2021, 21, e12419. [Google Scholar] [CrossRef]
 - Kimura, M.; Ishii, M.N.; Seki, N.; Sakai, Y.; Yamashita, T.; Awatsuji, H.; Kanda, K.; Matsumoto, K.; Matsui, H. Reduction of Kiss1 Expression in the Anteroventral Periventricular Nucleus Is Associated with Atrazine-Induced Attenuation of the Luteinizing Hormone Surge in Female Rats. Biol. Reprod. 2019, 100, 41–48. [Google Scholar] [CrossRef]
 - Cohen, A.; Popowitz, J.; Delbridge-Perry, M.; Rowe, C.J.; Connaughton, V.P. The Role of Estrogen and Thyroid Hormones in Zebrafish Visual System Function. Front. Pharmacol. 2022, 13, 837687. [Google Scholar] [CrossRef]
 - Tang, H.; Chen, Y.; Liu, Y.; Yin, Y.; Li, G.; Guo, Y.; Liu, X.; Lin, H. New Insights Into the Role of Estrogens in Male Fertility Based on Findings in Aromatase-Deficient Zebrafish. Endocrinology 2017, 158, 3042–3054. [Google Scholar] [CrossRef]
 - Wasel, O.; Freeman, J.L. Chemical and Genetic Zebrafish Models to Define Mechanisms of and Treatments for Dopaminergic Neurodegeneration. Int. J. Mol. Sci. 2020, 21, 5981. [Google Scholar] [CrossRef]
 - Liu, Z.; Wang, Y.; Zhu, Z.; Yang, E.; Feng, X.; Fu, Z.; Jin, Y. Atrazine and Its Main Metabolites Alter the Locomotor Activity of Larval Zebrafish (Danio rerio). Chemosphere 2016, 148, 163–170. [Google Scholar] [CrossRef]
 - Weber, G.J.; Sepúlveda, M.S.; Peterson, S.M.; Lewis, S.S.; Freeman, J.L. Transcriptome Alterations Following Developmental Atrazine Exposure in Zebrafish Are Associated with Disruption of Neuroendocrine and Reproductive System Function, Cell Cycle, and Carcinogenesis. Toxicol. Sci. 2013, 132, 458–466. [Google Scholar] [CrossRef]
 - Wirbisky, S.E.; Weber, G.J.; Sepúlveda, M.S.; Xiao, C.; Cannon, J.R.; Freeman, J.L. Developmental Origins of Neurotransmitter and Transcriptome Alterations in Adult Female Zebrafish Exposed to Atrazine during Embryogenesis. Toxicology 2015, 333, 156–167. [Google Scholar] [CrossRef] [PubMed]
 - Kitahashi, T.; Ogawa, S.; Parhar, I.S. Cloning and Expression of Kiss2 in the Zebrafish and Medaka. Endocrinology 2009, 150, 821–831. [Google Scholar] [CrossRef] [PubMed]
 - Onuma, T.A.; Duan, C. Duplicated Kiss1 Receptor Genes in Zebrafish: Distinct Gene Expression Patterns, Different Ligand Selectivity, and a Novel Nuclear Isoform with Transactivating Activity. FASEB J. 2012, 26, 2941–2950. [Google Scholar] [CrossRef] [PubMed]
 - Sowers, M.R.; Zheng, H.; McConnell, D.; Nan, B.; Harlow, S.D.; Randolph, J.F. Estradiol Rates of Change in Relation to the Final Menstrual Period in a Population-Based Cohort of Women. J. Clin. Endocrinol. Metab. 2008, 93, 3847–3852. [Google Scholar] [CrossRef]
 - Stradtman, S.C.; Freeman, J.L. Mechanisms of Neurotoxicity Associated with Exposure to the Herbicide Atrazine. Toxics 2021, 9, 207. [Google Scholar] [CrossRef]
 - Samardzija, D.; Pogrmic-Majkic, K.; Fa, S.; Glisic, B.; Stanic, B.; Andric, N. Atrazine blocks ovulation via suppression of Lhr and Cyp19a1 mRNA and estradiol secretion in immature gonadotropin-treated rats. Reprod. Toxicol. 2016, 61, 10–18. [Google Scholar] [CrossRef]
 - Wilhelms, K.W.; Cutler, S.A.; Proudman, J.A.; Anderson, L.L.; Scanes, C.G. Effects of atrazine on sexual maturation in female Japanese quail induced by photostimulation or exogenous gonadotropin. Environ. Toxicol. Chem. 2006, 25, 233–240. [Google Scholar] [CrossRef]
 - Hall, J.E. Endocrinology of the Menopause. Endocrinol. Metab. Clin. N. Am. 2015, 44, 485–496. [Google Scholar] [CrossRef]
 - Cable, J.K.; Grider, M.H. Physiology, Progesterone. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2024. [Google Scholar]
 - von Hofsten, J.; Olsson, P.-E. Zebrafish Sex Determination and Differentiation: Involvement of FTZ-F1 Genes. Reprod. Biol. Endocrinol. 2005, 3, 63. [Google Scholar] [CrossRef]
 - Das, P.C.; McElroy, W.K.; Cooper, R.L. Differential Modulation of Catecholamines by Chlorotriazine Herbicides in Pheochromocytoma (PC12) Cells in Vitro. Toxicol. Sci. 2000, 56, 324–331. [Google Scholar] [CrossRef]
 - Coban, A.; Filipov, N.M. Dopaminergic Toxicity Associated with Oral Exposure to the Herbicide Atrazine in Juvenile Male C57BL/6 Mice. J. Neurochem. 2007, 100, 1177–1187. [Google Scholar] [CrossRef] [PubMed]
 - Walters, J.L.; Lansdell, T.A.; Lookingland, K.J.; Baker, L.E. The Effects of Gestational and Chronic Atrazine Exposure on Motor Behaviors and Striatal Dopamine in Male Sprague-Dawley Rats. Toxicol. Appl. Pharmacol. 2015, 289, 185–192. [Google Scholar] [CrossRef] [PubMed]
 - Li, J.; Li, X.; Bi, H.; Ma, K.; Li, B. Developmental Exposure to Atrazine Impairs Spatial Memory and Downregulates the Hippocampal D1 Dopamine Receptor and cAMP-Dependent Signaling Pathway in Rats. Int. J. Mol. Sci. 2018, 19, 2241. [Google Scholar] [CrossRef] [PubMed]
 - Dopamine: What It Is, Function & Symptoms. Available online: https://my.clevelandclinic.org/health/articles/22581-dopamine (accessed on 26 November 2024).
 - Kim, J.; Semaan, S.J.; Clifton, D.K.; Steiner, R.A.; Dhamija, S.; Kauffman, A.S. Regulation of Kiss1 Expression by Sex Steroids in the Amygdala of the Rat and Mouse. Endocrinology 2011, 152, 2020–2030. [Google Scholar] [CrossRef]
 - Tng, E.L. Kisspeptin Signalling and Its Roles in Humans. Singap. Med. J. 2015, 56, 649–656. [Google Scholar] [CrossRef]
 - Frontiers|Kisspeptin Exhibits Stimulatory Effects on Expression of the Genes for Kisspeptin Receptor, GnRH1 and GTH Subunits in a Gonadal Stage-Dependent Manner in the Grass Puffer, a Semilunar-Synchronized Spawner. Available online: https://www.frontiersin.org/journals/endocrinology/articles/10.3389/fendo.2022.917258/full (accessed on 11 November 2024).
 - Freeman, J.L.; Rayburn, A.L. Developmental Impact of Atrazine on Metamorphing Xenopus Laevis as Revealed by Nuclear Analysis and Morphology. Environ. Toxicol. Chem. 2005, 24, 1648–1653. [Google Scholar] [CrossRef]
 - Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio), 5th ed.; University of Oregon Press: Eugene, OR, USA, 2007. [Google Scholar]
 - Peterson, S.M.; Zhang, J.; Weber, G.; Freeman, J.L. Global Gene Expression Analysis Reveals Dynamic and Developmental Stage–Dependent Enrichment of Lead-Induced Neurological Gene Alterations. Environ. Health Perspect. 2011, 119, 615–621. [Google Scholar] [CrossRef]
 - Fleming, A.; Diekmann, H.; Goldsmith, P. Functional Characterisation of the Maturation of the Blood-Brain Barrier in Larval Zebrafish. PLoS ONE 2013, 8, e77548. [Google Scholar] [CrossRef]
 - Quiñonez-Silvero, C.; Hübner, K.; Herzog, W. Development of the Brain Vasculature and the Blood-Brain Barrier in Zebrafish. Dev. Biol. 2020, 457, 181–190. [Google Scholar] [CrossRef]
 - Wasel, O.; King, H.; Choi, Y.J.; Lee, L.S.; Freeman, J.L. Differential Developmental Neurotoxicity and Tissue Uptake of the Per- and Polyfluoroalkyl Substance Alternatives, GenX and PFBS. Environ. Sci. Technol. 2023, 57, 19274–19284. [Google Scholar] [CrossRef]
 - Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
 - Peterson, S.M.; Freeman, J.L. RNA Isolation from Embryonic Zebrafish and cDNA Synthesis for Gene Expression Analysis. J. Vis. Exp. 2009, 30, 1470. [Google Scholar] [CrossRef]
 - Wirbisky-Hershberger, S.E.; Sanchez, O.F.; Horzmann, K.A.; Thanki, D.; Yuan, C.; Freeman, J.L. Atrazine Exposure Decreases the Activity of DNMTs, Global DNA Methylation Levels, and Dnmt Expression. Food Chem. Toxicol. 2017, 109, 727–734. [Google Scholar] [CrossRef] [PubMed]
 - Wirbisky, S.E.; Sepulveda, M.S.; Weber, G.J.; Jannasch, A.S.; Horzmann, K.A.; Freeman, J.L. Embryonic atrazine exposure elicits alterations in genes associated with neuroendocrine function in adult male zebrafish. Toxicol. Sci. 2016, 153, 149–164. [Google Scholar] [CrossRef][Green Version]
 - Horzmann, K.A.; Lin, L.F.; Taslakjian, B.; Yuan, C.; Freeman, J.L. Anxiety-related behavior and associated brain transcriptome and epigenome alterations in adult female zebrafish exposed to atrazine during embryogenesis. Chemosphere 2022, 308, 136431. [Google Scholar] [CrossRef]
 




| Gene Name | Gene Symbol | Primer Sequences | NCBI RefSeq | Function | 
|---|---|---|---|---|
| Hypothalamic Targets | ||||
| Arginine Vasopressin | avp | CTGTCTGTGTGTGTGCTGTG GGATCTCTTGCCTCCTCGTG  | NM_178293.2 | Makes vasopressin | 
| Corticotropin-Releasing Hormone b | crhb | TACGAGAAGTACTGGAGATGGC TGATGGAAAAGCAGCACTATGG  | NM_001007379.1 | Regulates HPA axis | 
| Growth Hormone-Releasing Hormone | ghrh | AGGCTGTATTTTGCATCCGT TGGCATCATTTCAAAGCAGGAG  | NM_001080092.1 | Triggers growth Hormone release | 
| Gonadotropin-Releasing Hormone | gnrh | CAGTGCTGTCTATTCCTGCTGA CCCCGTCTGTCTGGAAATCTTT  | NM_182887.2 | Triggers LH and FSH synthesis and release | 
| Oxytocin | oxt | CTACATCTCAAACTGCCCCATC CACACGGAGAAGGGAGAAAATC  | NM_178291.2 | Plays a role in childbirth and behavior | 
| Somatostatin 1 | sst1 | CAGATACACACTCGCAGACCTG TCCAGACGCACATCATCTTTCT  | NM_183070.1 | Regulates the endocrine system | 
| Somatostatin 3 | sst3 | GCCGCACTTTAACTTCAACCAT TACTTTGTGCTGGGTTCCTCTC  | NM_001045431.2 | Regulates sleep and locomotor activity | 
| Thyrotropin-Releasing Hormone | trh | GGAAACACACCTGTCTCTCCAT TTGAGGAGACAGTCTGAACGTG  | NM_001012365.2 | Triggers thyrotropin release | 
| Pituitary Targets | ||||
| Follicle-Stimulating Hormone b | fshb | TGATTCAGTCTTCGTGTACCCC AGTGCTCTAGTGTATGCTGCAG  | NM_205624.1 | Develops reproductive organs, regulates the function of sperm, modifies androgens into estradiol | 
| Growth Hormone 1 | gh1 | CTTCGTATCTCTTTCCGCCTCA CGCCAGTTTCTCAGTGATTTGG  | NM_001020492.2 | Regulates the growth of tissues | 
| Luteinizing Hormone | lhb | GTGCACCATAAACACTTCCGAC CTCGACTGTGTGTGTAGGTTGA  | NM_205622.2 | Triggers the production of testosterone in males and estrogen and progesterone in females | 
| Adenocorticotropin Hormone | pomca | TTTCCTACCTGCACAACCCATT GGATGTGTCTGGTTGTCTTTGC  | NM_181438.3 | Regulates cortisol and androgen production | 
| Prolactin | prl | AGAACGCAACACCATTAACAGC CCATTAAACGGGAGAGTGGACA  | NM_181437.3 | Regulates lactation and breast development | 
| Thyroid-Stimulating Hormone | tsh | GCCACCTATCATGTCTCTCCTG CAGCCACACAGTAATTGCACTC  | NM_181494.2 | Stimulates thyroid hormone production | 
| Kisspeptin Targets | ||||
| Kisspeptin 1 | kiss1 | TCTAAACTCTCAGCGCTCTTCT TGTCCTGTTCTCTCTTGCCATA  | NM_001113489.1 | Regulates dopamine release | 
| Kisspeptin 2 | kiss2 | CGACTCTGACAGACTCAAACAC AGAAAATCGCATCCTTCTGACG  | NM_001142585.1 | Regulates reproduction and GnRH surge | 
| Kisspeptin 1 Receptor a | kiss1ra | CCTAACTTCAAGGCCAACTACG TGTGTCTGAAGAGGAAGGGAAA  | NM_001105679.2 | Kisspeptin receptor with affinity for Kisspeptin 1 and Kisspeptin 2 | 
| Kisspeptin 1 Receptor b | kiss1rb | ATCTTGCCACCACCGATATACT TGACCAGGCGACACATAAAATC  | NM_001110531.1 | Kisspeptin receptor with affinity for Kisspeptin 1 | 
| Dopamine Targets | ||||
| Dopamine Receptor D1a | drd1a | CTTTTGGGATGCCAGAGACTCT TTTCCGTCATTTTCCAACAGCC  | XM_021481157.1 | Dopamine receptor | 
| Dopamine Receptor D1b | drd1b | ATCTGCGCTCTAAAGTCACCAA TGACGCACAGATTCAAGATGGA  | NM_001135976.2 | Dopamine receptor | 
| Dopamine Receptor D2a | drd2a | ACTGACATATCACCTCCATCGC GCTAACATCTGAGTGGCCTTCT  | NM_183068.1 | Dopamine receptor | 
| Dopamine Receptor D2b | drd2b | ATGGCTCTGTGTGTGAAATTGC GTTTAGTGTTGACCCGTTTCCG  | NM_197936.1 | Dopamine receptor | 
| Dopamine Receptor D2 like | drd2L | TCCGCCGTATAACTTCTATGCC TGAGGTAATTGGTGGTGGTCTG  | NM_197935.1 | Dopamine receptor | 
| Danio rerio Solute Carrier Family 18 Member 2 | slc18a2 | TCGGTGTATGGAAGTGTGTACG AGGAGCAAACATGATGTCCACT  | NM_001256225.2 | Plays a role in monoaminergic neurotransmission | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stradtman, S.C.; Swihart, J.N.; Moore, K.; Akoro, I.N.; Ahkin Chin Tai, J.K.; Tamagno, W.A.; Freeman, J.L. Integrated Analysis of Neuroendocrine and Neurotransmission Pathways Following Developmental Atrazine Exposure in Zebrafish. Int. J. Mol. Sci. 2024, 25, 13066. https://doi.org/10.3390/ijms252313066
Stradtman SC, Swihart JN, Moore K, Akoro IN, Ahkin Chin Tai JK, Tamagno WA, Freeman JL. Integrated Analysis of Neuroendocrine and Neurotransmission Pathways Following Developmental Atrazine Exposure in Zebrafish. International Journal of Molecular Sciences. 2024; 25(23):13066. https://doi.org/10.3390/ijms252313066
Chicago/Turabian StyleStradtman, Sydney C., Jenna N. Swihart, Kaylin Moore, Isabelle N. Akoro, Janiel K. Ahkin Chin Tai, Wagner Antonio Tamagno, and Jennifer L. Freeman. 2024. "Integrated Analysis of Neuroendocrine and Neurotransmission Pathways Following Developmental Atrazine Exposure in Zebrafish" International Journal of Molecular Sciences 25, no. 23: 13066. https://doi.org/10.3390/ijms252313066
APA StyleStradtman, S. C., Swihart, J. N., Moore, K., Akoro, I. N., Ahkin Chin Tai, J. K., Tamagno, W. A., & Freeman, J. L. (2024). Integrated Analysis of Neuroendocrine and Neurotransmission Pathways Following Developmental Atrazine Exposure in Zebrafish. International Journal of Molecular Sciences, 25(23), 13066. https://doi.org/10.3390/ijms252313066
        
                                                
