Non-Categorical Analyses Identify Rotenone-Induced ‘Parkinsonian’ Rats Benefiting from Nano-Emulsified Punicic Acid (Nano-PSO) in a Phenotypically Diverse Population: Implications for Translational Neurodegenerative Therapies
Abstract
1. Introduction
2. Results
2.1. General Considerations
- (A)
- The motor phenotype (MoP), defined by the statistical interaction between the treatment and the latency values obtained in each of the assessments conducted during the inclined beam test. These assessments were performed 21 days and 42 days after the initiation of treatment.
- (B)
- The morphotype (MrP), defined by the statistical interaction between the type of treatment and the number of dopaminergic neurons present in the right side or left side and in the combined total within the Substantia nigra pars compacta (SNpc). The morphological assessment was conducted in fixed brains collected 42 days after the initiation of treatment.
- (C)
- The α-synuclein phenotype (αSP), defined by the statistical interaction between the treatment and the concentration of α-synuclein (α-syn), as measured in homogenates of the caudate nucleus (CaNu) and (SNpc). Tissue samples were collected bilaterally on day 42 following the initiation of treatment.
- (D)
- The dopaminergic phenotype (DP [34]), defined by the statistical interaction between the treatment and the concentration of dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC), the DA:DOPAC ratio, and serotonin (5HT), as assessed in the homogenates of CaNu and SNpc. Tissue samples were collected bilaterally on day 42 following the initiation of treatment.
- (E)
- Lipid peroxidation phenotype (LPP), defined by the statistical interaction between the treatment and the concentration of malondialdehyde (MDA) in homogenates of CaNu and SNpc. Tissue samples were collected bilaterally on day 42 following the initiation of treatment.
- (F)
- Transcriptomic phenotype (TP), defined by the statistical interaction between the treatment and the relative transcription levels of genes encoding tyrosine hydroxylase (TH), α-syn, glucose transporter 3 (GLUT3), glucose transporter 4 (GLUT4), catalase (CAT), glutathione peroxidase 1, (GPX1), and superoxide dismutase (SOD) in homogenates of CaNu. Tissue samples were collected bilaterally on day 42 following the initiation of treatment.
- (G)
- Anti-oxidative phenotype (AOP), defined by the statistical interaction between the treatment and the activity levels of CAT, GPx, and SOD, as estimated in blood samples withdrawn 42 days after the initiation of treatment.
- (H)
- Glucose, triglycerides, and cholesterol profile (GTCP), defined by the statistical interaction between the treatment and the concentration of glucose, triglycerides, and cholesterol in blood samples withdrawn 42 days after the initiation of treatment.
2.2. Assessing MoPs Variance and Similitude
2.3. Assessing MrPs Variance and Similitude
2.4. Assessing αSPs Variance and Similitude
2.5. Assessing DPs Variance and Similitude
2.6. Assessing LPPs Variance and Similitude
2.7. Assessing TPs Variance and Similitude
2.8. Assessing AOPs Variance and Similitude
2.9. Assessing GTCPs Variance and Similitude
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Motor Coordination Tests
4.3. Dopaminergic Neuron Counts
4.4. Concentrations of Dopamine (DA), 3,4-Dihydroxyphenylacetic Acid (DOPAC), and Serotonin (5-HT) by Reverse Phase, High-Performance Lipid Chromatography
4.5. Concentration of α-Synuclein by ELISA
4.6. Estimation of Lipid Peroxidation by Colorimetry
4.7. Estimation of the Activity of Oxidative Enzymes by Colorimetry
4.8. Gene Expression Profiling
4.9. Blood Glucose and Lipid Estimates
4.10. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mazzio, E.A.; Close, F.; Soliman, K.F.A. The Biochemical and Cellular Basis for Nutraceutical Strategies to Attenuate Neurodegeneration in Parkinson’s Disease. Int. J. Mol. Sci. 2011, 12, 506–569. [Google Scholar] [CrossRef] [PubMed]
- Dey, A.; De, J.N. Possible Anti-Parkinson’s Disease Therapeutics from Nature: A Review. Stud. Nat. Prod. Chem. 2015, 44, 447–520. [Google Scholar] [CrossRef]
- Tapias, V.; McCoy, J.L.; Greenamyre, J.T. Phenothiazine Normalizes the NADH/NAD + Ratio, Maintains Mitochondrial Integrity and Protects the Nigrostriatal Dopamine System in a Chronic Rotenone Model of Parkinson’s Disease. Redox Biol. 2019, 24, 101164. [Google Scholar] [CrossRef] [PubMed]
- Bayir, H.; Kapralov, A.A.; Jiang, J.; Huang, Z.; Tyurina, Y.Y.; Tyurin, V.A.; Zhao, Q.; Belikova, N.A.; Vlasova, I.I.; Maeda, A.; et al. Peroxidase Mechanism of Lipid-Dependent Cross-Linking of Synuclein with Cytochrome C: Protection against Apoptosis versus Delayed Oxidative Stress in Parkinson Disease. J. Biol. Chem. 2009, 284, 15951–15969. [Google Scholar] [CrossRef] [PubMed]
- Berg, D.; Lang, A.E.; Postuma, R.B.; Maetzler, W.; Deuschl, G.; Gasser, T.; Siderowf, A.; Schapira, A.H.; Oertel, W.; Obeso, J.A.; et al. Changing the Research Criteria for the Diagnosis of Parkinson’s Disease: Obstacles and Opportunities. Lancet Neurol. 2013, 12, 514–524. [Google Scholar] [CrossRef]
- Martinez, P. The Comparative Method in Biology and the Essentialist Trap. Front. Ecol. Evol. 2018, 6, 130. [Google Scholar] [CrossRef]
- Fernbach, P.M.; Van Boven, L. False Polarization: Cognitive Mechanisms and Potential Solutions. Curr. Opin. Psychol. 2022, 43, 1–6. [Google Scholar] [CrossRef]
- Runco Mark, A. Chapter 1—Cognition and Creativity. In Creativity; Academic Press: Cambridge, MA, USA, 2023; pp. 1–36. [Google Scholar]
- Stephens, M.C.; Brandt, V.; Botas, J. The Developmental Roots of Neurodegeneration. Neuron 2022, 110, 1–3. [Google Scholar] [CrossRef]
- Bayer, T.A. Proteinopathies, a Core Concept for Understanding and Ultimately Treating Degenerative Disorders? Eur. Neuropsychopharmacol. 2015, 25, 713–724. [Google Scholar] [CrossRef]
- Calne, D.B. Is “Parkinson’s Disease” One Disease? J. Neurol. Neurosurg. Psychiatry 1989, 52, 18–21. [Google Scholar] [CrossRef]
- Rockenstein, E.; Clarke, J.; Viel, C.; Panarello, N.; Treleaven, C.M.; Kim, C.; Spencer, B.; Adame, A.; Park, H.; Dodge, J.C.; et al. Glucocerebrosidase Modulates Cognitive and Motor Activities in Murine Models of Parkinson’s Disease. Hum. Mol. Genet. 2016, 25, 2645–2660. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Peters, O.M.; Weiss, A.; Metterville, J.; Song, L.; Logan, R.; Smith, G.A.; Schwarzschild, M.A.; Mueller, C.; Brown, R.H.; Freeman, M. Genetic Diversity of Axon Degenerative Mechanisms in Models of Parkinson’s Disease. Neurobiol. Dis. 2021, 155, 105368. [Google Scholar] [CrossRef] [PubMed]
- Lesage, S.; Brice, A. Parkinson’s Disease: From Monogenic Forms to Genetic Susceptibility Factors. Hum. Mol. Genet. 2009, 18, R48–R59. [Google Scholar] [CrossRef] [PubMed]
- Angelopoulou, E.; Bougea, A.; Hatzimanolis, A.; Stefanis, L.; Scarmeas, N.; Papageorgiou, S. Mild Behavioral Impairment in Parkinson’s Disease: An Updated Review on the Clinical, Genetic, Neuroanatomical, and Pathophysiological Aspects. Medicina 2024, 60, 115. [Google Scholar] [CrossRef] [PubMed]
- Lord, S.; Galna, B.; Coleman, S.; Yarnall, A.; Burn, D.; Rochester, L. Cognition and Gait Show a Selective Pattern of Association Dominated by Phenotype in Incident Parkinson’s Disease. Front. Aging Neurosci. 2014, 6, 249. [Google Scholar] [CrossRef]
- Che, N.N.; Jiang, Q.H.; Chen, S.; Chen, S.Y.; Zhao, Z.X.; Li, X.; Ma, J.J.; Zhang, J.W.; Malik, R.A.; Yang, H.Q. The Severity of Corneal Nerve Loss Differentiates Motor Subtypes in Patients with Parkinson’s Disease. Ther. Adv. Neurol. Disord. 2023, 16, 17562864231165561. [Google Scholar] [CrossRef]
- Zhang, L.; Gu, L.Y.; Dai, S.B.; Zheng, R.; Jin, C.Y.; Fang, Y.; Yang, W.Y.; Tian, J.; Yin, X.Z.; Zhao, G.H.; et al. Associations of Body Mass Index-Metabolic Phenotypes with Cognitive Decline in Parkinson’s Disease. Eur. Neurol. 2022, 85, 24–30. [Google Scholar] [CrossRef]
- Tresse, E.; Marturia-Navarro, J.; Sew, W.Q.G.; Cisquella-Serra, M.; Jaberi, E.; Riera-Ponsati, L.; Fauerby, N.; Hu, E.; Kretz, O.; Aznar, S.; et al. Mitochondrial DNA Damage Triggers Spread of Parkinson’s Disease-like Pathology. Mol. Psychiatry 2023, 28, 4902–4914. [Google Scholar] [CrossRef]
- O’Hanlon, M.E.; Tweedy, C.; Scialo, F.; Bass, R.; Sanz, A.; Smulders-Srinivasan, T.K. Mitochondrial Electron Transport Chain Defects Modify Parkinson’s Disease Phenotypes in a Drosophila Model. Neurobiol. Dis. 2022, 171, 105803. [Google Scholar] [CrossRef]
- Mor, D.E.; Sohrabi, S.; Kaletsky, R.; Keyes, W.; Tartici, A.; Kalia, V.; Miller, D.; Gary, W.; Murphy, C.T. Metformin Rescues Parkinson’s Disease Phenotypes Caused by Hyperactive Mitochondria. Proc. Natl. Acad. Sci. USA 2020, 117, 26438–26447. [Google Scholar] [CrossRef]
- Castelo Rueda, M.P.; Zanon, A.; Gilmozzi, V.; Lavdas, A.A.; Raftopoulou, A.; Delcambre, S.; Del Greco, M.F.; Klein, C.; Grünewald, A.; Pramstaller, P.P.; et al. Molecular Phenotypes of Mitochondrial Dysfunction in Clinically Non-Manifesting Heterozygous PRKN Variant Carriers. NPJ Park. Dis. 2023, 9, 65. [Google Scholar] [CrossRef] [PubMed]
- Heger, L.M.; Wise, R.M.; Hees, J.T.; Harbauer, A.B.; Burbulla, L.F. Mitochondrial Phenotypes in Parkinson’s Diseases—A Focus on Human Ipsc-Derived Dopaminergic Neurons. Cells 2021, 10, 3436. [Google Scholar] [CrossRef] [PubMed]
- Binyamin, O.; Nitzan, K.; Frid, K.; Ungar, Y.; Rosenmann, H.; Gabizon, R. Brain Targeting of 9c,11t-Conjugated Linoleic Acid, a Natural Calpain Inhibitor, Preserves Memory and Reduces Aβ and P25 Accumulation in 5XFAD Mice. Sci. Rep. 2019, 9, 18437. [Google Scholar] [CrossRef] [PubMed]
- Testa, C.M.; Sherer, T.B.; Greenamyre, J.T. Rotenone Induces Oxidative Stress and Dopaminergic Neuron Damage in Organotypic Substantia Nigra Cultures. Mol. Brain Res. 2005, 134, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Maglioni, S.; Ventura, N.C. Elegans as a Model Organism for Human Mitochondrial Associated Disorders. Mitochondrion 2016, 30, 117–125. [Google Scholar] [CrossRef]
- Caboni, P.; Sherer, T.B.; Zhang, N.; Taylor, G.; Na, H.M.; Greenamyre, J.T.; Casida, J.E. Rotenone, Deguelin, Their Metabolites, and the Rat Model of Parkinson’s Disease. Chem. Res. Toxicol. 2004, 17, 1540–1548. [Google Scholar] [CrossRef]
- Mizrahi, M.; Friedman-Levi, Y.; Larush, L.; Frid, K.; Binyamin, O.; Dori, D.; Fainstein, N.; Ovadia, H.; Ben-Hur, T.; Magdassi, S.; et al. Pomegranate Seed Oil Nanoemulsions for the Prevention and Treatment of Neurodegenerative Diseases: The Case of Genetic CJD. Nanomedicine 2014, 10, 1353–1363. [Google Scholar] [CrossRef]
- Binyamin, O.; Keller, G.; Frid, K.; Larush, L.; Magdassi, S.; Gabizon, R. Continues Administration of Nano-PSO Significantly Increased Survival of Genetic CJD Mice. Neurobiol. Dis. 2017, 108, 140–147. [Google Scholar] [CrossRef]
- Keller, G.; Binyamin, O.; Frid, K.; Saada, A.; Gabizon, R. Mitochondrial Dysfunction in Preclinical Genetic Prion Disease: A Target for Preventive Treatment? Neurobiol. Dis. 2019, 124, 57–66. [Google Scholar] [CrossRef]
- Petrou, P.; Ginzberg, A.; Binyamin, O.; Karussis, D.; Petrou, B. Beneficial Effects of a Nano Formulation of Pomegranate Seed Oil, GranaGard, on the Cognitive Function of Multiple Sclerosis Patients. Mult. Scler. Relat. Disord. 2021, 54, 103103. [Google Scholar] [CrossRef]
- Voelkl, B.; Altman, N.S.; Forsman, A.; Forstmeier, W.; Gurevitch, J.; Jaric, I.; Karp, N.A.; Kas, M.J.; Schielzeth, H.; Van de Casteele, T.; et al. Reproducibility of Animal Research in Light of Biological Variation. Nat. Rev. Neurosci. 2020, 21, 384–393. [Google Scholar] [CrossRef] [PubMed]
- Gerrits, L.; Pagliarin, S. Social and Causal Complexity in Qualitative Comparative Analysis (QCA): Strategies to Account for Emergence. Int. J. Soc. Res. Methodol. 2021, 24, 501–514. [Google Scholar] [CrossRef]
- Viggiano, D.; Ruocco, L.A.; Sadile, A.G. Dopamine Phenotype and Behaviour in Animal Models: In Relation to Attention Deficit Hyperactivity Disorder. Neurosci. Biobehav. Rev. 2003, 27, 623–637. [Google Scholar] [CrossRef] [PubMed]
- Simonet, C.; Schrag, A.; Lees, A.J.; Noyce, A.J. The Motor Prodromes of Parkinson’s Disease: From Bedside Observation to Large-Scale Application. J. Neurol. 2021, 268, 2099–2108. [Google Scholar] [CrossRef] [PubMed]
- Mallet, D.; Dufourd, T.; Decourt, M.; Carcenac, C.; Bossù, P.; Verlin, L.; Fernagut, P.O.; Benoit-Marand, M.; Spalletta, G.; Barbier, E.L.; et al. A Metabolic Biomarker Predicts Parkinson’s Disease at the Early Stages in Patients and Animal Models. J. Clin. Investig. 2022, 132, e146400. [Google Scholar] [CrossRef]
- Shao, Y.; Li, T.; Liu, Z.; Wang, X.; Xu, X.; Li, S.; Xu, G.; Le, W. Comprehensive Metabolic Profiling of Parkinson’s Disease by Liquid Chromatography-Mass Spectrometry. Mol. Neurodegener. 2021, 16, 4. [Google Scholar] [CrossRef]
- Goetz, L.H.; Schork, N.J. Personalized Medicine: Motivation, Challenges, and Progress. Fertil. Steril. 2018, 109, 952–963. [Google Scholar] [CrossRef]
- Mitoma, H.; Kakei, S.; Tanaka, H.; Manto, M. Morphological and Functional Principles Governing the Plasticity Reserve in the Cerebellum: The Cortico-Deep Cerebellar Nuclei Loop Model. Biology 2023, 12, 1435. [Google Scholar] [CrossRef]
- Toricelli, M.; Pereira, A.; Souza Abrao, G.; Malerba, H.; Maia, J.; Buck, H.; Viel, T. Mechanisms of Neuroplasticity and Brain Degeneration: Strategies for Protection during the Aging Process. Neural Regen. Res. 2021, 16, 58–67. [Google Scholar] [CrossRef]
- Liu, D.; Guo, J.J.; Su, J.H.; Svanbergsson, A.; Yuan, L.; Haikal, C.; Li, W.; Gouras, G.; Li, J.Y. Differential Seeding and Propagating Efficiency of α-Synuclein Strains Generated in Different Conditions. Transl. Neurodegener. 2021, 10, 20. [Google Scholar] [CrossRef]
- Buchanan, A.M.; Mena, S.; Choukari, I.; Vasa, A.; Crawford, J.N.; Fadel, J.; Maxwell, N.; Reagan, L.; Cruikshank, A.; Best, J.; et al. Serotonin as a Biomarker of Toxin-Induced Parkinsonism. Mol. Med. 2024, 30, 33. [Google Scholar] [CrossRef] [PubMed]
- Patrick, R.P.; Ames, B.N. Vitamin D and the Omega-3 Fatty Acids Control Serotonin Synthesis and Action, Part 2: Relevance for ADHD, Bipolar Disorder, Schizophrenia, and Impulsive Behavior. FASEB J. 2015, 29, 2207–2222. [Google Scholar] [CrossRef] [PubMed]
- Avcı, B.; Günaydın, C.; Güvenç, T.; Yavuz, C.K.; Kuruca, N.; Bilge, S.S. Idebenone Ameliorates Rotenone-Induced Parkinson’s Disease in Rats Through Decreasing Lipid Peroxidation. Neurochem. Res. 2021, 46, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Bashkatova, V.; Alam, M.; Vanin, A.; Prast, H.; Schmidt, W.J. Chronic Administration of Rotenone Induces Parkinsonian Symptoms and Increases Levels of Nitric Oxide in Rat Brain. BMC Pharmacol. 2008, 8, A33. [Google Scholar] [CrossRef]
- Ackerman, H.D.; Gerhard, G.S. Bile Acids in Neurodegenerative Disorders. Front. Aging Neurosci. 2016, 8, 263. [Google Scholar] [CrossRef]
- Adams, B.; Nunes, J.M.; Page, M.J.; Roberts, T.; Carr, J.; Nell, T.A.; Kell, D.B.; Pretorius, E. Parkinson’s Disease: A Systemic Inflammatory Disease Accompanied by Bacterial Inflammagens. Front. Aging Neurosci. 2019, 10, 210. [Google Scholar] [CrossRef]
- Costa, H.N.; Esteves, A.R.; Empadinhas, N.; Cardoso, S.M. Parkinson’s Disease: A Multisystem Disorder. Neurosci. Bull. 2023, 39, 113–124. [Google Scholar] [CrossRef]
- Ezquerra, M.; Martí, M.J.; Fernández-Santiago, R. Parkinson’s Disease as a Systemic Pathology. Aging 2019, 11, 1081–1082. [Google Scholar] [CrossRef]
- Silva, A.B.R.L.; de Oliveira, R.W.G.; Diógenes, G.P.; Aguiar, M.F.d.C.; Sallem, C.C.; Lima, M.P.P.; Filho, L.B.d.A.; de Medeiros, S.D.P.; de Mendonça, L.L.P.; Filho, P.C.d.S.; et al. Premotor, Nonmotor and Motor Symptoms of Parkinson’s Disease A New Clinical State of the Art. Ageing Res. Rev. 2022, 84, 101834. [Google Scholar] [CrossRef]
- Abdik, E.; Çakır, T. Systematic Investigation of Mouse Models of Parkinson’s Disease by Transcriptome Mapping on a Brain-Specific Genome-Scale Metabolic Network. Mol. Omics 2021, 17, 492–502. [Google Scholar] [CrossRef]
- Zhou, Z.D.; Yi, L.X.; Wang, D.Q.; Lim, T.M.; Tan, E.K. Role of Dopamine in the Pathophysiology of Parkinson’s Disease. Transl. Neurodegener. 2023, 12, 44. [Google Scholar] [CrossRef] [PubMed]
- Chin-Chan, M.; Navarro-Yepes, J.; Quintanilla-Vega, B. Environmental Pollutants as Risk Factors for Neurodegenerative Disorders: Alzheimer and Parkinson Diseases. Front. Cell. Neurosci. 2015, 9, 124. [Google Scholar] [CrossRef] [PubMed]
- Saha, S.S.; Ghosh, M. Comparative Study of Antioxidant Activity of α-Eleostearic Acid and Punicic Acid against Oxidative Stress Generated by Sodium Arsenite. Food Chem. Toxicol. 2009, 47, 2551–2556. [Google Scholar] [CrossRef] [PubMed]
- Guerra-Vázquez, C.M.; Martínez-Ávila, M.; Guajardo-Flores, D.; Antunes-Ricardo, M. Punicic Acid and Its Role in the Prevention of Neurological Disorders: A Review. Foods 2022, 11, 252. [Google Scholar] [CrossRef] [PubMed]
- Shabbir, M.A.; Khan, M.R.; Saeed, M.; Pasha, I.; Khalil, A.A.; Siraj, N. Punicic Acid: A Striking Health Substance to Combat Metabolic Syndromes in Humans. Lipids Health Dis. 2017, 16, 99. [Google Scholar] [CrossRef]
- Vivekkumar, P.; Priyanka, P.; Ajit, V.; Durga, N. Nutraceuticals against Neurodegeneration: A Mechanistic Insight. Curr. Neuropharmacol. 2016, 14, 627. [Google Scholar] [CrossRef]
- Wal, P.; Aziz, N.; Dash, B.; Tyagi, S.; Vinod, Y.R. Neuro-Nutraceuticals: Insights of Experimental Evidences and Molecular Mechanism in Neurodegenerative Disorders. Future J. Pharm. Sci. 2023, 9, 31. [Google Scholar] [CrossRef]
- Reza-Zaldívar, E.E.; Jacobo-Velázquez, D.A. Comprehensive Review of Nutraceuticals against Cognitive Decline Associated with Alzheimer’s Disease. ACS Omega 2023, 8, 35499–35522. [Google Scholar] [CrossRef]
- Makkar, R.; Behl, T.; Bungau, S.; Zengin, G.; Mehta, V.; Kumar, A.; Uddin, M.S.; Ashraf, G.M.; Abdel-Daim, M.M.; Arora, S.; et al. Nutraceuticals in Neurological Disorders. Int. J. Mol. Sci. 2020, 21, 4424. [Google Scholar] [CrossRef]
- Rajalakshmi, R.; Melians, M.A.; Pon, F.F.; Cosio, D.S.; Buvarahamurthy, V.; Jayakumar, A.R.; Paidas, M.J. Advantages and Disadvantages of Nutraceuticals. In Nutraceuticals for Alzheimer’s Disease: A Promising Therapeutic Approach; Arokiyasamy, J.T., Thamilarasan, M., Eds.; Springer: Singapore, 2023; pp. 245–286. ISBN 978-981-99-0677-2. [Google Scholar]
- Rai, S.N.; Singh, P.; Steinbusch, H.W.M.; Vamanu, E.; Ashraf, G.; Singh, M.P. The Role of Vitamins in Neurodegenerative Disease: An Update. Biomedicines 2021, 9, 1284. [Google Scholar] [CrossRef]
- Andrade, S.; Nunes, D.; Dabur, M.; Ramalho, M.J.; Pereira, M.C.; Loureiro, J.A. Therapeutic Potential of Natural Compounds in Neurodegenerative Diseases: Insights from Clinical Trials. Pharmaceutics 2023, 15, 212. [Google Scholar] [CrossRef] [PubMed]
- Mecocci, P.; Tinarelli, C.; Schulz, R.J.; Polidori, M.C. Nutraceuticals in Cognitive Impairment and Alzheimer’s Disease. Front. Pharmacol. 2014, 5, 91372. [Google Scholar] [CrossRef] [PubMed]
- Şimşek, H.; Uçar, A. Polyunsaturated Fatty Acids as a Nutraceutical for Age-Related Neurodegenerative Diseases: Current Knowledge and Future Directions. Clin. Nutr. Open Sci. 2024, 56, 65–73. [Google Scholar] [CrossRef]
- Farías, G.A.; Guzmán-Martínez, L.; Delgado, C.; Maccioni, R.B. Nutraceuticals: A Novel Concept in Prevention and Treatment of Alzheimer’s Disease and Related Disorders. J. Alzheimer’s Dis. 2014, 42, 357–367. [Google Scholar] [CrossRef] [PubMed]
- Avallone, R.; Vitale, G.; Bertolotti, M. Omega-3 Fatty Acids and Neurodegenerative Diseases: New Evidence in Clinical Trials. Int. J. Mol. Sci. 2019, 20, 4256. [Google Scholar] [CrossRef]
- Calin-Jageman, R.J.; Cumming, G. The New Statistics for Better Science: Ask How Much, How Uncertain, and What Else Is Known. Am. Stat. 2019, 73, 271–280. [Google Scholar] [CrossRef]
- Serpico, D. Beyond Quantitative and Qualitative Traits: Three Telling Cases in the Life Sciences. Biol. Philos. 2020, 35, 34. [Google Scholar] [CrossRef]
- Garchery, M.; Granitzer, M. On the Influence of Categorical Features in Ranking Anomalies Using Mixed Data. Proc. Comp. Sci. 2018, 126, 77–86. [Google Scholar] [CrossRef]
- Yan, F.; Robert, M.; Li, Y. Statistical Methods and Common Problems in Medical. Int. J. Physiol. Pathophysiol. Pharmacol. 2017, 9, 157–163. [Google Scholar]
- Hanckel, B.; Petticrew, M.; Thomas, J.; Green, J. The Use of Qualitative Comparative Analysis (QCA) to Address Causality in Complex Systems: A Systematic Review of Research on Public Health Interventions. BMC Public Health 2021, 21, 877. [Google Scholar] [CrossRef]
- Chandra, G.; Shenoi, R.A.; Anand, R.; Rajamma, U.; Mohanakumar, K.P. Reinforcing Mitochondrial Functions in Aging Brain: An Insight into Parkinson’s Disease. J. Chem. Neuroanat. 2019, 95, 29–42. [Google Scholar] [CrossRef] [PubMed]
- Bloem, B.R.; Marks, W.J.; Silva De Lima, A.L.; Kuijf, M.L.; Van Laar, T.; Jacobs, B.P.F.; Verbeek, M.M.; Helmich, R.C.; Van De Warrenburg, B.P.; Evers, L.J.W.; et al. The Personalized Parkinson Project: Examining Disease Progression through Broad Biomarkers in Early Parkinson’s Disease. BMC Neurol. 2019, 19, 160. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa-Hattori, Y.; Yoshino, H.; Kondo, T.; Mizuno, Y.; Horai, S. Is Parkinson’s Disease a Mitochondrial Disorder? J. Neurol. Sci. 1992, 107, 29–33. [Google Scholar] [CrossRef] [PubMed]
- Briston, T.; Hicks, A.R. Mitochondrial Dysfunction and Neurodegenerative Proteinopathies: Mechanisms and Prospects for Therapeutic Intervention. Biochem. Soc. Trans. 2018, 46, 829–842. [Google Scholar] [CrossRef]
- Grünewald, A.; Kumar, K.R.; Sue, C.M. New Insights into the Complex Role of Mitochondria in Parkinson’s Disease. Prog. Neurobiol. 2019, 177, 73–93. [Google Scholar] [CrossRef]
- Uttara, B.; Singh, A.V.; Zamboni, P.; Mahajan, R.T. Oxidative Stress and Neurodegenerative Diseases: A Review of Upstream and Downstream Antioxidant Therapeutic Options. Curr. Neuropharmacol. 2009, 7, 65–74. [Google Scholar] [CrossRef]
- Sauerbier, A.; Jenner, P.; Todorova, A.; Chaudhuri, K.R. Non Motor Subtypes and Parkinson’s Disease. Park. Relat. Disord. 2016, 22, S41–S46. [Google Scholar] [CrossRef]
- Austin, C.P. Opportunities and Challenges in Translational Science. Clin. Transl. Sci. 2021, 14, 1629–1647. [Google Scholar] [CrossRef]
- Luke, D.A.; Sarli, C.C.; Suiter, A.M.; Carothers, B.J.; Combs, T.B.; Allen, J.L.; Beers, C.E.; Evanoff, B.A. The Translational Science Benefits Model: A New Framework for Assessing the Health and Societal Benefits of Clinical and Translational Sciences. Clin. Transl. Sci. 2018, 11, 77–84. [Google Scholar] [CrossRef]
- Shahwar, D.; Ansari, M.Y.K.; Choudhary, S. Induction of Phenotypic Diversity in Mutagenized Population of Lentil (Lens culinaris Medik) by Using Heavy Metal. Heliyon 2019, 5, e01722. [Google Scholar] [CrossRef]
- Danovi, S. Safia Danovi Drug Treatment and Phenotypic Diversity. Nat. Genet. 2023, 55, 1253. [Google Scholar] [CrossRef] [PubMed]
- Vogt, G. Disentangling the Environmentally Induced and Stochastic Developmental Components of Phenotypic Variation. In Phenotypic Switching: Implications in Biology and Medicine; Elsevier: Amsterdam, The Netherlands, 2020; pp. 207–251. ISBN 9780128179963. [Google Scholar]
- Willmore, K.E.; Hallgrímsson, B. Within Individual Variation: Developmental Noise versus Developmental Stability. In Variation; Academic Press: Cambridge, MA, USA, 2005; pp. 191–218. [Google Scholar] [CrossRef]
- Zhang, Y.-H.; Tang, B.-S.; Song, C.-Y.; Xu, Q.; Lou, M.-X.; Liu, Z.-H.; Yu, R.-H.; Yan, X.-X.; Guo, J.-F. The Relationship between the Phenotype of Parkinson’s Disease and Levodopa-Induced Dyskinesia. Neurosci. Lett. 2013, 556, 109–112. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Chavarín, M.; Díaz-Pérez, R.; Morales-Espinosa, R.; Fernández-Ruiz, J.; Roldán-Roldán, G.; Torner, C.; Torner Aguilar, C.A. Efecto de La Exposición al Pesticida Rotenona Sobre El Desarrollo Del Sistema Dopaminérgico Nigro Efecto de La Exposición al Pesticida Rotenona Sobre El Desarrollo Del Sistema Dopaminérgico Nigro-Estriatal En Ratas. Salud Ment. 2013, 36, 1–8. [Google Scholar] [CrossRef]
- Shai Agencia Digital Grana Gard. Available online: https://granagard.com.mx/granagard/#nanotecnologia (accessed on 27 October 2024).
- Patel, C.; Dadhaniya, P.; Hingorani, L.; Soni, M.G. Safety Assessment of Pomegranate Fruit Extract: Acute and Subchronic Toxicity Studies. Food Chem. Toxicol. 2008, 46, 2728–2735. [Google Scholar] [CrossRef]
- Tsuzuki, T.; Kawakami, Y.; Abe, R.; Nakagawa, K.; Koba, K.; Imamura, J.; Iwata, T.; Ikeda, I.; Miyazawa, T. Conjugated Linolenic Acid Is Slowly Absorbed in Rat Intestine, but Quickly Converted to Conjugated Linoleic Acid. J. Nutr. 2006, 136, 2153–2159. [Google Scholar] [CrossRef]
- Pereira de Melo, I.L.; de Oliveira e Silva, A.M.; Yoshime, L.T.; Gasparotto Sattler, J.A.; Teixeira de Carvalho, E.B.; Mancini-Filho, J. Punicic Acid Was Metabolised and Incorporated in the Form of Conjugated Linoleic Acid in Different Rat Tissues. Int. J. Food Sci. Nutr. 2019, 70, 421–431. [Google Scholar] [CrossRef]
- Yuan, G.F.; Yuan, J.Q.; Li, D. Punicic Acid from Trichosanthes Kirilowii Seed Oil Is Rapidly Metabolized to Conjugated Linoleic Acid in Rats. J. Med. Food 2009, 12, 416–422. [Google Scholar] [CrossRef]
- Drucker-Colfn, R.; Garcla-Hernfindez, F. A New Motor Test Sensitive to Aging and Dopaminergic Function. J. Neurosci. Methods 1991, 39, 153–161. [Google Scholar] [CrossRef]
- Estévez-Cabrera, M.M.; Sánchez-Muñoz, F.; Pérez-Sánchez, G.; Pavón, L.; Hernández-Díazcouder, A.; Córtes Altamirano, J.L.; Soria-Fregoso, C.; Alfaro-Rodríguez, A.; Bonilla-Jaime, H. Therapeutic Treatment with Fluoxetine Using the Chronic Unpredictable Stress Model Induces Changes in Neurotransmitters and Circulating MiRNAs in Extracellular Vesicles. Heliyon 2023, 9, e13442. [Google Scholar] [CrossRef]
- Maldonado-García, J.L.; Pérez-Sánchez, G.; Becerril-Villanueva, E.; Alvarez-Herrera, S.; Pavón, L.; Sánchez-Torres, L.; Gutiérrez-Ospina, G.; Girón-Pérez, M.I.; Damian-Morales, G.; Maldonado-Tapia, J.O.; et al. Imipramine Administration in Brucella Abortus 2308-Infected Mice Restores Hippocampal Serotonin Levels, Muscle Strength, and Mood, and Decreases Spleen CFU Count. Pharmaceuticals 2023, 16, 1525. [Google Scholar] [CrossRef]
- Barbosa-Méndez, S.; Perez-Sánchez, G.; Salazar-Juárez, A. Agomelatine Decreases Cocaine-Induced Locomotor Sensitisation and Dopamine Release in Rats. World J. Biol. Psychiatry 2023, 24, 400–413. [Google Scholar] [CrossRef] [PubMed]
- Ponce-Regalado, M.D.; Salazar-Juárez, A.; Rojas-Espinosa, O.; Contis-Montes de Oca, A.; Hurtado-Alvarado, G.; Arce-Paredes, P.; Pérez-Sánchez, G.; Pavón, L.; Girón-Pérez, M.I.; Hernández-Pando, R.; et al. Development of Anxiolytic and Depression-like Behavior in Mice Infected with Mycobacterium lepraemurium. Neuroscience 2022, 493, 15–30. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Chavarín, M.; Prado-Prone, G.; Padilla, P.; Ramírez Santos, J.; Gutiérrez-Ospina, G.; García-Macedo, J.A. Dopamine Released from TiO2 Semicrystalline Lattice Implants Attenuates Motor Symptoms in Rats Treated with 6-Hydroxydopamine. ACS Omega 2019, 4, 7953–7962. [Google Scholar] [CrossRef] [PubMed]
- TBARS Assay Kit. Available online: https://www.abnova.com/upload/media/product/protocol_pdf/KA1381.pdf (accessed on 2 July 2024).
- Catalase Activity Assay Kit (Colorimetric/Fluorometric). Available online: www.abcam.co.jp/ab83464 (accessed on 2 July 2024).
- Superoxide Dismutase. Available online: https://www.abcam.com/ps/products/65/ab65354/documents/ab65354%20Superoxide%20Dismutase%20Activity%20assay%20v9b%20(website).pdf (accessed on 2 July 2024).
- Glutathione-Peroxidase-Assay-Kit-Ab102530-V12 (Website). Available online: https://www.abcam.com/ps/products/102/ab102530/documents/Glutathione-Peroxidase-Assay-Kit-ab102530-v12%20(website).pdf (accessed on 2 July 2024).
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bland, J.M.; Altman, D.G. Statistical Methods for Assessing Agreement between Two Methods of Clinical Measurement. Lancet 1986, 1, 307–310. [Google Scholar] [CrossRef]
- Videnovic, A.; Pfeiffer, H.C.V.; Tylki-Szymańska, A.; Berry-Kravis, E.; Ezgü, F.; Ganju, J.; Jurecka, A.; Lang, A.E. Study Design Challenges and Strategies in Clinical Trials for Rare Diseases: Lessons Learned from Pantothenate Kinase-Associated Neurodegeneration. Front. Neurol. 2023, 14, 1098454. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
CAT | TCACATCTGCAGAGCACTGG | ACTACCCCAACAGCTTCAGC |
GPX1 | GGAATGCCTTAGGGGTTGCT | GCTTTCGCACCATCGACATC |
SNCA | GACAAAACCAGTGGCAGCAG | CAGTGGTGACTGGTGTGACA |
SOD1 | ATTGGCCACACCGTCCTTTC | GTCCAGCGGATGAAGAGAGG |
TH | TCCTTCAAGAAGCGGGACAC | TTCTGGAACGGTACTGTGGC |
18S | CTCAACACGGGAAACTCA | CGCTCCACCAACTAAGAACG |
GLUT3 | CGGAGAAGATGGCCACACAT | TGGAAGAGCGGTTGGAAGAC |
GLUT4 | CAGCGAGGCAAGGCTAGATT | TAGACTCTGGGTGAAGGGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez-Camacho, J.V.; Gómez-Chavarín, M.; Galindo-Solano, N.; Padilla-Cortés, P.; Maldonado-García, J.L.; Pérez-Sánchez, G.; Pavón, L.; Ramírez-Santos, J.; Roldán Roldán, G.; Gómez-López, M.; et al. Non-Categorical Analyses Identify Rotenone-Induced ‘Parkinsonian’ Rats Benefiting from Nano-Emulsified Punicic Acid (Nano-PSO) in a Phenotypically Diverse Population: Implications for Translational Neurodegenerative Therapies. Int. J. Mol. Sci. 2024, 25, 12635. https://doi.org/10.3390/ijms252312635
Sánchez-Camacho JV, Gómez-Chavarín M, Galindo-Solano N, Padilla-Cortés P, Maldonado-García JL, Pérez-Sánchez G, Pavón L, Ramírez-Santos J, Roldán Roldán G, Gómez-López M, et al. Non-Categorical Analyses Identify Rotenone-Induced ‘Parkinsonian’ Rats Benefiting from Nano-Emulsified Punicic Acid (Nano-PSO) in a Phenotypically Diverse Population: Implications for Translational Neurodegenerative Therapies. International Journal of Molecular Sciences. 2024; 25(23):12635. https://doi.org/10.3390/ijms252312635
Chicago/Turabian StyleSánchez-Camacho, Jennifer Viridiana, Margarita Gómez-Chavarín, Nuria Galindo-Solano, Patricia Padilla-Cortés, José Luis Maldonado-García, Gilberto Pérez-Sánchez, Lenin Pavón, Jesús Ramírez-Santos, Gabriel Roldán Roldán, Modesto Gómez-López, and et al. 2024. "Non-Categorical Analyses Identify Rotenone-Induced ‘Parkinsonian’ Rats Benefiting from Nano-Emulsified Punicic Acid (Nano-PSO) in a Phenotypically Diverse Population: Implications for Translational Neurodegenerative Therapies" International Journal of Molecular Sciences 25, no. 23: 12635. https://doi.org/10.3390/ijms252312635
APA StyleSánchez-Camacho, J. V., Gómez-Chavarín, M., Galindo-Solano, N., Padilla-Cortés, P., Maldonado-García, J. L., Pérez-Sánchez, G., Pavón, L., Ramírez-Santos, J., Roldán Roldán, G., Gómez-López, M., & Gutierrez-Ospina, G. (2024). Non-Categorical Analyses Identify Rotenone-Induced ‘Parkinsonian’ Rats Benefiting from Nano-Emulsified Punicic Acid (Nano-PSO) in a Phenotypically Diverse Population: Implications for Translational Neurodegenerative Therapies. International Journal of Molecular Sciences, 25(23), 12635. https://doi.org/10.3390/ijms252312635