UNAM-HIMFG Bacterial Lysate Activates the Immune Response and Inhibits Colonization of Bladder of Balb/c Mice Infected with the Uropathogenic CFT073 Escherichia coli Strain
Abstract
1. Introduction
2. Results
2.1. Cultivable Bacterial Microbiota of Mice
2.2. Urinary Tract Infection
2.3. UNAM-HIMFG Lysate Protects Balb/c Mice against UPEC CFT073 Colonization
2.4. Immunostimulatory Effect of UNAM-HIMFG Lysate
2.5. UNAM-HIMFG Lysate Protects against Tissue Colonization
3. Discussion
4. Materials and Methods
4.1. Ethics Statement for Animal Protocols
4.2. Bacterial Strains and Culture Conditions
4.3. Laboratory Animals
4.4. Cultivable Microbiota of the Mice
4.5. Inoculum Preparation and Conditions
4.6. Urinary Tract Infection in Murine Model
4.7. Protective Effect of UNAM-HIMFG Lysate
4.8. Cytokines Detection
4.9. Effect of UNAM-HIMFG Lysate on Tissue Colonization by Bacteria
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bell, B.G.; Schellevis, F.; Stobberingh, E.; Goossens, H.; Pringle, M. A systematic review and meta-analysis of the effects of antibiotic consumption on antibiotic resistance. BMC Infect Dis. 2014, 14, 13. [Google Scholar] [CrossRef] [PubMed]
- Michael, C.A.; Dominey-Howes, D.; Labbate, M. The antimicrobial resistance crisis: Causes, consequences, and management. Front. Public Health 2014, 2, 145. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Global Action Plan on Antimicrobial Resistance; World Health Organization: Geneva, Switzerland, 2015; Available online: https://iris.who.int/handle/10665/193736 (accessed on 3 June 2024).
- World Health Organization. Bacterial Priority Pathogens List. 2024. Available online: https://www.who.int/publications/i/item/9789240093461 (accessed on 3 June 2024).
- de Kraker, M.E.A.; Stewardson, A.J.; Harbarth, S. Will 10 Million People Die a Year Due to Antimicrobial Resistance by 2050? PLoS Med. 2016, 13, e1002184. [Google Scholar] [CrossRef] [PubMed]
- Tullus, K.; Shaikh, N. Urinary tract infections in children. Lancet 2020, 395, 1659–1668. [Google Scholar] [CrossRef]
- Wagenlehner, F.M.E.; Bjerklund Johansen, T.E.; Cai, T.; Koves, B.; Kranz, J.; Pilatz, A.; Tandogdu, Z. Epidemiology, Definition and Treatment of Complicated Urinary Tract Infections. Nat. Rev. Urol. 2020, 17, 586–600. [Google Scholar] [CrossRef]
- Hernández-Chiñas, U.; Ahumada-Cota, R.E.; Navarro-Ocaña, A.; Chávez-Berrocal, M.E.; Molina-López, J.; Rocha-Ramírez, L.M.; del Prado, A.; Eslava, C.A. Phenotypic and Genotypic Characteristics of Escherichia coli Strains Isolated during a Longitudinal Follow-up Study of Chronic Urinary Tract Infections. Front. Public Health 2023, 11, 1240392. [Google Scholar] [CrossRef]
- Foxman, B. Urinary Tract Infection Syndromes: Occurrence, Recurrence, Bacteriology, Risk Factors, and Disease Burden. Infect. Dis. Clin. N. Am. 2014, 28, 1–13. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, Z.; Zheng, L.; Gong, Z.; Li, Y.; Jin, Y.; Huang, Y.; Chi, M. Urinary Tract Infections Caused by Uropathogenic Escherichia coli: Mechanisms of Infection and Treatment Options. Int. J. Mol. Sci. 2023, 24, 10537. [Google Scholar] [CrossRef]
- Regasa Dadi, B.; Abebe, T.; Zhang, L.; Mihret, A.; Abebe, W.; Amogne, W. Drug Resistance and Plasmid Profile of Uropathogenic Escherichia coli among Urinary Tract Infection Patients in Addis Abeba. J. Infect. Dev. Ctries. 2018, 12, 608–615. [Google Scholar] [CrossRef]
- Samei, A.; Haghi, F.; Zeighami, H. Distribution of Pathogenicity Island Markers in Commensal and Uropathogenic Escherichia coli Isolates. Folia Microbiol. 2016, 61, 261–268. [Google Scholar] [CrossRef]
- Rozwadowski, M.; Gawel, D. Molecular Factors and Mechanisms Driving Multidrug Resistance in Uropathogenic Escherichia coli-An Update. Genes 2022, 13, 1397. [Google Scholar] [CrossRef] [PubMed]
- Horumpende, P.G.; Said, S.H.; Mazuguni, F.S.; Antony, M.L.; Kumburu, H.H.; Sonda, T.B.; Mwanziva, C.E.; Mshana, S.E.; Mmbaga, B.T.; Kajeguka, D.C.; et al. Prevalence, determinants and knowledge of antibacterial self-medication: A cross sectional study in North-eastern Tanzania. PLoS ONE 2018, 13, e0206623. [Google Scholar] [CrossRef] [PubMed]
- Bologna, E.; Licari, L.C.; Manfredi, C.; Ditonno, F.; Cirillo, L.; Fusco, G.M.; Abate, M.; Passaro, F.; Di Mauro, E.; Crocetto, F.; et al. Carbapenem-Resistant Enterobacteriaceae in Urinary Tract Infections: From Biological Insights to Emerging Therapeutic Alternatives. Medicina 2024, 60, 214. [Google Scholar] [CrossRef] [PubMed]
- Cai, T.; Verze, P.; Arcaniolo, D.; Pandolfo, S.D.; Smarrazzo, F.; Manfredi, C.; Tascini, C.; Caciagli, P.; Lanzafame, M.; De Sio, M.; et al. Antibiotic Resistance Patterns Among Uropathogens in Female Outpatients Affected by Uncomplicated Cystitis: Focus on Fosfomycin Trometamol. Int. J. Antimicrob. Agents 2023, 62, 106974. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- World Health Organization. Prioritization of Pathogens to Guide Discovery, Research and Development of New Antibiotics for Drug-Resistant Bacterial Infections, Including Tuberculosis. 2017. Available online: https://www.who.int/publications/i/item/WHO-EMP-IAU-2017.12 (accessed on 30 May 2024).
- Servín-Blanco, R.; Zamora-Alvarado, R.; Gevorkian, G.; Manoutcharian, K. Antigenic Variability: Obstacles on the Road to Vaccines against Traditionally Difficult Targets. Hum. Vaccines Immunother. 2016, 12, 2640–2648. [Google Scholar] [CrossRef]
- Sánchez Ramón, S.; Manzanares, M.; Candelas, G. Vacunas Antiinfecciosas de Mucosas En La Profilaxis de Infecciones Recurrentes: Más Allá de Las Vacunas Convencionales. Reumatol. Clínica 2020, 16, 49–55. [Google Scholar] [CrossRef]
- Asadi Karam, M.R.; Habibi, M.; Bouzari, S. Urinary Tract Infection: Pathogenicity, Antibiotic Resistance and Development of Effective Vaccines against Uropathogenic Escherichia coli. Mol. Immunol. 2019, 108, 56–67. [Google Scholar] [CrossRef]
- Whelan, S.; Lucey, B.; Finn, K. Uropathogenic Escherichia coli (UPEC)-Associated Urinary Tract Infections: The Molecular Basis for Challenges to Effective Treatment. Microorganisms 2023, 11, 2169. [Google Scholar] [CrossRef]
- Westcott, M.M.; Morse, A.E.; Troy, G.; Blevins, M.; Wierzba, T.; Sanders, J.W. Photochemical Inactivation as an Alternative Method to Produce a Whole-Cell Vaccine for Uropathogenic Escherichia coli (UPEC). Microbiol. Spectr. 2024, 12, e03661-23. [Google Scholar] [CrossRef]
- Giedrys-Kalemba, S.; Czernomysy-Furowicz, D.; Fijałkowski, K.; Jursa-Kulesza, J. Chapter 19—Autovaccines in Individual Therapy of Staphylococcal Infections. In Pet-To-Man Travelling Staphylococci; Savini, V., Ed.; Academic Press: Cambridge, MA, USA, 2018; pp. 253–264. ISBN 978-0-12-813547-1. [Google Scholar]
- Suárez, N.; Ferrara, F.; Rial, A.; Dee, V.; Chabalgoity, J.A. Bacterial Lysates as Immunotherapies for Respiratory Infections: Methods of Preparation. Front. Bioeng. Biotechnol. 2020, 8, 545. [Google Scholar] [CrossRef] [PubMed]
- Ahumada-Cota, R.E.; Hernandez-Chiñas, U.; Milián-Suazo, F.; Chávez-berrocal, M.E.; Navarro-Ocaña, A.; Martínez-Gómez, D.; Patiño-lópez, G.; Salazar-Jiménez, E.P.; Eslava, C.A. Effect and Analysis of Bacterial Lysates for the Treatment of Recurrent Urinary Tract Infections in Adults. Pathogens 2020, 9, 102. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Chiñas, U.; Chávez-Berrocal, M.E.; Ahumada-Cota, R.E.; Navarro-Ocaña, A.; Rocha-Ramírez, L.M.; Pérez-Del Mazo, Y.; Alvarado-Cabello, M.; Pérez-Soto, G.; León-Alamilla, L.A.; Acevedo-Monroy, S.E.; et al. Prospective Study in Children with Complicated Urinary Tract Infection Treated with Autologous Bacterial Lysates. Microorganisms 2021, 9, 1811. [Google Scholar] [CrossRef] [PubMed]
- Acevedo-Monroy, S.E.; Rocha-Ramírez, L.M.; Martínez-Gómez, D.; Basurto-Alcántara, F.J.; Medina-Contreras, Ó.; Hernández-Chiñas, U.; Quiñones-Peña, M.A.; García-Sosa, D.I.; Ramírez-Lezama, J.; Rodríguez-García, J.A.; et al. Polyvalent Bacterial Lysate with Potential Use to Treatment and Control of Recurrent Urinary Tract Infections. Int. J. Mol. Sci. 2024, 25, 6157. [Google Scholar] [CrossRef] [PubMed]
- Mfoutou Mapanguy, C.C.; Adedoja, A.; Kecka, L.G.V.; Vouvoungui, J.C.; Nguimbi, E.; Velavan, T.P.; Ntoumi, F. High prevalence of antibiotic-resistant Escherichia coli in Congolese students. Int. J. Infect. Dis. 2021, 103, 119–123. [Google Scholar] [CrossRef]
- Hannan, T.J.; Mysorekar, I.U.; Hung, C.S.; Isaacson-Schmid, M.L.; Hultgren, S.J. Early severe inflammatory responses to uropathogenic E. coli predispose to chronic and recurrent urinary tract infection. PLoS Pathog. 2010, 6, e1001042. [Google Scholar] [CrossRef]
- Nardelli, C.; Aveta, A.; Pandolfo, S.D.; Tripodi, L.; Russo, F.; Imbimbo, C.; Castaldo, G.; Pastore, L. Microbiome Profiling in Bladder Cancer Patients Using the First-morning Urine Sample. Eur. Urol. Open Sci. 2023, 59, 18–26. [Google Scholar] [CrossRef]
- Barrons, R.; Tassone, D. Use of Lactobacillus Probiotics for Bacterial Genitourinary Infections in Women: A Review. Clin. Ther. 2008, 30, 453–468. [Google Scholar] [CrossRef]
- Gupta, V.; Nag, D.; Garg, P. Recurrent Urinary Tract Infections in Women: How Promising Is the Use of Probiotics? Indian J. Med. Microbiol. 2017, 35, 347–354. [Google Scholar] [CrossRef]
- Roberts, J.A.; Kaack, M.B.; Baskin, G.; Chapman, M.R.; Hunstad, D.A.; Pinkner, J.S.; Hultgren, S.J. Antibody Responses and Protection from Pyelonephritis Following Vaccination with Purified Escherichia coli PapDG Protein. J. Urol. 2004, 171, 1682–1685. [Google Scholar] [CrossRef]
- Aziminia, N.; Hadjipavlou, M.; Philippou, Y.; Pandian, S.S.; Malde, S.; Hammadeh, M.Y. Vaccines for the Prevention of Recurrent Urinary Tract Infections: A Systematic Review. BJU Int. 2019, 123, 753–768. [Google Scholar] [CrossRef] [PubMed]
- Westcott, M.M.; Blevins, M.; Wierzba, T.F.; Morse, A.E.; White, K.R.; Sanders, L.A.; Sanders, J.W. The Immunogenicity and Properties of a Whole-Cell ETEC Vaccine Inactivated with Psoralen and UVA Light in Comparison to Formalin. Microorganisms 2023, 11, 2040. [Google Scholar] [CrossRef] [PubMed]
- Carey, A.J.; Tan, C.K.; Ipe, D.S.; Sullivan, M.J.; Cripps, A.W.; Schembri, M.A.; Ulett, G.C. Urinary tract infection of mice to model human disease: Practicalities, implications and limitations. Crit. Rev. Microbiol. 2016, 42, 780–799. [Google Scholar] [CrossRef] [PubMed]
- Zychlinsky Scharff, A.; Albert, M.L.; Ingersoll, M.A. Urinary Tract Infection in a Small Animal Model: Transurethral Catheterization of Male and Female Mice. J. Vis. Exp. 2017, 130, 54432. [Google Scholar] [CrossRef]
- Vela Ramirez, J.E.; Sharpe, L.A.; Peppas, N.A. Current State and Challenges in Developing Oral Vaccines. Adv. Drug Deliv. Rev. 2017, 114, 116–131. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Hashizume, T.; Kurita-Ochiai, T.; Yamamoto, M. Sublingual Vaccination with Outer Membrane Protein of Porphyromonas Gingivalis and Flt3 Ligand Elicits Protective Immunity in the Oral Cavity. Biochem. Biophys. Res. Commun. 2009, 390, 937–941. [Google Scholar] [CrossRef]
- Trincado, V.; Gala, R.P.; Morales, J.O. Buccal and Sublingual Vaccines: A Review on Oral Mucosal Immunization and Delivery Systems. Vaccines 2021, 9, 1177. [Google Scholar] [CrossRef]
- Inagawa, H.; Kohchi, C.; Soma, G.I. Oral Administration of Lipopolysaccharides for the Prevention of Various Diseases: Benefit and Usefulness. Anticancer Res. 2011, 31, 2431–2436. [Google Scholar]
- Habibi, M.; Asadi Karam, M.R.; Shokrgozar, M.A.; Oloomi, M.; Jafari, A.; Bouzari, S. Intranasal Immunization with Fusion Protein MrpH·FimH and MPL Adjuvant Confers Protection against Urinary Tract Infections Caused by Uropathogenic Escherichia coli and Proteus mirabilis. Mol. Immunol. 2015, 64, 285–294. [Google Scholar] [CrossRef]
- McGhee, J.R.; Fujihashi, K. Inside the Mucosal Immune System. PLoS Biol. 2012, 10, e1001397. [Google Scholar] [CrossRef]
- Sedger, L.M.; McDermott, M.F. TNF and TNF-receptors: From mediators of cell death and inflammation to therapeutic giants—Past, present and future. Cytokine Growth Factor Rev. 2014, 25, 453–472. [Google Scholar] [CrossRef] [PubMed]
- Holbrook, J.; Lara-Reyna, S.; Jarosz-Griffiths, H.; McDermott, M. Tumour necrosis factor signalling in health and disease. F1000Research 2019, 8. [Google Scholar] [CrossRef] [PubMed]
- Devarapu, S.K.; Grill, J.F.; Xie, J.; Weidenbusch, M.; Honarpisheh, M.; Vielhauer, V.; Anders, H.J.; Mulay, S.R. Tumor Necrosis Factor Superfamily Ligand MRNA Expression Profiles Differ between Humans and Mice during Homeostasis and between Various Murine Kidney Injuries. J. Biomed. Sci. 2017, 24, 77. [Google Scholar] [CrossRef] [PubMed]
- Mulero, M.C.; Huxford, T.; Ghosh, G. NF-κB, IκB, and IKK: Integral Components of Immune System Signaling. Adv. Exp. Med. Biol. 2019, 1172, 207–226. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wu, X.; Jiang, M.; Tai, G. Mechanism by which TRAF6 Participates in the Immune Regulation of Autoimmune Diseases and Cancer. Biomed. Res. Int. 2020, 2020, 4607197. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-ΚB Signaling in Inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- Byrne, A.; Reen, D.J. Lipopolysaccharide Induces Rapid Production of IL-10 by Monocytes in the Presence of Apoptotic Neutrophils. J. Immunol. 2002, 168, 1968–1977. [Google Scholar] [CrossRef]
- Wybran, J.; Libin, M.; Schandene, L. Enhancement of Cytokine Production and Natural Killer Activity by an Escherichia coli Extract. Oncol. Res. Treat. 1989, 12, 22–25. [Google Scholar] [CrossRef]
- Duell, B.L.; Carey, A.J.; Tan, C.K.; Cui, X.; Webb, R.I.; Totsika, M.; Schembri, M.A.; Derrington, P.; Irving-Rodgers, H.; Brooks, A.J.; et al. Innate transcriptional networks activated in bladder in response to uropathogenic Escherichia coli drive diverse biological pathways and rapid synthesis of IL-10 for defense against bacterial urinary tract infection. J. Immunol. 2012, 188, 781–792. [Google Scholar] [CrossRef]
- Surette, F.A.; Guthmiller, J.J.; Li, L.; Sturtz, A.J.; Vijay, R.; Pope, R.L.; McClellan, B.L.; Pack, A.D.; Zander, R.A.; Shao, P.; et al. Extrafollicular CD4 T cell-derived IL-10 functions rapidly and transiently to support anti-Plasmodium humoral immunity. PLoS Pathog. 2021, 17, e1009288. [Google Scholar] [CrossRef]
- Kantor, A.F.; Hartge, P.; Hoover, R.N.; Narayana, A.S.; Sullivan, J.W.; Fraumeni, J.F., Jr. Urinary tract infection and risk of bladder cancer. Am. J. Epidemiol. 1984, 119, 510–515. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Pan, T.; Yan, L.; Jin, T.; Zhang, R.; Chen, B.; Feng, J.; Duan, T.; Xiang, Y.; Zhang, M.; et al. The inflammatory microenvironment and the urinary microbiome in the initiation and progression of bladder cancer. Genes Dis. 2020, 8, 781–797. [Google Scholar] [CrossRef] [PubMed]
- DOF. NORMA Oficial Mexicana NOM-062-ZOO-1999, Especificaciones Técnicas Para la Producción, Cuidado y Uso de los Animales de Laboratorio; DOF (Diario Oficial de la Federación): Mexico City, Mexico, 2001.
- Kurien, B.T.; Everds, N.E.; Scofield, R.H. Experimental Animal Urine Collection: A Review. Lab. Anim. 2004, 38, 333–361. [Google Scholar] [CrossRef] [PubMed]
- Barrow, G.; Feltham, R. (Eds.) Cowan and Steel’s Manual for the Identification of Medical Bacteria, 3rd ed.; Cambridge University Press: Cambridge, UK, 1993. [Google Scholar] [CrossRef]
- Wurpel, D.J.; Totsika, M.; Allsopp, L.P.; Hartley-Tassell, L.E.; Day, C.J.; Peters, K.M.; Sarkar, S.; Ulett, G.C.; Yang, J.; Tiralongo, J.; et al. F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Galb1-3GlcNAc-Containing Glycans. PLoS ONE 2014, 9, e93177. [Google Scholar] [CrossRef] [PubMed]
- Reis, L.O.; Sopena, J.M.G.; Fávaro, W.J.; Martin, M.C.; Simão, A.F.L.; dos Reis, R.B.; de Andrade, M.F.; Domenech, J.D.; Cardo, C.C. Anatomical Features of the Urethra and Urinary Bladder Catheterization in Female Mice and Rats. An Essential Translational Tool. Acta Cir. Bras. 2011, 26 (Suppl. S2), 106–110. [Google Scholar] [CrossRef]
- Banjo, M.; Iguchi, A.; Seto, K.; Kikuchi, T.; Harada, T.; Scheutz, F.; Iyoda, S. Escherichia coli H-Genotyping PCR: A Complete and Practical Platform for Molecular h Typing. J. Clin. Microbiol. 2018, 56, 1–13. [Google Scholar] [CrossRef]
- Hernández-Chiñas, U.; Pérez-Ramos, A.; Belmont-Monroy, L.; Chávez-Berrocal, M.E.; González-Villalobos, E.; Navarro-Ocaña, A.; Eslava, C.A.; Molina-López, J. Characterization of Auto-Agglutinating and Non-Typeable Uropathogenic Escherichia coli Strains. J. Infect. Dev. Ctries 2019, 13, 465–472. [Google Scholar] [CrossRef]
- Liu, M.; Zhong, Y.; Chen, J.; Liu, Y.; Tang, C.; Wang, X.; Zhang, Y.; Wang, P.; Logan, S.M.; Chen, W.; et al. Oral Immunization of Mice with a Multivalent Therapeutic Subunit Vaccine Protects against Helicobacter pylori Infection. Vaccine 2020, 38, 3031–3041. [Google Scholar] [CrossRef]
- Sreerohini, S.; Balakrishna, K.; Parida, M. Oral Immunization of Mice with Lactococcus Lactis Expressing Shiga Toxin Truncate Confers Enhanced Protection against Shiga Toxins of Escherichia coli O157:H7 and Shigella dysenteriae. Apmis 2019, 127, 671–680. [Google Scholar] [CrossRef]
- Tomar, B.; Mulay, S.R. Expression Profiling of Tumor Necrosis Factor Superfamily Ligands mRNA in Healthy and Injured Murine Kidneys. Methods Mol. Biol. 2021, 2248, 231–241. [Google Scholar]
- Gorressen, S.; Stern, M.; Van De Sandt, A.M.; Cortese-Krott, M.M.; Ohlig, J.; Rassaf, T.; Gödecke, A.; Fischer, J.W.; Heusch, G.; Merx, M.W.; et al. Circulating NOS3 Modulates Left Ventricular Remodeling Following Reperfused Myocardial Infarction. PLoS ONE 2015, 10, e0120961. [Google Scholar] [CrossRef] [PubMed]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An Improvement of the 2−ΔΔCT Method for Quantitative Real-Time Polymerase Chain Reaction Data Analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
- McInnes, E. Urinary System. In A Practical Guide to the Histology of the Mouse; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2014; pp. 75–85. ISBN 9781118789568. [Google Scholar]
- Leaver, R.E.; Evans, B.J.; Corrin, B. Identification of Gram-Negative Bacteria in Histological Sections Using Sandiford’s Counterstain. J. Clin. Pathol. 1977, 30, 290–291. [Google Scholar] [CrossRef] [PubMed]
Targeted Gene | Sequence (5′-3′) | Size (bp) | UPEC Strains | References |
---|---|---|---|---|
wzy O6 F | GGATGACGATGTGATTTTGGCTAAC | 783 | CFT073 | [63] |
wzy O6 R | TCTGGGTTTGCTGTGTATGAGGC | |||
FliC H1 F | ATGCGCTGACTGCATCAAAG | 774 | CFT073 | [62] |
FliC H1 R | CCTTGCCGTTGTTAGCATCG | |||
wzy O25 F | GTTCTGGATACCTAACGCAATACCC | 229 | RMR(U3)02 | [63] |
wzy O25 R | AGAGATCCGTCTTTTATTTGTTCGC | |||
FliC H4 F | GATTTCAGCGCGGCGAAACT | 150 | RMR(U3)02 | [62] |
FliC H4 R | GGTTGCAGAATCAACGACCG |
Gene | Primer | Sequence (5′-3′) | Size (bp) | References |
---|---|---|---|---|
gpdh, glyceraldehyde-3-phosphate dehydrogenase [Mus musculus (house mouse)] | gapdh F | TGGCAAAGTGGAGATTGTTGCC | 156 | [67] |
gapdh R | AAGATGGTGATGGGCTTCCCG | |||
Tnf-α, tumor necrosis factor [Mus musculus (house mouse)] | TNF-a g | GGTGCCTATGTCTCAGCCTCTT | 139 | [47] |
TNF-a R | GCCATAGAACTGATGAGAGGGAG | |||
IL-10 [Mus musculus (house mouse)] | IL-10 F | CGGGAAGACAATAACTGCACCC | 130 | [67] |
IL-10 R | CGGTTAGCAGTATGTTGTCCAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Acevedo-Monroy, S.E.; Hernández-Chiñas, U.; Rocha-Ramírez, L.M.; Medina-Contreras, O.; López-Díaz, O.; Ahumada-Cota, R.E.; Martínez-Gómez, D.; Huerta-Yepez, S.; Tirado-Rodríguez, A.B.; Molina-López, J.; et al. UNAM-HIMFG Bacterial Lysate Activates the Immune Response and Inhibits Colonization of Bladder of Balb/c Mice Infected with the Uropathogenic CFT073 Escherichia coli Strain. Int. J. Mol. Sci. 2024, 25, 9876. https://doi.org/10.3390/ijms25189876
Acevedo-Monroy SE, Hernández-Chiñas U, Rocha-Ramírez LM, Medina-Contreras O, López-Díaz O, Ahumada-Cota RE, Martínez-Gómez D, Huerta-Yepez S, Tirado-Rodríguez AB, Molina-López J, et al. UNAM-HIMFG Bacterial Lysate Activates the Immune Response and Inhibits Colonization of Bladder of Balb/c Mice Infected with the Uropathogenic CFT073 Escherichia coli Strain. International Journal of Molecular Sciences. 2024; 25(18):9876. https://doi.org/10.3390/ijms25189876
Chicago/Turabian StyleAcevedo-Monroy, Salvador Eduardo, Ulises Hernández-Chiñas, Luz María Rocha-Ramírez, Oscar Medina-Contreras, Osvaldo López-Díaz, Ricardo Ernesto Ahumada-Cota, Daniel Martínez-Gómez, Sara Huerta-Yepez, Ana Belén Tirado-Rodríguez, José Molina-López, and et al. 2024. "UNAM-HIMFG Bacterial Lysate Activates the Immune Response and Inhibits Colonization of Bladder of Balb/c Mice Infected with the Uropathogenic CFT073 Escherichia coli Strain" International Journal of Molecular Sciences 25, no. 18: 9876. https://doi.org/10.3390/ijms25189876
APA StyleAcevedo-Monroy, S. E., Hernández-Chiñas, U., Rocha-Ramírez, L. M., Medina-Contreras, O., López-Díaz, O., Ahumada-Cota, R. E., Martínez-Gómez, D., Huerta-Yepez, S., Tirado-Rodríguez, A. B., Molina-López, J., Castro-Luna, R., Martínez-Cristóbal, L., Rojas-Castro, F. E., Chávez-Berrocal, M. E., Verdugo-Rodríguez, A., & Eslava-Campos, C. A. (2024). UNAM-HIMFG Bacterial Lysate Activates the Immune Response and Inhibits Colonization of Bladder of Balb/c Mice Infected with the Uropathogenic CFT073 Escherichia coli Strain. International Journal of Molecular Sciences, 25(18), 9876. https://doi.org/10.3390/ijms25189876