The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy
Abstract
1. Introduction
2. Results
2.1. Expression of NRF2 in HNSCC
2.2. ML385 Inhibits the Viability of HNSCC Cells
2.3. ML385 Reduces Oncogenic Properties in HNSCC
2.4. ML385 Induces G1/S Phase Arrest in HNSCC
3. Discussion
4. Materials and Methods
4.1. Gene Expression Profiling Interactive Analysis (GEPIA)
4.2. Cell Culture
4.3. Analysis of Cell Viability, Proliferation Rate, Migration, Colonogenicity, and Wound Healing
4.4. Small Interfering RNA (siRNA) Transfection
4.5. Total RNA Extraction and Quantitative Reverse Transcription-PCR (qRT-PCR)
4.6. Western Blotting
4.7. Apoptosis Assay
4.8. Cell Cycle Assay
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jemal, A.; Siegel, R.; Ward, E.; Hao, Y.; Xu, J.; Thun, M.J. Cancer statistics, 2009. CA Cancer J. Clin. 2009, 59, 225–249. [Google Scholar] [CrossRef] [PubMed]
- Warnakulasuriya, S. Global epidemiology of oral and oropharyngeal cancer. Oral Oncol. 2009, 45, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Parkin, D.M.; Bray, F.; Ferlay, J.; Pisani, P. Global cancer statistics, 2002. CA Cancer J. Clin. 2005, 55, 74–108. [Google Scholar] [CrossRef] [PubMed]
- Ajila, V.; Shetty, H.; Babu, S.; Shetty, V.; Hegde, S. Human Papilloma Virus Associated Squamous Cell Carcinoma of the Head and Neck. J. Sex. Transm. Dis. 2015, 2015, 791024. [Google Scholar] [CrossRef] [PubMed]
- Cognetti, D.M.; Weber, R.S.; Lai, S.Y. Head and neck cancer: An evolving treatment paradigm. Cancer 2008, 113, 1911–1932. [Google Scholar] [CrossRef]
- Wakabayashi, N.; Itoh, K.; Wakabayashi, J.; Motohashi, H.; Noda, S.; Takahashi, S.; Imakado, S.; Kotsuji, T.; Otsuka, F.; Roop, D.R.; et al. Keap1-null mutation leads to postnatal lethality due to constitutive Nrf2 activation. Nat. Genet. 2003, 35, 238–245. [Google Scholar] [CrossRef] [PubMed]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, J.; Duan, H.; Li, R.; Peng, W.; Wu, C. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J. Adv. Res. 2021, 34, 43–63. [Google Scholar] [CrossRef]
- Hartikainen, J.M.; Tengstrom, M.; Kosma, V.M.; Kinnula, V.L.; Mannermaa, A.; Soini, Y. Genetic polymorphisms and protein expression of NRF2 and Sulfiredoxin predict survival outcomes in breast cancer. Cancer Res. 2012, 72, 5537–5546. [Google Scholar] [CrossRef]
- Shanmugam, M.K.; Nguyen, A.H.; Kumar, A.P.; Tan, B.K.; Sethi, G. Targeted inhibition of tumor proliferation, survival, and metastasis by pentacyclic triterpenoids: Potential role in prevention and therapy of cancer. Cancer Lett. 2012, 320, 158–170. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef] [PubMed]
- Panieri, E.; Saso, L. Potential Applications of NRF2 Inhibitors in Cancer Therapy. Oxid. Med. Cell Longev. 2019, 2019, 8592348. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Venkannagari, S.; Oh, K.H.; Zhang, Y.Q.; Rohde, J.M.; Liu, L.; Nimmagadda, S.; Sudini, K.; Brimacombe, K.R.; Gajghate, S.; et al. Small Molecule Inhibitor of NRF2 Selectively Intervenes Therapeutic Resistance in KEAP1-Deficient NSCLC Tumors. ACS Chem. Biol. 2016, 11, 3214–3225. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.F.; Zhang, L.; Ma, S.R.; Zhao, Z.L.; Wang, W.M.; He, K.F.; Zhao, Y.F.; Zhang, W.F.; Liu, B.; Sun, Z.J. Clinical significance of Keap1 and Nrf2 in oral squamous cell carcinoma. PLoS ONE 2013, 8, e83479. [Google Scholar] [CrossRef] [PubMed]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef] [PubMed]
- Kool, R.; Dragomir, A.; Kulkarni, G.S.; Marcq, G.; Breau, R.H.; Kim, M.; Busca, I.; Abdi, H.; Dawidek, M.; Uy, M.; et al. Benefit of Neoadjuvant Cisplatin-Based Chemotherapy for Invasive Bladder Cancer Patients Treated with Radiation-Based Therapy in a Real-World Setting: An Inverse Probability Treatment Weighted Analysis. Eur. Urol. Oncol. 2024; in press. [Google Scholar] [CrossRef]
- Maeda, O.; Furune, S.; Kanda, M.; Miyata, K.; Shimizu, D.; Sugita, S.; Nishida, K.; Ando, M.; Kodera, Y.; Ando, Y. Docetaxel, cisplatin, and fluorouracil with pegfilgrastim on day 3 as neoadjuvant chemotherapy for esophageal cancer. Cancer Med. 2024, 13, e6974. [Google Scholar] [CrossRef]
- Tchounwou, P.B.; Dasari, S.; Noubissi, F.K.; Ray, P.; Kumar, S. Advances in Our Understanding of the Molecular Mechanisms of Action of Cisplatin in Cancer Therapy. J. Exp. Pharmacol. 2021, 13, 303–328. [Google Scholar] [CrossRef] [PubMed]
- Hotter, G.; Rosello-Catafau, J.; Closa, D.; Bioque, G.; Gelpi, E.; Javerbaum, A.; Gonzalez, E.; Gimeno, M.A. Liquid chromatography and radioimmunoassay method for the determination of prostaglandins E1 and E2 in rat embryo incubates. J. Chromatogr. 1993, 655, 85–88. [Google Scholar] [CrossRef] [PubMed]
- Long, J.; Wang, W.; Chu, J.; Li, Y.; Wang, M.; Su, J.; Yang, Y.; Wang, G.; Li, Q.; Cheng, H. Overexpression of Nrf2 reverses ferroptosis induced by Arenobufagin in gastric cancer. Toxicol. Appl. Pharmacol. 2024, 484, 116842. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.M.; Hossain, M.M.; Islam, S.; Ahmed, R.; Majumder, M.; Dey, S.; Kawser, M.; Sarkar, B.; Himu, M.E.R.; Chowdhury, A.A.; et al. CTC together with Shh and Nrf2 are prospective diagnostic markers for HNSCC. BMC Mol. Cell Biol. 2024, 25, 4. [Google Scholar] [CrossRef]
- Roh, J.L.; Kim, E.H.; Jang, H.; Shin, D. Nrf2 inhibition reverses the resistance of cisplatin-resistant head and neck cancer cells to artesunate-induced ferroptosis. Redox Biol. 2017, 11, 254–262. [Google Scholar] [CrossRef] [PubMed]
- Tuerhong, A.; Xu, J.; Wang, W.; Shi, S.; Meng, Q.; Hua, J.; Liu, J.; Zhang, B.; Yu, X.; Liang, C. CPT1B maintains redox homeostasis and inhibits ferroptosis to induce gemcitabine resistance via the KEAP1/NRF2 axis in pancreatic cancer. Surgery 2024, 175, 1264–1275. [Google Scholar] [CrossRef] [PubMed]
- Moon, E.J.; Giaccia, A. Dual roles of NRF2 in tumor prevention and progression: Possible implications in cancer treatment. Free Radic. Biol. Med. 2015, 79, 292–299. [Google Scholar] [CrossRef] [PubMed]
- Namani, A.; Li, Y.; Wang, X.J.; Tang, X. Modulation of NRF2 signaling pathway by nuclear receptors: Implications for cancer. Biochim. Biophys. Acta 2014, 1843, 1875–1885. [Google Scholar] [CrossRef]
- Kansanen, E.; Kuosmanen, S.M.; Leinonen, H.; Levonen, A.L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013, 1, 45–49. [Google Scholar] [CrossRef] [PubMed]
- Sova, M.; Saso, L. Design and development of Nrf2 modulators for cancer chemoprevention and therapy: A review. Drug Des. Devel Ther. 2018, 12, 3181–3197. [Google Scholar] [CrossRef]
- Taguchi, K.; Motohashi, H.; Yamamoto, M. Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes. Cells 2011, 16, 123–140. [Google Scholar] [CrossRef]
- Adinolfi, S.; Patinen, T.; Jawahar Deen, A.; Pitkanen, S.; Harkonen, J.; Kansanen, E.; Kublbeck, J.; Levonen, A.L. The KEAP1-NRF2 pathway: Targets for therapy and role in cancer. Redox Biol. 2023, 63, 102726. [Google Scholar] [CrossRef]
- Dinkova-Kostova, A.T.; Abramov, A.Y. The emerging role of Nrf2 in mitochondrial function. Free Radic. Biol. Med. 2015, 88, 179–188. [Google Scholar] [CrossRef]
- Wang, H.; Liu, C.; Zhao, Y.; Zhang, W.; Xu, K.; Li, D.; Zhou, Y.; Li, H.; Xiao, G.; Lu, B.; et al. Inhibition of LONP1 protects against erastin-induced ferroptosis in Pancreatic ductal adenocarcinoma PANC1 cells. Biochem. Biophys. Res. Commun. 2020, 522, 1063–1068. [Google Scholar] [CrossRef]
- Paredes-Gonzalez, X.; Fuentes, F.; Su, Z.Y.; Kong, A.N. Apigenin reactivates Nrf2 anti-oxidative stress signaling in mouse skin epidermal JB6 P + cells through epigenetics modifications. AAPS J. 2014, 16, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Xian, P.; Hei, Y.; Wang, R.; Wang, T.; Yang, J.; Li, J.; Di, Z.; Liu, Z.; Baskys, A.; Liu, W.; et al. Mesenchymal stem cell-derived exosomes as a nanotherapeutic agent for amelioration of inflammation-induced astrocyte alterations in mice. Theranostics 2019, 9, 5956–5975. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.; Yang, Y.; Chen, Z.; Wang, J.; Wang, X.; Zheng, Y.; Wang, C.; Wang, Y.; Zhu, Z.; Ding, X.; et al. TNFAIP2 confers cisplatin resistance in head and neck squamous cell carcinoma via KEAP1/NRF2 signaling. J. Exp. Clin. Cancer Res. 2023, 42, 190. [Google Scholar] [CrossRef] [PubMed]
- Lv, X.; Song, D.M.; Niu, Y.H.; Wang, B.S. Inhibition of heme oxygenase-1 enhances the chemosensitivity of laryngeal squamous cell cancer Hep-2 cells to cisplatin. Apoptosis 2016, 21, 489–501. [Google Scholar] [CrossRef] [PubMed]
Gene | Sense | Anti-Sense |
---|---|---|
siNRF2 (siNFE2L2) | GAGACUACCAUGGUUCCAA | UUGGAACCAUGGUAGUCUC |
Gene | Sense | Antisence |
---|---|---|
NRF2 | TCAGCGACGGAAAGAGTATGA | CCACTGGTTTCTGACTGGATGT |
KEAP1 | CTGGAGGATCATACCAAGCAGG | GGATACCCTCAATGGACACCAC |
HO-1 | AAGACTGCGTTCCTGCTCAAC | AAAGCCCTACAGCAACTGTCG |
GAPDH | CTCTGCTCCTCCTGTTCGAC | TTAAAAGCAGCCCTGGTGAC |
β-ACTIN | TCCTCTCCCAAGTCCACACAGG | GGGCACGAAGGCTCATCATTC |
Antibody | Company | Catalogue No. |
---|---|---|
Anti-Phosphor-NRF2 | Abcam | ab76026 |
Anti-NRF2 | Abcam | Ab62352 |
Anti-Cleaved CASPASE-3 | Cell signalling | 9661S |
Anti-PARP | Cell signalling | 9542S |
Anti-KEAP1 | Santacruz | SC365626 |
Anti-HO-1 | Cell signalling | 43966S |
Cell cycle (pCdk/Phh3/actin) | Abcam | ab136810 |
β-ACTIN | Cell signalling | 4967 |
GAPDH | Cell signalling | 5174 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, E.-J.; Choi, J.J.; Lee, S.Y.; Kim, Y.S. The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy. Int. J. Mol. Sci. 2024, 25, 7011. https://doi.org/10.3390/ijms25137011
Jeong E-J, Choi JJ, Lee SY, Kim YS. The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy. International Journal of Molecular Sciences. 2024; 25(13):7011. https://doi.org/10.3390/ijms25137011
Chicago/Turabian StyleJeong, Eun-Jeong, Jong Joong Choi, Sun Young Lee, and Yeon Soo Kim. 2024. "The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy" International Journal of Molecular Sciences 25, no. 13: 7011. https://doi.org/10.3390/ijms25137011
APA StyleJeong, E.-J., Choi, J. J., Lee, S. Y., & Kim, Y. S. (2024). The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy. International Journal of Molecular Sciences, 25(13), 7011. https://doi.org/10.3390/ijms25137011