Identification and Validation of Tumor Microenvironment-Associated Signature in Clear-Cell Renal Cell Carcinoma through Integration of DNA Methylation and Gene Expression
Abstract
1. Introduction
2. Results
2.1. The Technical Roadmap of This Study
2.2. Identifying TME-Related Genes in ccRCC
2.3. Identification of Candidate MDGs in ccRCC
2.4. Construction and Validation of the Prognostic Prediction Signature
2.5. The Protein Expression, Cellular Localization, and Subcellular Localization of the 4 TME-MDGs
2.6. Analysis of Immune Cell Infiltration
2.7. Prediction of Immunotherapy, Chemotherapy, and Targeted Therapy
2.8. The Drug Sensitivity and Molecular Docking Analysis of Four TME-MDGs
2.9. Mutational Landscape in ccRCC
2.10. Gene Alteration Analysis
2.11. Risk Scores Combined with Clinical Features
2.12. Stratified Survival Analysis
2.13. External Datasets and qRT-PCR Validation
3. Discussion
4. Materials and Methods
4.1. Clinical Sample Collection
4.2. Data Collection
4.3. Analysis of TME Based on ESTIMATE Algorithm
4.4. Differential Expression and DNA Methylation Analysis
4.5. Construction and Validation of Prognostic Signature Associated with Methylation Driven TME
4.6. Infiltration of Immune Cells in ccRCC
4.7. Mutation Analysis
4.8. Drug Sensitivity and Immune Therapy Analysis
4.9. Molecular Docking
4.10. Genomic Alterations and CNV Analysis
4.11. Protein Expression and Pathway Alteration Analysis
4.12. RNA Extraction and qRT-PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Nickerson, M.L.; Jaeger, E.; Shi, Y.; Durocher, J.A.; Mahurkar, S.; Zaridze, D.; Matveev, V.; Janout, V.; Kollarova, H.; Bencko, V.; et al. Improved identification of von Hippel-Lindau gene alterations in clear cell renal tumors. Clin. Cancer Res. 2008, 14, 4726–4734. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, J.J.; Purdue, M.P.; Signoretti, S.; Swanton, C.; Albiges, L.; Schmidinger, M.; Heng, D.Y.; Larkin, J.; Ficarra, V. Renal cell carcinoma. Nat. Rev. Dis. Primers 2017, 3, 17009. [Google Scholar] [CrossRef]
- Rini, B.I.; Campbell, S.C.; Escudier, B. Renal cell carcinoma. Lancet 2009, 373, 1119–1132. [Google Scholar] [CrossRef]
- Mahoney, K.M.; Rennert, P.D.; Freeman, G.J. Combination cancer immunotherapy and new immunomodulatory targets. Nat. Rev. Drug Discov. 2015, 14, 561–584. [Google Scholar] [CrossRef] [PubMed]
- Pardoll, D.M. The blockade of immune checkpoints in cancer immunotherapy. Nat. Rev. Cancer 2012, 12, 252–264. [Google Scholar] [CrossRef] [PubMed]
- Klemm, F.; Joyce, J.A. Microenvironmental regulation of therapeutic response in cancer. Trends Cell Biol. 2015, 25, 198–213. [Google Scholar] [CrossRef] [PubMed]
- Pickup, M.W.; Mouw, J.K.; Weaver, V.M. The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 2014, 15, 1243–1253. [Google Scholar] [CrossRef] [PubMed]
- Fridman, W.H.; Pagès, F.; Sautès-Fridman, C.; Galon, J. The immune contexture in human tumours: Impact on clinical outcome. Nat. Rev. Cancer 2012, 12, 298–306. [Google Scholar] [CrossRef]
- Solito, S.; Bronte, V.; Mandruzzato, S. Antigen specificity of immune suppression by myeloid-derived suppressor cells. J. Leukoc. Biol. 2011, 90, 31–36. [Google Scholar] [CrossRef] [PubMed]
- Oft, M. IL-10: Master switch from tumor-promoting inflammation to antitumor immunity. Cancer Immunol. Res. 2014, 2, 194–199. [Google Scholar] [CrossRef] [PubMed]
- Topalian, S.L.; Drake, C.G.; Pardoll, D.M. Immune checkpoint blockade: A common denominator approach to cancer therapy. Cancer Cell 2015, 27, 450–461. [Google Scholar] [CrossRef] [PubMed]
- Itahashi, K.; Irie, T.; Nishikawa, H. Regulatory T-cell development in the tumor microenvironment. Eur. J. Immunol. 2022, 52, 1216–1227. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Pang, Y.; Moses, H.L. TGF-beta and immune cells: An important regulatory axis in the tumor microenvironment and progression. Trends Immunol. 2010, 31, 220–227. [Google Scholar] [CrossRef] [PubMed]
- Dawson, M.A.; Kouzarides, T. Cancer Epigenetics: From Mechanism to Therapy. Cell 2012, 150, 12–27. [Google Scholar] [CrossRef] [PubMed]
- Moore, L.D.; Le, T.; Fan, G. DNA methylation and its basic function. Neuropsychopharmacology 2013, 38, 23–38. [Google Scholar] [CrossRef] [PubMed]
- Esteller, M. CpG island hypermethylation and tumor suppressor genes: A booming present, a brighter future. Oncogene 2002, 21, 5427–5440. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Kelly, T.K.; Jones, P.A. Epigenetics in cancer. Carcinogenesis 2010, 31, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Scharer, C.D.; Barwick, B.G.; Youngblood, B.A.; Ahmed, R.; Boss, J.M. Global DNA methylation remodeling accompanies CD8 T cell effector function. J. Immunol. 2013, 191, 3419–3429. [Google Scholar] [CrossRef] [PubMed]
- Dutta, A.; Venkataganesh, H.; Love, P.E. New Insights into Epigenetic Regulation of T Cell Differentiation. Cells 2021, 10, 3459. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, J.J.; Le, V.H.; Oyama, T.; Ricketts, C.J.; Ho, T.H.; Cheng, E.H. Chromosome 3p Loss-Orchestrated VHL, HIF, and Epigenetic Deregulation in Clear Cell Renal Cell Carcinoma. J. Clin. Oncol. 2018, 36, O2018792549. [Google Scholar] [CrossRef]
- Hakimi, A.A.; Chen, Y.B.; Wren, J.; Gonen, M.; Abdel-Wahab, O.; Heguy, A.; Liu, H.; Takeda, S.; Tickoo, S.K.; Reuter, V.E.; et al. Clinical and pathologic impact of select chromatin-modulating tumor suppressors in clear cell renal cell carcinoma. Eur. Urol. 2013, 63, 848–854. [Google Scholar] [CrossRef] [PubMed]
- Golijanin, B.; Malshy, K.; Khaleel, S.; Lagos, G.; Amin, A.; Cheng, L.; Golijanin, D.; Mega, A. Evolution of the HIF targeted therapy in clear cell renal cell carcinoma. Cancer Treat. Rev. 2023, 121, 102645. [Google Scholar] [CrossRef] [PubMed]
- Gossage, L.; Eisen, T.; Maher, E.R. VHL, the story of a tumour suppressor gene. Nat. Rev. Cancer 2015, 15, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Zhou, L.; Zhang, Z.; Xiao, X.; Qin, Y.; Zhou, X.; Huang, T. The components of tumor microenvironment as biomarker for immunotherapy in metastatic renal cell carcinoma. Front. Immunol. 2023, 14, 1146738. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.W.; Fujiwara, K.; Che, X.; Zheng, S.; Zheng, L. DNA methylation in the tumor microenvironment. J. Zhejiang Univ. Sci. B 2017, 18, 365–372. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Xu, J.; Wang, W.; Zhang, B.; Yu, X.; Shi, S. Epigenetic regulation in the tumor microenvironment: Molecular mechanisms and therapeutic targets. Signal Transduct. Target. Ther. 2023, 8, 210. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Guo, X.; Bray, M.J.; Ding, Z.; Zhao, Z. An integrative genomics approach for identifying novel functional consequences of PBRM1 truncated mutations in clear cell renal cell carcinoma (ccRCC). BMC Genom. 2016, 17, 227–237. [Google Scholar] [CrossRef] [PubMed]
- Surcel, A.; Schiffhauer, E.S.; Thomas, D.G.; Zhu, Q.; Dinapoli, K.T.; Herbig, M.; Otto, O.; West-Foyle, H.; Jacobi, A.; Kräter, M.; et al. Targeting Mechanoresponsive Proteins in Pancreatic Cancer: 4-Hydroxyacetophenone Blocks Dissemination and Invasion by Activating MYH14. Cancer Res. 2019, 79, 4665–4678. [Google Scholar] [CrossRef] [PubMed]
- Otterpohl, K.L.; Hart, R.G.; Evans, C.; Surendran, K.; Chandrasekar, I. Nonmuscle myosin 2 proteins encoded by Myh9, Myh10, and Myh14 are uniquely distributed in the tubular segments of murine kidney. Physiol. Rep. 2017, 5, e13513. [Google Scholar] [CrossRef]
- Zamora-Fuentes, J.M.; Hernández-Lemus, E.; Espinal-Enríquez, J. Gene Expression and Co-expression Networks Are Strongly Altered through Stages in Clear Cell Renal Carcinoma. Front. Genet. 2020, 11, 578679. [Google Scholar] [CrossRef] [PubMed]
- Einecke, G.; Kayser, D.; Vanslambrouck, J.M.; Sis, B.; Sis, B.; Reeve, J.; Mengel, M.; Famulski, K.S.; Bailey, C.G.; Rasko, J.E.J.; et al. Loss of Solute Carriers in T Cell-Mediated Rejection in Mouse and Human Kidneys: An Active Epithelial Injury–Repair Response. Am. J. Transplant. 2010, 10, 2241–2251. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Li, Y.S.; Wang, Q.X.; Huang, K.; Wei, J.W.; Wang, Y.F.; Zhou, J.H.; Yi, K.K.; Zhang, K.L.; Zhou, B.C.; et al. EGFR/EGFRvIII remodels the cytoskeleton via epigenetic silencing of AJAP1 in glioma cells. Cancer Lett. 2017, 403, 119–127. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, H.; Kanda, M.; Koike, M.; Iwata, N.; Shimizu, D.; Ezaka, K.; Sueoka, S.; Tanaka, Y.; Takami, H.; Hashimoto, R.; et al. Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus. Int. J. Oncol. 2015, 47, 1811–1818. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Qu, W.; Wen, X.; Su, K.; Gou, W. MiR-552 promotes the proliferation, migration and EMT of hepatocellular carcinoma cells by inhibiting AJAP1 expression. J. Cell Mol. Med. 2019, 23, 1541–1552. [Google Scholar] [CrossRef] [PubMed]
- Lasorsa, F.; Rutigliano, M.; Milella, M.; Ferro, M.; Pandolfo, S.D.; Crocetto, F.; Autorino, R.; Battaglia, M.; Ditonno, P.; Lucarelli, G. Cancer Stem Cells in Renal Cell Carcinoma: Origins and Biomarkers. Int. J. Mol. Sci. 2023, 24, 13179. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Gao, L.; Hao, H.; Yu, L. Identification of a novel gene signature for the prognosis of sepsis. Comput. Biol. Med. 2023, 159, 106958. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.; Wu, H.; Wu, J.; Liu, M.; Zhang, W.; Hu, Y.; Zhang, X.; Xu, J.; Li, L.; Yu, P.; et al. Constructing a novel mitochondrial-related gene signature for evaluating the tumor immune microenvironment and predicting survival in stomach adenocarcinoma. J. Transl. Med. 2023, 21, 191. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Zhong, Y.; Sun, Y.; Xie, C.; Yu, T. Construction of an immune-related prognostic model by exploring the tumor microenvironment of clear cell renal cell carcinoma. Anal. Biochem. 2022, 643, 114567. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Xie, Y.; Zheng, Y.; Wang, C.; Qi, F.; Hu, J.; Xu, Y. Comprehensive insights on pivotal prognostic signature involved in clear cell renal cell carcinoma microenvironment using the ESTIMATE algorithm. Cancer Med. 2020, 9, 4310–4323. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Chen, W.; Jin, J.; Wang, X.; Cao, Y.; He, Y. Data Mining of Prognostic Microenvironment-Related Genes in Clear Cell Renal Cell Carcinoma: A Study with TCGA Database. Dis. Markers 2019, 2019, 8901649. [Google Scholar] [CrossRef] [PubMed]
- Wan, B.; Liu, B.; Huang, Y.; Lv, C. Identification of genes of prognostic value in the ccRCC microenvironment from TCGA database. Mol. Genet. Genom. Med. 2020, 8, e1159. [Google Scholar] [CrossRef]
- Farhood, B.; Najafi, M.; Mortezaee, K. CD8+ cytotoxic T lymphocytes in cancer immunotherapy: A review. J. Cell Physiol. 2019, 234, 8509–8521. [Google Scholar] [CrossRef] [PubMed]
- Raskov, H.; Orhan, A.; Christensen, J.P.; Gögenur, I. Cytotoxic CD8+ T cells in cancer and cancer immunotherapy. Br. J. Cancer 2021, 124, 359–367. [Google Scholar] [CrossRef] [PubMed]
- Shimasaki, N.; Jain, A.; Campana, D. NK cells for cancer immunotherapy. Nat. Rev. Drug Discov. 2020, 19, 200–218. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Shi, H.; Zhang, B.; Ou, X.; Ma, Q.; Chen, Y.; Shu, P.; Li, D.; Wang, Y. Myeloid-derived suppressor cells as immunosuppressive regulators and therapeutic targets in cancer. Signal Transduct. Target. Ther. 2021, 6, 362. [Google Scholar] [CrossRef] [PubMed]
- Togashi, Y.; Shitara, K.; Nishikawa, H. Regulatory T cells in cancer immunosuppression—Implications for anticancer therapy. Nat. Rev. Clin. Oncol. 2019, 16, 356–371. [Google Scholar] [CrossRef]
- Tanaka, A.; Sakaguchi, S. Regulatory T cells in cancer immunotherapy. Cell Res. 2017, 27, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Chan, T.A.; Yarchoan, M.; Jaffee, E.; Swanton, C.; Quezada, S.A.; Stenzinger, A.; Peters, S. Development of tumor mutation burden as an immunotherapy biomarker: Utility for the oncology clinic. Ann. Oncol. 2019, 30, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Jardim, D.L.; Goodman, A.; de Melo, G.D.; Kurzrock, R. The Challenges of Tumor Mutational Burden as an Immunotherapy Biomarker. Cancer Cell 2021, 39, 154–173. [Google Scholar] [CrossRef] [PubMed]
- Galleggiante, V.; Rutigliano, M.; Sallustio, F.; Ribatti, D.; Ditonno, P.; Bettocchi, C.; Selvaggi, F.P.; Lucarelli, G.; Battaglia, M. CTR2 Identifies a Population of Cancer Cells with Stem Cell-like Features in Patients with Clear Cell Renal Cell Carcinoma. J. Urol. 2014, 192, 1831–1841. [Google Scholar] [CrossRef]
- Contarelli, S.; Fedele, V.; Melisi, D. HOX Genes Family and Cancer: A Novel Role for Homeobox B9 in the Resistance to Anti-Angiogenic Therapies. Cancers 2020, 12, 3299. [Google Scholar] [CrossRef] [PubMed]
- Milella, M.; Rutigliano, M.; Lasorsa, F.; Ferro, M.; Bianchi, R.; Fallara, G.; Crocetto, F.; Pandolfo, S.; Barone, B.; D Amati, A.; et al. The Role of MUC1 in Renal Cell Carcinoma. Biomolecules 2024, 14, 315. [Google Scholar] [CrossRef] [PubMed]
- Newman, A.M.; Liu, C.L.; Green, M.R.; Gentles, A.J.; Feng, W.; Xu, Y.; Hoang, C.D.; Diehn, M.; Alizadeh, A.A. Robust enumeration of cell subsets from tissue expression profiles. Nat. Methods 2015, 12, 453–457. [Google Scholar] [CrossRef] [PubMed]
- Maeser, D.; Gruener, R.F.; Huang, R.S. oncoPredict: An R package for predicting in vivo or cancer patient drug response and biomarkers from cell line screening data. Brief. Bioinform. 2021, 22, bbab260. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | Drug | Predictive Binding Energy (Kcal/mol) |
---|---|---|
AJAP1 | pazopanib | −5.74 |
MYH14 | pazopanib | −6.90 |
SLC6A19 | pazopanib | −7.36 |
HOXB9 | pazopanib | −5.03 |
Gene | Forward Primers (5′−3′) | Reverse Primers (5′−3′) |
---|---|---|
AJAP1 | CACGGCCTATAACGAGACCC | 5′-TTCTCAGACACGAAGGCCAC |
MYH14 | GATTCAGCCACGAGGAAATCA’ | 5′-CGGTGTTCCGTTCTCTCTTCAA |
SLC6A19 | CATGGTGGGACTGTATTACAACA | CTCGTCCACATACCCTGTCTG |
HOXB9 | TCCAGCGTCTGGTATTTGGT | GAAGCGAGGACAAAGAGAGG’ |
GAPDH | GGTGTGAACCATGAGAAGTATGA | GAGTCCTTCCACGATACCAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, Z.; Xu, J.; Zhang, X.; Zhang, Y.; Ivanova, D.; Lu, W.; Zhang, J.; Li, F.; Chen, X.; Wang, Y.; et al. Identification and Validation of Tumor Microenvironment-Associated Signature in Clear-Cell Renal Cell Carcinoma through Integration of DNA Methylation and Gene Expression. Int. J. Mol. Sci. 2024, 25, 6792. https://doi.org/10.3390/ijms25126792
Ye Z, Xu J, Zhang X, Zhang Y, Ivanova D, Lu W, Zhang J, Li F, Chen X, Wang Y, et al. Identification and Validation of Tumor Microenvironment-Associated Signature in Clear-Cell Renal Cell Carcinoma through Integration of DNA Methylation and Gene Expression. International Journal of Molecular Sciences. 2024; 25(12):6792. https://doi.org/10.3390/ijms25126792
Chicago/Turabian StyleYe, Zijian, Jialiang Xu, Xin Zhang, Yifan Zhang, Deyana Ivanova, Weiyu Lu, Jianning Zhang, Fangfang Li, Xuemei Chen, Yingxiong Wang, and et al. 2024. "Identification and Validation of Tumor Microenvironment-Associated Signature in Clear-Cell Renal Cell Carcinoma through Integration of DNA Methylation and Gene Expression" International Journal of Molecular Sciences 25, no. 12: 6792. https://doi.org/10.3390/ijms25126792
APA StyleYe, Z., Xu, J., Zhang, X., Zhang, Y., Ivanova, D., Lu, W., Zhang, J., Li, F., Chen, X., Wang, Y., Wang, M., & Xie, B. (2024). Identification and Validation of Tumor Microenvironment-Associated Signature in Clear-Cell Renal Cell Carcinoma through Integration of DNA Methylation and Gene Expression. International Journal of Molecular Sciences, 25(12), 6792. https://doi.org/10.3390/ijms25126792