Next Article in Journal
Wound-Microenvironment Engineering through Advanced-Dressing Bioprinting
Previous Article in Journal
Garvicin KS, a Broad-Spectrum Bacteriocin Protects Zebrafish Larvae against Lactococcus garvieae Infection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stress Reactivity, Susceptibility to Hypertension, and Differential Expression of Genes in Hypertensive Compared to Normotensive Patients

1
Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk, Russia
2
Institute of Medical Genetics, Tomsk National Research Medical Center, 634009 Tomsk, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(5), 2835; https://doi.org/10.3390/ijms23052835
Submission received: 30 December 2021 / Revised: 14 February 2022 / Accepted: 28 February 2022 / Published: 4 March 2022

Abstract

Although half of hypertensive patients have hypertensive parents, known hypertension-related human loci identified by genome-wide analysis explain only 3% of hypertension heredity. Therefore, mainstream transcriptome profiling of hypertensive subjects addresses differentially expressed genes (DEGs) specific to gender, age, and comorbidities in accordance with predictive preventive personalized participatory medicine treating patients according to their symptoms, individual lifestyle, and genetic background. Within this mainstream paradigm, here, we determined whether, among the known hypertension-related DEGs that we could find, there is any genome-wide hypertension theranostic molecular marker applicable to everyone, everywhere, anytime. Therefore, we sequenced the hippocampal transcriptome of tame and aggressive rats, corresponding to low and high stress reactivity, an increase of which raises hypertensive risk; we identified stress-reactivity-related rat DEGs and compared them with their known homologous hypertension-related animal DEGs. This yielded significant correlations between stress reactivity-related and hypertension-related fold changes (log2 values) of these DEG homologs. We found principal components, PC1 and PC2, corresponding to a half-difference and half-sum of these log2 values. Using the DEGs of hypertensive versus normotensive patients (as the control), we verified the correlations and principal components. This analysis highlighted downregulation of β-protocadherins and hemoglobin as whole-genome hypertension theranostic molecular markers associated with a wide vascular inner diameter and low blood viscosity, respectively.

1. Introduction

Hypertension is a fatal yet preventable risk factor of ischemic heart disease [1], the top cause of death worldwide [2]. Besides essential hypertension, there are many cases of hypertension that are not clinically classified as essential. In all these cases, there is an increase in intravascular pressure (only local sometimes) together with vascular shear stress, oxidative stress, inflammatory reactions, and remodeling of the vascular wall. These pathogenic mechanisms common to all hypertensive conditions share, at least in part, a molecular basis that we are trying to pinpoint here.
Although the hypertensive risk increases with age [3,4], the age of the first clinical manifestations of hypertension is now diminishing [5]. Preeclampsia (hypertension in pregnancy) is becoming a challenge to obstetricians [6]. Prenatal stress can epigenetically reprogram a newborn’s development and can lead to clinical hypertension in adulthood [7]. Pulmonary hypertension may start to develop in newborns [8]. Hypertension co-occurs with cancer [9,10,11,12,13], cirrhosis [14], and prostatitis [15]. Hypertension worsens both injury [16] and transplantation [17] of a kidney. Epilepsy [18], psoriasis, and dermatitis [19] are associated with hypertension. Anti–SARS-CoV-2 antibody titers are lower in hypertensive than in normotensive patients [20]. The “mosaic theory” of hypertension [21] was recently enriched with hypertensive development via exosome-dependent inflammation and angiogenesis impairment, associated with endothelial dysfunction and vascular remodeling [22]. A clinical review [23] revealed that the hypertensive risk increases with an increase in patients’ stress reactivity [24]. Parents of half of the hypertensive patients had hypertension, but all the known (>60) hypertension-related whole-genome human loci explained only 3% of this heritability of hypertension [25]. Maybe this is why mainstream transcriptome-profiling studies on hypertensive versus normotensive patients [26,27,28,29,30,31,32,33,34,35,36,37,38,39] and animals [7,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57] are focused on the differentially expressed genes (DEGs) that are specific to gender, age, and the stage of hypertension development. This is needed in predictive preventive personalized participatory (4P) medicine [58] to estimate where, how, why, and when hypertension might occur in a given patient depending on his/her genetic background. Because hypertension seems to have a finger in every pie, a meta-analysis of all the available specific hypertension-related DEGs can find among them a theranostic molecular marker of hypertension applicable to everyone, everywhere, anytime.
In our previous studies within this mainstream paradigm, we measured stress reactivity in rats [59] and created an inbred ISIAH rat strain (i.e., inherited stress-induced arterial hypertension) [60] and two outbred strains—tame and aggressive rats—corresponding to low and high stress reactivity [61,62,63,64]. On this basis, we sequenced transcriptomes in the brain stem [43], hypothalamus [44], renal medulla [45], renal cortex [46], and adrenal glands [47] of hypertensive ISIAH rats versus normotensive WAG rats. Besides this, we profiled transcriptomes of the hippocampus [40], prefrontal cortex [41], and retina [42] in OXYS rats (ICG SB RAS, Novosibirsk, Russia), which spontaneously develop the accelerated-senescence phenotype against a background of moderately high blood pressure [65,66,67,68] with respect to normotensive Wistar rats. In the present work, we meta-analyzed our eight abovementioned RNA-Seq datasets to ensure out of caution that among them (together with those available in PubMed [69]), there are still no invariant molecular markers of hypertension. Accordingly, we sequenced the hippocampal transcriptome of tame compared to aggressive rats and identified the stress-reactivity-related rat DEGs and—using our bioinformatics model [70,71,72]—compared them by homology with all the available hypertension-related animal DEGs that we could find. The results were verified using the DEGs of hypertensive versus normotensive patients.

2. Results

2.1. RNA-Seq and Mapping to the Reference Rat Genome

We sequenced the hippocampal transcriptome of three adult male tame gray rats (Rattus norvegicus)—in comparison with that of three aggressive ones—on an Illumina NextSeq 550 system (see Section 4.2). We chose the hippocampus because its functions contribute to learning under stress [73]. The rats were derived from two outbred tame and aggressive strains selectively bred at the ICG SB RAS [59,64] for over 90 generations using the glove test as described elsewhere [74]. The rats were not consanguineous (see Section 4.1). This procedure yielded 169,529,658 raw reads of 75 nt in length (Table 1); we deposited them in the NCBI SRA database [75] (ID PRJNA668014).
In Table 1, the reader can see that 146,521,467 reads could be aligned with rat reference genome Rn6 and yielded 14,039 genes expressed within the hippocampus of the rats under study. Using Fisher’s Z-test with Benjamini’s correction for multiple comparisons, we found 42 DEGs that were not hypothetical, tentative, predicted, uncharacterized, or protein-non-coding genes; this approach reduced the false-positive error rates (Table 1 and Table 2).

2.2. Quantitative PCR (qPCR)-Based Selective Verification of the DEGs Identified in this Work in the Hippocampus of Tame versus Aggressive Rats

First, we used 16 additional unrelated rats, namely: eight aggressive and eight tame rats that scored “–3” and “3”, respectively, on a scale from –4 (most aggressive rat) to 4 (tamest rat) in the glove test [74] conducted one month before the extraction of hippocampus samples (Table 3). Next, among the 42 DEGs listed in Table 2, we chose Ascl3 and Defb17; our qPCR data on them in the hippocampus of the tame and aggressive rats (see Section 4.4) are in Table 3 as the “mean ± standard error of the mean” (M0 ± SEM) of their expression relative to four reference genes (B2m, Hprt1, Ppia, and Rpl30) [76] in triplicate. Arithmetic-mean estimates of the expression levels of each gene (Ascl3 and Defb17) in the hippocampus of these tame and aggressive rats in question are given in Table 3 and Figure 1a.
According to both the Mann–Whitney U test and Fisher’s Z-test, both Ascl3 and Defb17 are significantly overexpressed in the hippocampus of the tame (white bars) versus aggressive (grey bars) rats according to the qPCR data obtained here (Figure 1a: p < 0.05, asterisks), consistently with the RNA-Seq data (Table 2). Figure 1b depicts a significant Pearson’s linear correlation (p < 0.00005), Spearman’s rank correlation (p < 0.05), and Kendall’s rank correlation (p < 0.05) between the log2 values (hereinafter, log2: the log2-transformed ratio of an expression level of a given gene in tame rats to that in aggressive rats) for five genes—Ascl3, Defb17, B2m, Ppia, and Rpl30 (open circles)—within the RNA-Seq (X-axis) and qPCR (Y-axis) data obtained here.

2.3. Comparison of the Known DEGs (of Hypertensive versus Normotensive Animals) with Their Homologous Genes among the 42 Hippocampal DEGs (of Tame versus Aggressive Rats) Identified Here

In this study, using the PubMed database [69], we compiled all the transcriptomes (that we could find) of hypertensive versus normotensive animals, as presented in Table 4. The total number of DEGs was 4216 in 14 tissues of four animal species, as cited in the rightmost column of Table 4 [7,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57].
Figure S1 (hereinafter: see Supplementary Materials) depicts how we compared 4216 DEGs of hypertensive versus normotensive animals (Table 4) with 42 hippocampal DEGs of the tame versus aggressive rats (Table 2). First, we compiled 151 pairs of homologous DEGs, where one DEG was taken from Table 2, while its homologous DEG was found among the 4216 DEGs described in Table 4 (both are in Table S1 (hereinafter: see Supplementary Materials)), as shown in Figure S1 using a Venn diagram and in the table. Next, for the first time. we found that stress-reactivity-related and hypertension-related log2 values of the homologous animal DEGs statistically significantly correlate with each other according to Pearson’s linear correlation (r = −0.29, p < 0.0005), the Goodman–Kruskal generalized correlation (γ = −0.20, p < 0.0005), and Spearman’s (R = −0.29, p < 0.00025) and Kendall’s (τ = −0.20, p < 0.0005) rank correlations. Finally, we processed Table S1 by principal component analysis in the Bootstrap mode of the PAST4.04 software [77] that yielded principal components PC1 and PC2, corresponding to a half-difference and half-sum of the stress reactivity-related and hypertension-related log2 values of the homologous animal DEGs (Figure S1).

2.4. Verification of the Results Obtained on the Hypertensive versus Normotensive Animals Examined in this Work with respect to the DEGs—Of Hypertensive versus Normotensive Patients—That We Could Find

Using the PubMed database [69], we collected all the DEGs (of hypertensive compared with normotensive patients) that we could find (Table 5). The total number of hypertension-related human DEGs found was 7865, as cited in the rightmost column of Table 5 [26,27,28,29,30,31,32,33,34,35,36,37,38,39].
Figure 2 shows exactly how we reproduced step-by-step the results obtained from the hypertension-related animal DEGs only by replacing them with the hypertension-related human DEGs (Table 5) as independent control clinical data that are documented in Table S2. The lower half of this figure presents robust correlations between the stress-reactivity-related and hypertension-related log2 values corresponding to animal and human DEG homologs as well as principal components PC1 and PC2 proportional to the half-difference and half-sum, respectively, of these log2 values; this was the essence of the verification.

2.5. Searching for the Hypertension-Related Molecular Markers among the Human Genes Orthologous to the 42 Hippocampal DEGs (of Tame versus Aggressive Rats) Identified in this Work

To this end, first of all, using the PubMed database [69], we characterized each of the 42 hippocampal DEGs (of tame versus aggressive rats) identified in this work (Table 2), in terms of how downregulation or upregulation of their orthologous human genes can manifest itself in hypertension, as presented [78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178,179,180,181,182,183,184,185,186] in Table S3 (hereinafter: see Supplementary Materials).
Next, for each hippocampal DEG (of tame versus aggressive rats) in question (Table 2), we determined how many homologous DEGs of hypertensive versus normotensive subjects (i.e., patients and animals) have the opposite (NPC1) or the same (NPC2) sign of their log2 values related to hypertension, as compared with the sign of the log2 value of this hippocampal DEG in tame versus aggressive rats, because principal components PC1 and PC2 correspond to a half-difference and half-sum, respectively, of these log2 values (Figure S1 and Figure 2).
Table 6 presents these determined quantities (NPC1 and NPC2) together with their statistical significance assessed via the binomial distribution both without (p-values) and with (PADJ-values) Bonferroni’s correction for multiple comparisons.
As shown in this table, only two of the 42 DEGs (in the hippocampus of the tame versus aggressive rats) found here are linked with PC1 (i.e., Hbb-b1 and Pcdhb9, as described in Table 7). Looking through Table 7, readers can see the statistically significant upregulation of both β-protocadherin and hemoglobin subunit DEGs in the tissues of the hypertensive versus normotensive subjects (patients and animals). This result allowed us to propose the statistically significant downregulation of their homologous DEGs (in the hippocampus of tame versus aggressive rats), identified here (Table 2) as candidate hypertension theranostic molecular markers.

2.6. Verification of Downregulation of Human β-Hemoglobin and β-Protocadherins as HypertensionTtheranostic Molecular Markers using the DEGs (That We Could Find) of Domestic versus Wild Animals

For this purpose, using the PubMed database [69], we collected all the transcriptomes (that we could find) of domestic animals compared with their wild congeners, as shown in Table 8. The bottom row of this table indicates that we found 2393 DEGs in the tissues of domestic versus wild animals, as cited in the rightmost column of this table [72,187,188,189,190,191,192,193].
Using the 42 DEGs (from the hippocampus of the tame versus aggressive rats) identified here (Table 2), together with these 2393 DEGs of domestic versus wild animals (Table 8), we revealed three β-protocadherin DEGs and seven hemoglobin subunit DEGs, which are compared in Table 9 with the human homologous genes (HBB, HBD, and PCDHB9), annotated with respect to hypertension in Table S3. Within columns viii and ix of this table, we transformed the log2 value characterizing the animal hemoglobin subunit and β-protocadherin DEGs into either underexpression or overexpression of the corresponding gene during divergence of domestic and wild animals from their most recent common ancestor, which is the most widely used phylogeny concept [194,195,196,197,198]. Downregulation of human genes HBB and HBD reduces blood viscosity [199] and corresponds to downregulation of the homologous genes Hbb-b1, Hbbl, Hba1, Hbad, Hbm, and Hbz1 in the tame rat, domestic chicken, or dog during their divergence from their most recent ancestors with respect to their wild congeners (Table 9). As for human hemoglobin upregulation, a high-altitude environment provokes both hypertension and hyperhemoglobinemia [103]. This hemoglobin upregulation in humans corresponds to high hemoglobin subunit levels in aggressive rats [72], wolves [189], and wild chickens [193] during their microevolution (Table 9). Likewise, human gene PCDHB9 (protocadherin β9) downregulation leads to a wide vascular inner diameter [200] and corresponds to downregulation of β-protocadherins in tame rats [72] and domestic rabbits [188] during their microevolution (Table 9). Finally, PCDHB9 upregulation in humans elevates the risk of gastric cancer [201] (the surgical removal of which leads to hypertensive remission [12]) and corresponds to upregulation of β-protocadherins in aggressive rats [72] and wild rabbits [188] during their microevolution (Table 9). As a standard Fisher’s 2 × 2 table, Table 10 summarizes the observations detailed in Table 9.
As one can see in Table 10, downregulation of the genes of β-protocadherins and hemoglobin subunits, which were associated with a wide vascular inner diameter [200] and low blood viscosity [199], respectively, was observed only in domestic animals (not in their wild congeners). This difference is statistically significant according to the binomial distribution (p < 0.0001), Pearson’s χ2 test (p < 0.001), and Fisher’s exact test (p < 0.001). Thus, downregulation of β-protocadherins and downregulation of hemoglobin subunits in animals are molecular markers of low stress reactivity [24], which is both a key physiological trait for domestic animals [61,62] and a clinically proven hypertension theranostic physiological marker in everyone, everywhere, anytime [23].

3. Discussion

Here, we observed for the first time that downregulation of hemoglobin subunits or β-protocadherins corresponds to low blood viscosity or a wide vascular inner diameter, i.e., two universal genome-wide hypertension theranostic molecular markers applicable to everyone, everywhere, anytime, as readers can see in Table 7. Because of atherosclerosis comorbid with hypertension, this may support our previous finding that natural selection against underexpression of atheroprotective genes slows atherogenesis [202].
Nevertheless, it seems to be highly debatable how low expression levels of human genes HBB, HBD, and PCDHB9 would be adaptive under natural selection, favoring their downregulation that could cause their loss. For this reason, here, we analyzed these genes using our web service SNP_TATA_Comparator [203] applicable to research on hypertension, owing to its successful use in a clinical study on pulmonary tuberculosis [204] comorbid with hypertension [205]. Figure S2 exemplifies how we also used the UCSC Browser [206], Bioperl toolkit [207], and a package of R [208], together with both Ensembl [209] and dbSNP [210] databases in the case of the candidate SNP marker (rs34166473) reducing blood viscosity via HBD downregulation [199], as outlined here (Table S4). In total, we examined all 85 SNPs within the 70 bp proximal promoters of the genes HBD, HBD, and PCDHB9 within build #153 of the dbSNP database [210]. As a result of this work, we found 27 candidate SNP markers of hypertension, as indicated [12,103,199,200,201,211] in Table S4 and described [212,213,214,215,216,217,218,219,220] in Section S1Supplementary methods for DNA sequence analysis” (see Supplementary Materials).
Besides this, Figure S3 (hereinafter: see Supplementary Materials) presents the selective experimental verification [221,222,223] of these estimates (in an electrophoretic mobility shift assay; EMSA) exemplified by minor allele −30C of rs1473693473 (see Section S2Supplementary methods for in vitro measurements”). In total, we verified two ancestral alleles of the human HBB and HBD genes along with nine minor alleles, namely: rs35518301:g, rs34166473:c, rs34500389:t, rs33980857:a, rs34598529:g, rs33931746:g, rs33931746:c, rs281864525:c, and rs63750953:deletion (Table S5 (hereinafter: see Supplementary Materials)). According to Goodman–Kruskal generalized correlation (γ), Pearson’s linear correlation (r), and Spearman’s (R) and Kendall’s (τ) rank correlations, our computational predictions and experimental measurements are in significant agreement with one another (Figure S3c).
Finally, according to the semicentennial tradition, to assess the relative mutation rates (e.g., transitions versus transversions [224], synonymous versus non-synonymous substitutions [225], and insertions versus deletions [226]), we compared the genes HBB, HBD, and PCDHB9 in question with the human genome as a whole [227,228,229] (Table 11).
At the top of this table is a genome-wide SNP pattern of TBP sites—where SNPs decreasing the TBP–DNA affinity dominate over SNPs, thus increasing this affinity within the human genome—as predicted by taking into account many mutagenesis molecular mechanisms (e.g., epistatic effects) [227] and as proven within the “1000 Genomes” project [228]. In accordance with Haldane’s dilemma [229] and neutral evolution theory [230], this whole-genome trait reflects neutral mutation drift as a norm. At the bottom of Table 11 is the hypertension-related candidate SNP markers identified here, which often significantly reduce the affinity of TBP for promoters of the genes HBB, HBD, and PCDHB9, representing the genome-wide neutral mutational drift antagonizing hypertension.
Altogether, the hypertension-related candidate SNP markers discussed above fit the newest concept [231]: in addition to the accumulation of degenerative SNPs owing to their uncontrollability during neutral mutational drift, some adaptive SNPs can also accumulate in this way (Table 11).

4. Materials and Methods

4.1. Animals

The study was conducted on adult male gray rats (R. norvegicus) artificially bred for over 90 generations for either aggressive or tame behavior (as two outbred strains). The rats were kept under standard conditions of the Conventional Animal Facility at the ICG SB RAS (Novosibirsk, Russia), as described elsewhere [64,74,232]. The total number of rats was 22 (11 aggressive and 11 tame ones), each four months old and weighing 250–270 g, all from different unrelated litters. All the rats were decapitated. Using a handbook technique [233], we excised samples of the hippocampus, which were then flash-frozen in liquid nitrogen and stored at −70 °C until use. Every effort was made to minimize the number of animals under study and to prevent their suffering. This work was conducted in accordance with the guidelines of the Declaration of Helsinki, Directive 2010/63/EU of the European Parliament, and of the European Council resolution of 22 September 2010.
The research protocol was approved by the Interinstitutional Commission on Bioethics at the ICG SB RAS, Novosibirsk, Russia (approval documentation no. 8 dated 19 March 2012).

4.2. RNA-Seq

Total RNA was isolated from ~100 mg of the hippocampus tissue samples of tame (n = 3) and aggressive (n = 3) rats using the TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA). The quality of the total-RNA samples was evaluated using a Bioanalyzer 2100 (Agilent, Santa-Clara, CA, USA). Samples with optimal RNA Integrity Numbers (RINs) were chosen for further analysis. Additionally, the total RNA was analyzed quantitatively on an Invitrogen Qubit™ 2.0 fluorometer (Invitrogen). Different RNA types were separated with the mirVana™ Kit (Thermo Fisher Scientific, Waltham, MA, USA). The Dynabeads mRNA Purification Kit (Invitrogen) was used to prepare highly purified mRNA from 5 μg of the RNA fraction depleted of small RNAs. Preparation of RNA-seq libraries from 15–30 ng of an mRNA fraction was carried out using the ScriptSeq™ v2 RNA-Seq Library Preparation Kit (epicenter®, Madison, WI, USA). The quality of the obtained libraries was checked on a Bioanalyzer 2100. After normalization, barcoded libraries were pooled and handed over to the Multi-Access Center of Genomic Research (ICG SB RAS, Novosibirsk, Russia) for sequencing on an Illumina NextSeq 550 instrument in a NextSeq® 500/550 High Output Kit v2 cassette (75 cycles) under the assumption of a direct read of 75 nucleotides, with at least 40 million reads.

4.3. Mapping of RNA Sequences to the R. norvegicus Reference Genome

First, the primary raw Fastq files were checked by means of a quality control tool FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc; accessed on 19 December 2018) for high-throughput sequencing data. After that, using the Trimmomatic tool [234], we improved the quality of the raw reads step-by-step as follows: (i) removing a base from either the start or end position if the quality was low, (ii) trimming bases by a sliding-window method, and (iii) removing any remaining reads that were less than 36 bases long. Next, with the help of the TopHat2 toolbox [235], we aligned the trimmed reads to the R. norvegicus reference genome (RGSC Rnor_6.0, UCSC version Rn6, July 2014 assembly). Then, in SAMTools version 1.4 [236], we reformatted these alignments into sorted BAM files. After that, using the htseq-count tool from preprocessing software HTSeq v.0.7.2 [237], along with gtf files carrying coordinates of the rat genes according to Rnor_6.0 and an indexed SAM file, we assigned the reads in question to these genes. Finally, in DESeq2 [238] via Web service IRIS (http://bmbl.sdstate.edu/IRIS/; accessed on 16 January 2020), we rated the differential expression of the abovementioned rat genes, and to minimize false-positive error rates, applied Fisher’s Z-test [239] with Benjamini’s correction for multiple comparisons, as well as discarded all the hypothetical, tentative, predicted, uncharacterized, and protein-non-coding genes.

4.4. qPCR

To selectively and independently verify the tame-versus-aggressive rat hippocampal DEGs found here (Table 2), in this work, we performed a qPCR control assay on the total RNA taken only from the remaining samples of the hypothalamus of tame (n = 8) and aggressive (n = 8) rats. First, with the help of TRIzol™, we isolated total RNA, purified it on Agencourt RNAClean XP Kit magnetic beads (Beckman, #A63987), and quantified it by means of a Qubit™ 2.0 fluorometer (Invitrogen/Life Technologies) along with an RNA High-Sensitivity Kit (Invitrogen, cat. # Q32852). After that, we synthesized cDNA using the Reverse Transcription Kit (Syntol, #OT-1). Next, using web service PrimerBLAST [240], we designed oligonucleotide primers for qPCR (Table 12).
After that, we carried out qPCR on a LightCycler® 96 (Roche, Basel, Basel-Stadt, Switzerland) with the EVA Green I Kit in three technical replicates. We determined the qPCR efficiency by means of serial cDNA dilutions (standards). In line with the commonly accepted recommendations [76], we simultaneously analyzed four reference genes, namely: B2m (β-2-microglobulin) [241], Hprt1 (hypoxanthine phosphoribosyltransferase 1) [242], Ppia (peptidylprolyl isomerase A) [243], and Rpl30 (ribosomal protein L30) [244].

4.5. DEGs under Study

In this work, we analyzed all the publicly available independent experimental RNA-Seq datasets—on transcriptomes from the tissues of hypertensive versus normotensive patients [26,27,28,29,30,31,32,33,34,35,36,37,38,39], hypertensive versus normotensive animals [7,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57], and domestic versus wild animals [72,176,177,178,179,180,181,182,183,184,185,186,187,188,189,190,191,192,193].

4.6. Human Genes under Study

Here, we analyzed the 42 human genes that are orthologous to the 42 hippocampal DEGs of the tame versus aggressive rats (Table 2). Using the PubMed database [69], we characterized each of these 42 human genes in terms of what is already clinically known about how their underexpression or overexpression can manifest itself in hypertension (Table 9 and Tables S3 and S4).

4.7. DNA Sequences under Study

For in silico analysis of the human genes encoding candidate molecular markers for hypertension that were for the first time suggested in this work, we retrieved both DNA sequences and SNPs of their 70 bp proximal promoters from the Ensembl database [209] and from the dbSNP database [210], respectively, relative to reference human genome assembly GRCh38/hg38 using the UCSC Genome Browser [206] in the dialog mode and additionally by means of toolbox BioPerl [207] in the automated mode, as shown in Figure S2.

4.8. In Silico Analysis of DNA Sequences

We examined SNPs within DNA sequences using our previously developed public web service SNP_TATA_Comparator [203], which applies our bioinformatic model of three-step binding between TBP and a human gene promoter, as detailed in the Supplementary Materials (i.e., Section S1Supplementary methods for DNA sequence analysis”) and additionally exemplified in Figure S2.

4.9. In Vitro Measurements

In this project, we in vitro measured KD values expressed in “moles per liter” units of the equilibrium dissociation constant of TBP promoter complexes by means of the EMSA, for each of the nine chosen candidate SNP markers for hypertension subjected to this experimental verification—i.e., rs35518301:g, rs34166473:c, rs34500389:t, rs33980857:a, rs34598529:g, rs33931746:g, rs33931746:c, rs281864525:c, and rs63750953:deletion—as described in-depth in the Supplementary Materials (i.e., Section S2Supplementary methods for in vitro measurement”).

4.10. Knowledge Base on Domestic Animals’ DEGs with Orthologous Human Genes that Can Affect Hypertension

In files with the flat Excel-compatible textual format, here, on the one hand, we first documented all the suggested associations between DEGs (of domestic versus wild animals) homologous to the 42 DEGs (in the hippocampus of tame and aggressive rats) identified in this study. On the other hand, we documented how underexpression or overexpression of the human genes homologous to these hippocampal rat DEGs can affect hypertension. Next, using the MariaDB 10.2.12 web environment (MariaDB Corp AB, Espoo, Finland), we added the current findings to our previously created PetDEGsDB knowledge base, which is publicly available at www.sysbio.ru/domestic-wild (accessed on 16 January 2020).

4.11. Statistical Analysis

Using the options in the standard toolbox of Statistica (StatsoftTM), we applied the Mann–Whitney U test, Fisher’s Z-test, Pearson’s linear correlation test, the Goodman–Kruskal generalized correlation test, Spearman’s and Kendall’s rank correlation tests, Pearson’s χ2 test, Fisher’s exact test, and binomial-distribution analysis.
Besides this, using the PAST4.04 software package [77], we conducted principal component analysis in the Bootstrap-refinement mode via its mode selection path “Multivariate” → “Ordination” → “Principal Components (PCA)” → “Correlation” → “Bootstrap.”

5. Conclusions

First of all, in this work, we performed high-throughput sequencing of the hippocampus transcriptome for three tame adult male rats compared with three aggressive ones (all unrelated animals). The primary experimental data are publicly available for those who would like to use them (NCBI SRA database ID: PRJNA668014) [75].
With the help of this transcriptome, we found the 42 hippocampal DEGs—in the tame versus aggressive rats in question—with statistical significance (PADJ < 0.05, Fisher’s Z-test with Benjamini’s correction for multiple comparisons) that was conventionally acceptable (Table 2). Moreover, we selectively validated these DEGs by independent experimental analyses (qPCR) of the other eight tame versus eight aggressive adult male rats from different unrelated litters of the same two outbred strains (Table 3 and Figure 1).
Besides this, using these 42 hippocampal tame-versus-aggressive rat DEGs, which reflect rat stress reactivity, we meta-analyzed (by homology) all the highly specific DEGs—of hypertensive versus normotensive subjects (i.e., patients and animals)—that we could find within mainstream hypertension-related transcriptomic research articles. First, we found significant correlations between stress reactivity-related and hypertension-related conventional log2 values (fold changes) of the homologous DEGs analyzed. Next, we found principal components, PC1 and PC2, corresponding to a half-difference and half-sum of these log2 values. Finally, these data pointed to downregulation of hemoglobin or β-protocadherins, corresponding to low blood viscosity [199] or a wide vascular inner diameter [200], as two hypertension theranostic molecular markers applicable to everyone, everywhere, anytime.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/article/10.3390/ijms23052835/s1.

Author Contributions

Conceptualization and supervision, N.A.K.; methodology, A.M., M.N., O.R. and N.G.K.; investigation, I.C., R.K., N.V.K. and S.S.; software, A.B.; validation, E.S. and P.P.; resources, D.O.; data curation, K.Z. and B.K.; writing—original draft preparation, M.P. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Russian Science Foundation (project no. 19-74-10041).

Institutional Review Board Statement

This work was conducted in accordance with the guidelines of the Declaration of Helsinki, Directive 2010/63/EU of the European Parliament, and of the European Council resolution of 22 September 2010. The research protocol was approved by the Interinstitutional Commission on Bioethics at the ICG SB RAS, Novosibirsk, Russia (Approval documentation no. 8 dated 19 March 2012).

Informed Consent Statement

Not applicable.

Data Availability Statement

The primary RNA-Seq data obtained in this work were deposited in the NCBI SRA database (ID = PRJNA668014).

Acknowledgments

We are grateful to Nikolai Shevchuk (Shevchuk Editing Co., Brooklyn, NY, USA) for fruitful discussions of the work and assistance with adapting it to the requirements of the English language for scientific publications. We are also thankful to the Multi-Access Center “Bioinformatics” for the use of computational resources as supported by Russian government project FWNR-2022-0020. We are appreciative of the Center for Genomic Research at the ICG SB RAS, where RNA-Seq was carried out, as supported by the Russian Federal Science and Technology Program for the Development of Genetic Technologies.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

DEGdifferentially expressed gene
EMSAelectrophoretic mobility shift assay
HThypertension
log2 valuelog2-transformed gene expression fold change
PC1 (PC2)major (minor) principal component
qPCRquantitative polymerase chain reaction
RNA-SeqRNA sequencing
SNPsingle-nucleotide polymorphism
TBPTATA-binding protein

References

  1. Alpsoy, S. Exercise and hypertension. Adv. Exp. Med. Biol. 2020, 1228, 153–167. [Google Scholar] [PubMed]
  2. Barquera, S.; Pedroza-Tobias, A.; Medina, C.; Hernandez-Barrera, L.; Bibbins-Domingo, K.; Lozano, R.; Moran, A.E. Global overview of the epidemiology of atherosclerotic cardiovascular disease. Arch. Med. Res. 2015, 46, 328–338. [Google Scholar] [CrossRef] [PubMed]
  3. Meade, R.D.; Akerman, A.P.; Notley, S.R.; McGinn, R.; Poirier, P.; Gosselin, P.; Kenny, G.P. Physiological factors characterizing heat-vulnerable older adults: A narrative review. Environ. Int. 2020, 144, 105909. [Google Scholar] [CrossRef]
  4. Samanic, C.M.; Barbour, K.E.; Liu, Y.; Wang, Y.; Fang, J.; Lu, H.; Schieb, L.; Greenlund, K.J. Prevalence of self-reported hypertension and antihypertensive medication use by county and rural-urban classification-United States, 2017. MMWR-Morb. Mortal. Wkly. Rep. 2020, 69, 533–539. [Google Scholar] [CrossRef]
  5. Karaduman, M.; Aparci, M.; Unlu, M.; Ozturk, C.; Balta, S.; Celik, T. Role of screening tests in the detection and management of blood pressure abnormalities among young population. Angiology 2017, 68, 441–446. [Google Scholar] [CrossRef]
  6. Huang, Q.T.; Chen, J.H.; Hang, L.L.; Liu, S.S.; Zhong, M. Activation of PAR-1/NADPH oxidase/ROS signaling pathways is crucial for the thrombin-induced sFlt-1 production in extravillous trophoblasts: Possible involvement in the pathogenesis of preeclampsia. Cell. Physiol. Biochem. 2015, 35, 1654–1662. [Google Scholar] [CrossRef]
  7. Tharmalingam, S.; Khurana, S.; Murray, A.; Lamothe, J.; Tai, T.C. Whole transcriptome analysis of adrenal glands from prenatal glucocorticoid programmed hypertensive rodents. Sci. Rep. 2020, 10, 18755. [Google Scholar] [CrossRef] [PubMed]
  8. Mardenkyzy, D.; Rakhimzhanova, R.; Dautov, T.; Jongmin, L.; Saduakasova, A.; Kozhakhmetova, Z.; Yelshibaeyva, E. Possibilities of computer tomography in the diagnosis of pulmonary hypertension and influence of various factors (gender, age, body weight, reception of medicines) on the severity of the pulmonary hypertension syndrome. Georgian Med. News 2020, 303, 67–72. [Google Scholar]
  9. Khan, A.W.; Olds, G.; Malik, F.; Teran, P.; Hall, N.; Ali, M. Acute myeloid leukemia masquerading as idiopathic intracranial hypertension: A rare initial presentation. Kans. J. Med. 2021, 14, 133–135. [Google Scholar] [CrossRef]
  10. Adams-Campbell, L.L.; Taylor, T.; Hicks, J.; Lu, J.; Dash, C. The effect of a 6-month exercise intervention trial on allostatic load in black women at increased risk for breast cancer: The FIERCE study. J. Racial Ethn. Health Disparities 2021. [Google Scholar] [CrossRef] [PubMed]
  11. Gilard, V.; Ferey, J.; Marguet, F.; Fontanilles, M.; Ducatez, F.; Pilon, C.; Lesueur, C.; Pereira, T.; Basset, C.; Schmitz-Afonso, I.; et al. Integrative metabolomics reveals deep tissue and systemic metabolic remodeling in glioblastoma. Cancers 2021, 13, 5157. [Google Scholar] [CrossRef] [PubMed]
  12. Cheng, Y.X.; Peng, D.; Tao, W.; Zhang, W. Effect of oncometabolic surgery on gastric cancer: The remission of hypertension, type 2 diabetes mellitus, and beyond. World J. Gastrointest. Oncol. 2021, 13, 1157–1163. [Google Scholar] [CrossRef]
  13. Palacios, D.A.; Zabor, E.C.; Munoz-Lopez, C.; Roversi, G.; Mahmood, F.; Abramczyk, E.; Kelly, M.; Wilson, B.; Abouassaly, R.; Campbell, S.C. Does reduced renal function predispose to cancer-specific mortality from renal cell carcinoma? Eur. Urol. 2021, 79, 774–780. [Google Scholar] [CrossRef] [PubMed]
  14. Qi, X.L. Current status and prospects of clinical research on portal hypertension in China. Zhonghua Gan Zang Bing Za Zhi (Chin. J. Hepatol.) 2021, 29, 817–819. [Google Scholar]
  15. Saltalamacchia, G.; Frascaroli, M.; Bernardo, A.; Quaquarini, E. Renal and cardiovascular toxicities by new systemic treatments for prostate cancer. Cancers 2020, 12, 1750. [Google Scholar] [CrossRef] [PubMed]
  16. Gu, D.; Fang, D.; Zhang, M.; Guo, J.; Ren, H.; Li, X.; Zhang, Z.; Yang, D.; Zou, X.; Liu, Y.; et al. Gastrin, via activation of PPARα, protects the kidney against hypertensive injury. Clin. Sci. 2021, 135, 409–427. [Google Scholar] [CrossRef]
  17. Chou, L.M.; Beyer, M.M.; Butt, K.M.; Manis, T.; Friedman, E.A. Hypertension jeopardizes diabetic patients following renal transplant. Trans. Am. Soc. Artif. Intern. Organs 1984, 30, 473–478. [Google Scholar] [PubMed]
  18. Yousaf, M.; Ayasse, M.; Ahmed, A.; Gwillim, E.C.; Janmohamed, S.R.; Yousaf, A.; Patel, K.R.; Thyssen, J.P.; Silverberg, J.I. Association between atopic dermatitis and hypertension: A systematic review and meta-analysis. Br. J. Dermatol. 2021. [Google Scholar] [CrossRef]
  19. Lukawski, K.; Czuczwar, S.J. Assessment of drug-drug interactions between moxonidine and antiepileptic drugs in the maximal electroshock seizure test in mice. Basic Clin. Pharmacol. Toxicol. 2021, 130, 28–34. [Google Scholar] [CrossRef] [PubMed]
  20. Dinc, H.O.; Saltoglu, N.; Can, G.; Balkan, I.I.; Budak, B.; Ozbey, D.; Caglar, B.; Karaali, R.; Mete, B.; Tuyji Tok, Y.; et al. Inactive SARS-CoV-2 vaccine generates high antibody responses in healthcare workers with and without prior infection. Vaccine 2022, 40, 52–58. [Google Scholar] [CrossRef] [PubMed]
  21. Page, I.H. The Mosaic Theory of arterial hypertension-: Its interpretation. Perspect. Biol. Med. 1967, 10, 325–333. [Google Scholar] [CrossRef] [PubMed]
  22. Arishe, O.O.; Priviero, F.; Wilczynski, S.A.; Webb, R.C. Exosomes as intercellular messengers in hypertension. Int. J. Mol. Sci. 2021, 22, 11685. [Google Scholar] [CrossRef]
  23. Turner, A.I.; Smyth, N.; Hall, S.J.; Torres, S.J.; Hussein, M.; Jayasinghe, S.U.; Ball, K.; Clow, A.J. Psychological stress reactivity and future health and disease outcomes: A systematic review of prospective evidence. Psychoneuroendocrinology 2020, 114, 104599. [Google Scholar] [CrossRef] [PubMed]
  24. Cannon, W.B. The emergency function of the adrenal medulla in pain and the major emotions. Am. J. Physiol. 1914, 33, 356–372. [Google Scholar] [CrossRef]
  25. Poulter, N.R.; Prabhakaran, D.; Caulfield, M. Hypertension. Lancet 2015, 386, 801–812. [Google Scholar] [CrossRef]
  26. Wu, Y.B.; Zang, W.D.; Yao, W.Z.; Luo, Y.; Hu, B.; Wang, L.; Liang, Y.L. Analysis of FOS, BTG2, and NR4A in the function of renal medullary hypertension. Genet. Mol. Res. 2013, 12, 3735–3741. [Google Scholar] [CrossRef] [PubMed]
  27. Qiu, X.; Lin, J.; Liang, B.; Chen, Y.; Liu, G.; Zheng, J. Identification of hub genes and microRNAs associated with idiopathic pulmonary arterial hypertension by integrated bioinformatics analyses. Front. Genet. 2021, 12, 667406. [Google Scholar] [CrossRef] [PubMed]
  28. Stearman, R.S.; Bui, Q.M.; Speyer, G.; Handen, A.; Cornelius, A.R.; Graham, B.B.; Kim, S.; Mickler, E.A.; Tuder, R.M.; Chan, S.Y.; et al. Systems analysis of the human pulmonary arterial hypertension lung transcriptome. Am. J. Respir. Cell Mol. Biol. 2019, 60, 637–649. [Google Scholar] [CrossRef] [PubMed]
  29. Li, C.; Zhang, Z.; Xu, Q.; Wu, T.; Shi, R. Potential mechanisms and serum biomarkers involved in sex differences in pulmonary arterial hypertension. Medicine 2020, 99, e19612. [Google Scholar] [CrossRef] [PubMed]
  30. Yao, X.; Jing, T.; Wang, T.; Gu, C.; Chen, X.; Chen, F.; Feng, H.; Zhao, H.; Chen, D.; Ma, W. Molecular characterization and elucidation of pathways to identify novel therapeutic targets in pulmonary arterial hypertension. Front. Physiol. 2021, 12, 694702. [Google Scholar] [CrossRef]
  31. Awad, K.S.; Elinoff, J.M.; Wang, S.; Gairhe, S.; Ferreyra, G.A.; Cai, R.; Sun, J.; Solomon, M.A.; Danner, R.L. Raf/ERK drives the proliferative and invasive phenotype of BMPR2-silenced pulmonary artery endothelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2016, 310, L187–L201. [Google Scholar] [CrossRef]
  32. Saei, H.; Govahi, A.; Abiri, A.; Eghbali, M.; Abiri, M. Comprehensive transcriptome mining identified the gene expression signature and differentially regulated pathways of the late-onset preeclampsia. Pregnancy Hypertens. 2021, 25, 91–102. [Google Scholar] [CrossRef] [PubMed]
  33. Jung, Y.W.; Shim, J.I.; Shim, S.H.; Shin, Y.J.; Shim, S.H.; Chang, S.W.; Cha, D.H. Global gene expression analysis of cell-free RNA in amniotic fluid from women destined to develop preeclampsia. Medicine 2019, 98, e13971. [Google Scholar] [CrossRef] [PubMed]
  34. Textoris, J.; Ivorra, D.; Ben Amara, A.; Sabatier, F.; Menard, J.P.; Heckenroth, H.; Bretelle, F.; Mege, J.L. Evaluation of current and new biomarkers in severe preeclampsia: A microarray approach reveals the VSIG4 gene as a potential blood biomarker. PLoS ONE 2013, 8, e82638. [Google Scholar] [CrossRef]
  35. Yong, H.E.; Melton, P.E.; Johnson, M.P.; Freed, K.A.; Kalionis, B.; Murthi, P.; Brennecke, S.P.; Keogh, R.J.; Moses, E.K. Genome-wide transcriptome directed pathway analysis of maternal pre-eclampsia susceptibility genes. PLoS ONE 2015, 10, e0128230. [Google Scholar] [CrossRef] [PubMed]
  36. Ahn, S.; Jeong, E.; Min, J.W.; Kim, E.; Choi, S.S.; Kim, C.J.; Lee, D.C. Identification of genes dysregulated by elevation of microRNA-210 levels in human trophoblasts cell line, Swan 71. Am. J. Reprod. Immunol. 2017, 78, e12722. [Google Scholar] [CrossRef]
  37. Neusser, M.A.; Lindenmeyer, M.T.; Moll, A.G.; Segerer, S.; Edenhofer, I.; Sen, K.; Stiehl, D.P.; Kretzler, M.; Grone, H.J.; Schlondorff, D.; et al. Human nephrosclerosis triggers a hypoxia-related glomerulopathy. Am. J. Pathol. 2010, 176, 594–607. [Google Scholar] [CrossRef] [PubMed]
  38. Koper, A.; Zeef, L.A.; Joseph, L.; Kerr, K.; Gosney, J.; Lindsay, M.A.; Booton, R. Whole transcriptome analysis of pre-invasive and invasive early squamous lung carcinoma in archival laser microdissected samples. Respir. Res. 2017, 18, 12. [Google Scholar] [CrossRef] [PubMed]
  39. Zheng, Y.; He, J.Q. Common differentially expressed genes and pathways correlating both coronary artery disease and atrial fibrillation. EXCLI J. 2021, 20, 126–141. [Google Scholar]
  40. Stefanova, N.A.; Maksimova, K.Y.; Rudnitskaya, E.A.; Muraleva, N.A.; Kolosova, N.G. Association of cerebrovascular dysfunction with the development of Alzheimer’s disease-like pathology in OXYS rats. BMC Genom. 2018, 19, 75. [Google Scholar] [CrossRef] [PubMed]
  41. Stefanova, N.A.; Ershov, N.I.; Maksimova, K.Y.; Muraleva, N.A.; Tyumentsev, M.A.; Kolosova, N.G. The rat prefrontal-cortex transcriptome: Effects of aging and sporadic Alzheimer’s disease-like pathology. J. Gerontol. A Biol. Sci. Med. Sci. 2019, 74, 33–43. [Google Scholar] [CrossRef]
  42. Kozhevnikova, O.S.; Korbolina, E.E.; Ershov, N.I.; Kolosova, N.G. Rat retinal transcriptome: Effects of aging and AMD-like retinopathy. Cell Cycle 2013, 12, 1745–1761. [Google Scholar] [CrossRef]
  43. Fedoseeva, L.A.; Klimov, L.O.; Ershov, N.I.; Efimov, V.M.; Markel, A.L.; Orlov, Y.L.; Redina, O.E. The differences in brain stem transcriptional profiling in hypertensive ISIAH and normotensive WAG rats. BMC Genom. 2019, 20, 297. [Google Scholar] [CrossRef]
  44. Klimov, L.O.; Ershov, N.I.; Efimov, V.M.; Markel, A.L.; Redina, O.E. Genome-wide transcriptome analysis of hypothalamus in rats with inherited stress-induced arterial hypertension. BMC Genet. 2016, 17, 13. [Google Scholar] [CrossRef]
  45. Ryazanova, M.A.; Fedoseeva, L.A.; Ershov, N.I.; Efimov, V.M.; Markel, A.L.; Redina, O.E. The gene-expression profile of renal medulla in ISIAH rats with inherited stress-induced arterial hypertension. BMC Genet. 2016, 17 (Suppl. S3), 151. [Google Scholar] [CrossRef]
  46. Fedoseeva, L.A.; Ryazanova, M.A.; Ershov, N.I.; Markel, A.L.; Redina, O.E. Comparative transcriptional profiling of renal cortex in rats with inherited stress-induced arterial hypertension and normotensive Wistar Albino Glaxo rats. BMC Genet. 2016, 17 (Suppl. S1), 12. [Google Scholar] [CrossRef] [PubMed][Green Version]
  47. Fedoseeva, L.A.; Klimov, L.O.; Ershov, N.I.; Alexandrovich, Y.V.; Efimov, V.M.; Markel, A.L.; Redina, O.E. Molecular determinants of the adrenal gland functioning related to stress-sensitive hypertension in ISIAH rats. BMC Genom. 2016, 17, 989. [Google Scholar] [CrossRef] [PubMed]
  48. Yuan, X.; Wu, Q.; Liu, X.; Zhang, H.; Xiu, R. Transcriptomic profile analysis of brain microvascular pericytes in spontaneously hypertensive rats by RNA-Seq. Am. J. Transl. Res. 2018, 10, 2372–2386. [Google Scholar] [PubMed]
  49. Watanabe, Y.; Yoshida, M.; Yamanishi, K.; Yamamoto, H.; Okuzaki, D.; Nojima, H.; Yasunaga, T.; Okamura, H.; Matsunaga, H.; Yamanishi, H. Genetic analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the kidneys. Int. J. Mol. Med. 2015, 36, 712–724. [Google Scholar] [CrossRef] [PubMed]
  50. Xiao, G.; Wang, T.; Zhuang, W.; Ye, C.; Luo, L.; Wang, H.; Lian, G.; Xie, L. RNA sequencing analysis of monocrotaline-induced PAH reveals dysregulated chemokine and neuroactive ligand receptor pathways. Aging 2020, 12, 4953–4969. [Google Scholar] [CrossRef] [PubMed]
  51. Du, H.; Xiao, G.; Xue, Z.; Li, Z.; He, S.; Du, X.; Zhou, Z.; Cao, L.; Wang, Y.; Yang, J.; et al. QiShenYiQi ameliorates salt-induced hypertensive nephropathy by balancing ADRA1D and SIK1 expression in Dahl salt-sensitive rats. Biomed. Pharmacother. 2021, 141, 111941. [Google Scholar] [CrossRef] [PubMed]
  52. Ashraf, U.M.; Mell, B.; Jose, P.A.; Kumarasamy, S. Deep transcriptomic profiling of Dahl salt-sensitive rat kidneys with mutant form of Resp18. Biochem. Biophys. Res. Commun. 2021, 572, 35–40. [Google Scholar] [CrossRef] [PubMed]
  53. Zhou, X.; Zhang, X.X.; Mahmmod, Y.S.; Hernandez, J.A.; Li, G.F.; Huang, W.Y.; Wang, Y.P.; Zheng, Y.X.; Li, X.M.; Yuan, Z.G. A Transcriptome analysis: Various reasons of adverse pregnancy outcomes caused by acute toxoplasma gondii infection. Front. Physiol. 2020, 11, 115. [Google Scholar] [CrossRef]
  54. Puig, O.; Wang, I.M.; Cheng, P.; Zhou, P.; Roy, S.; Cully, D.; Peters, M.; Benita, Y.; Thompson, J.; Cai, T.Q. Transcriptome profiling and network analysis of genetically hypertensive mice identifies potential pharmacological targets of hypertension. Physiol. Genom. 2010, 42A, 24–32. [Google Scholar] [CrossRef] [PubMed][Green Version]
  55. Loke, S.Y.; Wong, P.T.; Ong, W.Y. Global gene expression changes in the prefrontal cortex of rabbits with hypercholesterolemia and/or hypertension. Neurochem. Int. 2017, 102, 33–56. [Google Scholar] [CrossRef] [PubMed]
  56. Park, W.; Rengaraj, D.; Kil, D.Y.; Kim, H.; Lee, H.K.; Song, K.D. RNA-seq analysis of the kidneys of broiler chickens fed diets containing different concentrations of calcium. Sci. Rep. 2017, 7, 11740. [Google Scholar] [CrossRef]
  57. Yang, F.; Cao, H.; Xiao, Q.; Guo, X.; Zhuang, Y.; Zhang, C.; Wang, T.; Lin, H.; Song, Y.; Hu, G.; et al. Transcriptome analysis and gene identification in the pulmonary artery of broilers with ascites syndrome. PLoS ONE 2016, 11, e0156045. [Google Scholar] [CrossRef] [PubMed]
  58. Trovato, G.M. Sustainable medical research by effective and comprehensive medical skills: Overcoming the frontiers by predictive, preventive and personalized medicine. EPMA J. 2014, 5, 14. [Google Scholar] [CrossRef] [PubMed]
  59. Osadchuk, A.V.; Markel, A.L.; Khusainov, R.A.; Naumenko, E.V.; Beliaev, D.K. Problems in the genetics of stress. IV. A genetic analysis of the level of autonomic reactivity in emotional stress in rats. Sov. Genet. 1979, 15, 1847–1857. [Google Scholar]
  60. Markel, A.L. Features of the behavior of the rat with hereditarily determined arterial hypertension. Zhurnal Vyss. Nervn. Deiatelnosti Im. IP Pavlov. 1986, 36, 956–962. [Google Scholar]
  61. Herbek, Y.E.; Zakharov, I.K.; Trapezov, O.V.; Shumny, V.K. Evolution compressed in time. Philos. Sci. 2013, 1, 115–139. [Google Scholar]
  62. Oskina, I.N.; Herbeck, Y.E.; Shikhevich, S.G.; Plyusnina, I.Z.; Gulevich, R.G. Alterations in the hypothalamus-pituitary-adrenal and immune systems during selection of animals for tame behavior. Inf. Bull. VOGiS 2008, 12, 39–49. [Google Scholar]
  63. Prasolova, L.A.; Gerbek, Y.E.; Gulevich, R.G.; Shikhevich, S.G.; Konoshenko, M.Y.; Kozhemyakina, R.V.; Oskina, I.N.; Plyusnina, I.Z. The effects of prolonged selection for behavior on the stress response and activity of the reproductive system of male grey mice (Rattus norvegicus). Russ. J. Genet. 2014, 50, 846–852. [Google Scholar] [CrossRef]
  64. Belyaev, D.K.; Borodin, P.M. The influence of stress on variation and its role in evolution. Biol. Zent. 1982, 100, 705–714. [Google Scholar]
  65. Kolosova, N.G.; Stefanova, N.A.; Korbolina, E.E.; Fursova, A.Z.; Kozhevnikova, O.S. Senescence-accelerated OXYS rats: A genetic model of premature aging and age-related diseases. Adv. Gerontol. 2014, 27, 336–340. [Google Scholar] [CrossRef]
  66. Stefanova, N.A.; Kozhevnikova, O.S.; Vitovtov, A.O.; Maksimova, K.Y.; Logvinov, S.V.; Rudnitskaya, E.A.; Korbolina, E.E.; Muraleva, N.A.; Kolosova, N.G. Senescence-accelerated OXYS rats: A model of age-related cognitive decline with relevance to abnormalities in Alzheimer disease. Cell Cycle 2014, 13, 898–909. [Google Scholar] [CrossRef] [PubMed]
  67. Devyatkin, V.A.; Redina, O.E.; Muraleva, N.A.; Kolosova, N.G. Single-nucleotide polymorphisms (SNPs) both associated with hypertension and contributing to accelerated-senescence traits in OXYS rats. Int. J. Mol. Sci. 2020, 21, 3542. [Google Scholar] [CrossRef] [PubMed]
  68. Devyatkin, V.A.; Redina, O.E.; Kolosova, N.G.; Muraleva, N.A. Single-nucleotide polymorphisms associated with the senescence-accelerated phenotype of OXYS rats: A focus on Alzheimer’s disease-like and age-related-macular-degeneration-like pathologies. J. Alzheimer’s Dis. 2020, 73, 1167–1183. [Google Scholar] [CrossRef] [PubMed]
  69. Lu, Z. PubMed and beyond: A survey of web tools for searching biomedical literature. Database 2011, 2011, baq036. [Google Scholar] [CrossRef] [PubMed]
  70. Vasiliev, G.; Chadaeva, I.; Rasskazov, D.; Ponomarenko, P.; Sharypova, E.; Drachkova, I.; Bogomolov, A.; Savinkova, L.; Ponomarenko, M.; Kolchanov, N.; et al. A bioinformatics model of human diseases on the basis of differentially expressed genes (of domestic versus wild animals) that are orthologs of human genes associated with reproductive-potential changes. Int. J. Mol. Sci. 2021, 22, 2346. [Google Scholar] [CrossRef] [PubMed]
  71. Klimova, N.V.; Oshchepkova, E.; Chadaeva, I.; Sharypova, E.; Ponomarenko, P.; Drachkova, I.; Rasskazov, D.; Oshchepkov, D.; Ponomarenko, M.; Savinkova, L.; et al. Disruptive selection of human immunostimulatory and immunosuppressive genes both provokes and prevents rheumatoid arthritis, respectively, as a self-domestication syndrome. Front. Genet. 2021, 12, 610774. [Google Scholar] [CrossRef] [PubMed]
  72. Chadaeva, I.; Ponomarenko, P.; Kozhemyakina, R.; Suslov, V.; Bogomolov, A.; Klimova, N.; Shikhevich, S.; Savinkova, L.; Oshchepkov, D.; Kolchanov, N.A.; et al. Domestication explains two-thirds of differential-gene-expression variance between domestic and wild animals; the remaining one-third reflects intraspecific and interspecific variation. Animals 2021, 11, 2667. [Google Scholar] [CrossRef] [PubMed]
  73. Hecht, K.; Hai, N.V.; Hecht, T.; Moritz, V.; Woossmann, H. Correlations between hippocampus function and stressed learning and their effect on cerebro-visceral regulation processes. Acta Biol. Med. Ger. 1976, 35, 35–45. [Google Scholar] [PubMed]
  74. Plyusnina, I.; Oskina, I. Behavioral and adrenocortical responses to open-field test in rats selected for reduced aggressiveness toward humans. Physiol. Behav. 1997, 61, 381–385. [Google Scholar] [CrossRef]
  75. Sayers, E.W.; Beck, J.; Bolton, E.E.; Bourexis, D.; Brister, J.R.; Canese, K.; Comeau, D.C.; Funk, K.; Kim, S.; Klimke, W.; et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2021, 49, D10–D17. [Google Scholar] [CrossRef]
  76. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
  77. Hammer, O.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
  78. McNeil, J.B.; Jackson, K.E.; Wang, C.; Siew, E.D.; Vincz, A.J.; Shaver, C.M.; Bastarache, J.A.; Ware, L.B. Linear association between hypoalbuminemia and increased risk of acute respiratory distress syndrome in critically ill adults. Crit Care Explor. 2021, 3, e0527. [Google Scholar] [CrossRef]
  79. Facciorusso, A.; Nacchiero, M.C.; Rosania, R.; Laonigro, G.; Longo, N.; Panella, C.; Ierardi, E. The use of human albumin for the treatment of ascites in patients with liver cirrhosis: Item of safety, facts, controversies and perspectives. Curr. Drug Saf. 2011, 6, 267–274. [Google Scholar] [CrossRef] [PubMed]
  80. Vassiliou, A.G.; Keskinidou, C.; Kotanidou, A.; Frantzeskaki, F.; Dimopoulou, I.; Langleben, D.; Orfanos, S.E. Knockdown of bone morphogenetic protein type II receptor leads to decreased aquaporin 1 expression and function in human pulmonary microvascular endothelial cells. Can. J. Physiol. Pharmacol. 2020, 98, 834–839. [Google Scholar] [CrossRef] [PubMed]
  81. Schuoler, C.; Haider, T.J.; Leuenberger, C.; Vogel, J.; Ostergaard, L.; Kwapiszewska, G.; Kohler, M.; Gassmann, M.; Huber, L.C.; Brock, M. Aquaporin 1 controls the functional phenotype of pulmonary smooth muscle cells in hypoxia-induced pulmonary hypertension. Basic Res. Cardiol. 2017, 112, 30. [Google Scholar] [CrossRef] [PubMed]
  82. Wang, C.Y.; Shahi, P.; Huang, J.T.; Phan, N.N.; Sun, Z.; Lin, Y.C.; Lai, M.D.; Werb, Z. Systematic analysis of the achaete-scute complex-like gene signature in clinical cancer patients. Mol. Clin. Oncol. 2017, 6, 7–18. [Google Scholar] [CrossRef] [PubMed]
  83. Martin, T.G.; Tawfik, S.; Moravec, C.S.; Pak, T.R.; Kirk, J.A. BAG3 expression and sarcomere localization in the human heart are linked to HSF-1 and are differentially affected by sex and disease. Am. J. Physiol. Heart Circ. Physiol. 2021, 320, H2339–H2350. [Google Scholar] [CrossRef] [PubMed]
  84. Derosa, G.; Maffioli, P.; Rosati, A.; Basile, A.; D’Angelo, A.; Romano, D.; Sahebkar, A.; Falco, A.; Turco, M.C. Evaluation of BAG3 levels in healthy subjects, hypertensive patients, and hypertensive diabetic patients. J. Cell. Physiol. 2018, 3, 1791–1795. [Google Scholar] [CrossRef]
  85. Wang, Y.P.; Huang, L.Y.; Sun, W.M.; Zhang, Z.Z.; Fang, J.Z.; Wei, B.F.; Wu, B.H.; Han, Z.G. Insulin receptor tyrosine kinase substrate activates EGFR/ERK signalling pathway and promotes cell proliferation of hepatocellular carcinoma. Cancer Lett. 2013, 337, 96–106. [Google Scholar] [CrossRef] [PubMed]
  86. Park, J.S.; Pierorazio, P.M.; Lee, J.H.; Lee, H.J.; Lim, Y.S.; Jang, W.S.; Kim, J.; Lee, S.H.; Rha, K.H.; Cho, N.H.; et al. Gene expression analysis of aggressive clinical T1 stage clear cell renal cell carcinoma for identifying potential diagnostic and prognostic biomarkers. Cancers 2020, 12, 222. [Google Scholar] [CrossRef]
  87. Stojanovic, M.; Goldner, B.; Ivkovic, D. Renal cell carcinoma and arterial hypertension. Clin. Exp. Nephrol. 2009, 13, 295–299. [Google Scholar] [CrossRef]
  88. Han, F.; Zhao, H.; Lu, J.; Yun, W.; Yang, L.; Lou, Y.; Su, D.; Chen, X.; Zhang, S.; Jin, H.; et al. Anti-Tumor effects of BDH1 in acute myeloid leukemia. Front. Oncol. 2021, 11, 694594. [Google Scholar] [CrossRef]
  89. Camerino, M.; Giacobino, D.; Manassero, L.; Iussich, S.; Riccardo, F.; Cavallo, F.; Tarone, L.; Olimpo, M.; Lardone, E.; Martano, M.; et al. Prognostic impact of bone invasion in canine oral malignant melanoma treated by surgery and anti-CSPG4 vaccination: A retrospective study on 68 cases (2010–2020). Vet. Comp. Oncol. 2021, 20, 189–197. [Google Scholar] [CrossRef]
  90. El-Qushayri, A.E.; Benmelouka, A.Y.; Salman, S.; Nardone, B. Melanoma and hypertension, is there an association? A U.S. population based study. Ital. J. Dermatol. Venerol. 2021. [Google Scholar] [CrossRef]
  91. Damour, A.; Garcia, M.; Seneschal, J.; Leveque, N.; Bodet, C. Eczema herpeticum: Clinical and pathophysiological aspects. Clin. Rev. Allergy Immunol. 2020, 59, 1–18. [Google Scholar] [CrossRef] [PubMed]
  92. Ohtani, M.; Nishimura, T. Sulfur-containing amino acids in aged garlic extract inhibit inflammation in human gingival epithelial cells by suppressing intercellular adhesion molecule-1 expression and IL-6 secretion. Biomed. Rep. 2020, 12, 99–108. [Google Scholar] [CrossRef] [PubMed]
  93. Liu, R.; Zhang, Z.; Liu, H.; Hou, P.; Lang, J.; Wang, S.; Yan, H.; Li, P.; Huang, Z.; Wu, H.; et al. Human β-defensin 2 is a novel opener of Ca2+-activated potassium channels and induces vasodilation and hypotension in monkeys. Hypertension 2013, 62, 415–425. [Google Scholar] [CrossRef] [PubMed]
  94. He, L.; Yang, Y.; Chen, J.; Zou, P.; Li, J. Transcriptional activation of ENPP2 by FoxO4 protects cardiomyocytes from doxorubicin-induced toxicity. Mol. Med. Rep. 2021, 24, 668. [Google Scholar] [CrossRef]
  95. Matsumura, N.; Zordoky, B.N.; Robertson, I.M.; Hamza, S.M.; Parajuli, N.; Soltys, C.M.; Beker, D.L.; Grant, M.K.; Razzoli, M.; Bartolomucci, A.; et al. Co-administration of resveratrol with doxorubicin in young mice attenuates detrimental late-occurring cardiovascular changes. Cardiovasc. Res. 2018, 114, 1350–1359. [Google Scholar] [CrossRef] [PubMed]
  96. Xu, X.Y.; Guo, W.J.; Pan, S.H.; Zhang, Y.; Gao, F.L.; Wang, J.T.; Zhang, S.; Li, H.Y.; Wang, R.; Zhang, X. TILRR (FREM1 isoform 2) is a prognostic biomarker correlated with immune infiltration in breast cancer. Aging 2020, 12, 19335–19351. [Google Scholar] [CrossRef]
  97. Li, H.N.; Li, X.R.; Lv, Z.T.; Cai, M.M.; Wang, G.; Yang, Z.F. Elevated expression of FREM1 in breast cancer indicates favorable prognosis and high-level immune infiltration status. Cancer Med. 2020, 9, 9554–9570. [Google Scholar] [CrossRef]
  98. Wang, S.; Zhu, G.; Jiang, D.; Rhen, J.; Li, X.; Liu, H.; Lyu, Y.; Tsai, P.; Rose, Y.; Nguyen, T.; et al. Reduced Notch1 cleavage promotes the development of pulmonary hypertension. Hypertension 2021, 79, 79–92. [Google Scholar] [CrossRef]
  99. Zhou, C.; Yu, J.; Wang, M.; Yang, J.; Xiong, H.; Huang, H.; Wu, D.; Hu, S.; Wang, Y.; Chen, X.Z.; et al. Identification of glycerol-3-phosphate dehydrogenase 1 as a tumour suppressor in human breast cancer. Oncotarget 2017, 8, 101309–101324. [Google Scholar] [CrossRef]
  100. Azad, G.K.; Singh, V.; Thakare, M.J.; Baranwal, S.; Tomar, R.S. Mitogen-activated protein kinase Hog1 is activated in response to curcumin exposure in the budding yeast Saccharomyces cerevisiae. BMC Microbiol. 2014, 14, 317. [Google Scholar] [CrossRef]
  101. Kim, Y.B.; Kim, Y.S.; Kim, W.B.; Shen, F.Y.; Lee, S.W.; Chung, H.J.; Kim, J.S.; Han, H.C.; Colwell, C.S.; Kim, Y.I. GABAergic excitation of vasopressin neurons: Possible mechanism underlying sodium-dependent hypertension. Circ. Res. 2013, 113, 1296–1307. [Google Scholar] [CrossRef]
  102. Triantafyllou, A.I.; Vyssoulis, G.P.; Karpanou, E.A.; Karkalousos, P.L.; Triantafyllou, E.A.; Aessopos, A.; Farmakis, D.T. Impact of β-thalassemia trait carrier state on cardiovascular risk factors and metabolic profile in patients with newly diagnosed hypertension. J. Hum. Hypertens. 2014, 28, 328–332. [Google Scholar] [CrossRef] [PubMed]
  103. Zheng, H.; Wei, X.C.; Yu, T.; Lei, Q. Anesthesia of a high-altitude area inhabitant who underwent aortic dissection emergency surgery in a low-altitude area. J. Int. Med. Res. 2020, 48, 300060520979871. [Google Scholar] [CrossRef] [PubMed]
  104. Chen, M.; Li, M.H.; Zhang, N.; Sun, W.W.; Wang, H.; Wang, Y.A.; Zhao, Y.; Wei, W. Pro-angiogenic effect of exosomal microRNA-103a in mice with rheumatoid arthritis via the downregulation of hepatocyte nuclear factor 4 alpha and activation of the JAK/STAT3 signaling pathway. J. Biol. Regul. Homeost Agents 2021, 35, 629–640. [Google Scholar] [PubMed]
  105. Argnani, L.; Zanetti, A.; Carrara, G.; Silvagni, E.; Guerrini, G.; Zambon, A.; Scire, C.A. Rheumatoid arthritis and cardiovascular risk: Retrospective matched-cohort analysis based on the RECORD study of the italian society for rheumatology. Front. Med. 2021, 8, 745601. [Google Scholar] [CrossRef] [PubMed]
  106. Ni, Z.; Lu, W.; Li, Q.; Han, C.; Yuan, T.; Sun, N.; Shi, Y. Analysis of the HNF4A isoform-regulated transcriptome identifies CCL15 as a downstream target in gastric carcinogenesis. Cancer Biol. Med. 2021, 18, 530–546. [Google Scholar] [CrossRef] [PubMed]
  107. Sejourne, J.; Llaneza, D.; Kuti, O.J.; Page, D.T. Social behavioral deficits coincide with the onset of seizure susceptibility in mice lacking serotonin receptor 2c. PLoS ONE 2015, 10, e0136494. [Google Scholar] [CrossRef] [PubMed]
  108. Veeramachaneni, G.K.; Thunuguntla, V.B.S.C.; Bhaswant, M.; Mathai, M.L.; Bondili, J.S. Pharmacophore directed screening of agonistic natural molecules showing affinity to 5HT2C receptor. Biomolecules 2019, 9, 556. [Google Scholar] [CrossRef] [PubMed]
  109. Kelm-Nelson, C.A.; Gammie, S. Gene expression within the periaqueductal gray is linked to vocal behavior and early-onset parkinsonism in Pink1 knockout rats. BMC Genom. 2020, 21, 625. [Google Scholar] [CrossRef]
  110. Shin, N.Y.; Park, Y.W.; Yoo, S.W.; Yoo, J.Y.; Choi, Y.; Jang, J.; Ahn, K.J.; Kim, B.S.; Kim, J.S. Adverse effects of hypertension, supine hypertension, and perivascular space on cognition and motor function in PD. NPJ Parkinsons Dis. 2021, 7, 69. [Google Scholar] [CrossRef] [PubMed]
  111. Zhao, Z.L.; Du, S.; Shen, S.X.; Luo, P.; Ding, S.K.; Wang, G.G.; Wang, L.X. Biomarkers screening for viral myocarditis through proteomics analysis of plasma exosomes. Zhonghua Yi Xue Za Zhi (Chin. Med. J.) 2019, 99, 343–348. [Google Scholar]
  112. Fox, S.E.; Falgout, L.; Vander Heide, R.S. COVID-19 myocarditis: Quantitative analysis of the inflammatory infiltrate and a proposed mechanism. Cardiovasc. Pathol. 2021, 54, 107361. [Google Scholar] [CrossRef] [PubMed]
  113. Karo-Atar, D.; Moshkovits, I.; Eickelberg, O.; Konigshoff, M.; Munitz, A. Paired immunoglobulin-like receptor-B inhibits pulmonary fibrosis by suppressing profibrogenic properties of alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 2013, 48, 456–464. [Google Scholar] [CrossRef] [PubMed]
  114. Huang, J.; Burke, P.S.; Cung, T.D.; Pereyra, F.; Toth, I.; Walker, B.D.; Borges, L.; Lichterfeld, M.; Yu, X.G. Leukocyte immunoglobulin-like receptors maintain unique antigen-presenting properties of circulating myeloid dendritic cells in HIV-1-infected elite controllers. J. Virol. 2010, 84, 9463–9471. [Google Scholar] [CrossRef][Green Version]
  115. Kumar, A.; Mahajan, A.; Salazar, E.A.; Pruitt, K.; Guzman, C.A.; Clauss, M.A.; Almodovar, S.; Dhillon, N.K. Impact of human immunodeficiency virus on pulmonary vascular disease. Glob. Cardiol. Sci. Pract. 2021, 2021, e202112. [Google Scholar] [CrossRef]
  116. Sakamoto, S.; Matsuura, K.; Masuda, S.; Hagiwara, N.; Shimizu, T. Heart-derived fibroblasts express LYPD-1 and negatively regulate angiogenesis in rat. Regen. Ther. 2020, 15, 27–33. [Google Scholar] [CrossRef]
  117. Kumar, N.; Verma, R.; Lohana, P.; Lohana, A.; Ramphul, K. Acute myocardial infarction in COVID-19 patients. A review of cases in the literature. Arch. Med. Sci. Atheroscler Dis. 2021, 6, e169–e175. [Google Scholar] [CrossRef]
  118. Matsushita, Y.; Furukawa, T.; Kasanuki, H.; Nishibatake, M.; Kurihara, Y.; Ikeda, A.; Kamatani, N.; Takeshima, H.; Matsuoka, R. Mutation of junctophilin type 2 associated with hypertrophic cardiomyopathy. J. Hum. Genet. 2007, 52, 543–548. [Google Scholar] [CrossRef]
  119. Sridharan, A.; Maron, M.S.; Carrick, R.T.; Madias, C.A.; Huang, D.; Cooper, C.; Drummond, J.; Maron, B.J.; Rowin, E.J. Impact of comorbidities on atrial fibrillation and sudden cardiac death in hypertrophic cardiomyopathy. J. Cardiovasc. Electrophysiol. 2021, 33, 20–29. [Google Scholar] [CrossRef]
  120. Rozanski, A.; Takano, A.P.; Kato, P.N.; Soares, A.G.; Lellis-Santos, C.; Campos, J.C.; Ferreira, J.C.; Barreto-Chaves, M.L.; Moriscot, A.S. M-protein is down-regulated in cardiac hypertrophy driven by thyroid hormone in rats. Mol. Endocrinol. 2013, 27, 2055–2065. [Google Scholar] [CrossRef] [PubMed]
  121. Grabowski, K.; Herlan, L.; Witten, A.; Qadri, F.; Eisenreich, A.; Lindner, D.; Schadlich, M.; Schulz, A.; Subrova, J.; Mhatre, K.N.; et al. Cpxm2 as a novel candidate for cardiac hypertrophy and failure in hypertension. Hypertens. Res. 2021, 45, 292–307. [Google Scholar] [CrossRef] [PubMed]
  122. Zeng, Y.; Du, X.; Yao, X.; Qiu, Y.; Jiang, W.; Shen, J.; Li, L.; Liu, X. Mechanism of cell death of endothelial cells regulated by mechanical forces. J. Biomech. 2021, 131, 110917. [Google Scholar] [CrossRef] [PubMed]
  123. Ashton, K.J.; Tupicoff, A.; Williams-Pritchard, G.; Kiessling, C.J.; See Hoe, L.E.; Headrick, J.P.; Peart, J.N. Unique transcriptional profile of sustained ligand-activated preconditioning in pre- and post-ischemic myocardium. PLoS ONE 2013, 8, e72278. [Google Scholar] [CrossRef] [PubMed]
  124. Sekino, Y.; Oue, N.; Mukai, S.; Shigematsu, Y.; Goto, K.; Sakamoto, N.; Sentani, K.; Hayashi, T.; Teishima, J.; Matsubara, A.; et al. Protocadherin B9 promotes resistance to bicalutamide and is associated with the survival of prostate cancer patients. Prostate 2019, 79, 234–242. [Google Scholar] [CrossRef]
  125. Gabbert, L.; Dilling, C.; Meybohm, P.; Burek, M. Deletion of protocadherin gamma C3 induces phenotypic and functional changes in brain microvascular endothelial cells in vitro. Front. Pharmacol. 2020, 11, 590144. [Google Scholar] [CrossRef]
  126. Wang, H.L.; Zhang, C.L.; Qiu, Y.M.; Chen, A.Q.; Li, Y.N.; Hu, B. Dysfunction of the blood-brain barrier in cerebral microbleeds: From bedside to bench. Aging Dis. 2021, 12, 1898–1919. [Google Scholar] [CrossRef]
  127. Du, J.; Dong, Y.; Li, Y. Identification and prognostic value exploration of cyclophosphamide (cytoxan)-centered chemotherapy response-associated genes in breast cancer. DNA Cell Biol. 2021, 40, 1356–1368. [Google Scholar] [CrossRef]
  128. Bloodgood, D.W.; Hardaway, J.A.; Stanhope, C.M.; Pati, D.; Pina, M.M.; Neira, S.; Desai, S.; Boyt, K.M.; Palmiter, R.D.; Kash, T.L. Kappa opioid receptor and dynorphin signaling in the central amygdala regulates alcohol intake. Mol. Psychiatry 2021, 26, 2187–2199. [Google Scholar] [CrossRef]
  129. Uchiyama, M.; Mizukami, S.; Arima, K.; Nishimura, T.; Tomita, Y.; Abe, Y.; Tanaka, N.; Honda, Y.; Goto, H.; Hasegawa, M.; et al. Association between serum 25-hydroxyvitamin D and physical performance measures in middle-aged and old Japanese men and women: The Unzen study. PLoS ONE 2021, 16, e0261639. [Google Scholar] [CrossRef]
  130. Landrum, M.; Lee, J.; Riley, G.; Jang, W.; Rubinstein, W.; Church, D.; Maglott, D. ClinVar: Public archive of relationships among sequence variation and human phenotype. Nucleic Acids Res. 2014, 42, D980–D985. [Google Scholar] [CrossRef]
  131. Elavarasi, A.; Dash, D.; Tripathi, M.; Bhatia, R. Cerebellar ataxia and neuropathy as presenting features of hepatitis-B related cirrhosis and portal hypertension. BMJ Case Rep. 2017, 2017, bcr2017221912. [Google Scholar] [CrossRef]
  132. Miki, Y.; Kidoguchi, Y.; Sato, M.; Taketomi, Y.; Taya, C.; Muramatsu, K.; Gelb, M.H.; Yamamoto, K.; Murakami, M. Dual roles of group iid phospholipase A2 in inflammation and cancer. J. Biol. Chem. 2016, 291, 15588–155601. [Google Scholar] [CrossRef] [PubMed]
  133. Karpinska-Mirecka, A.; Bartosinska, J.; Krasowska, D. The impact of hypertension, diabetes, lipid disorders, overweight/obesity and nicotine dependence on health-related quality of life and psoriasis severity in psoriatic patients receiving systemic conventional and biological treatment. Int. J. Environ. Res. Public Health 2021, 18, 13167. [Google Scholar] [CrossRef] [PubMed]
  134. Htwe, Y.M.; Wang, H.; Belvitch, P.; Meliton, L.; Bandela, M.; Letsiou, E.; Dudek, S.M. Group V phospholipase A2 mediates endothelial dysfunction and acute lung injury caused by methicillin-resistant Staphylococcus Aureus. Cells 2021, 10, 1731. [Google Scholar] [CrossRef] [PubMed]
  135. Launay, J.M.; Herve, P.; Callebert, J.; Mallat, Z.; Collet, C.; Doly, S.; Belmer, A.; Diaz, S.L.; Hatia, S.; Cote, F.; et al. Serotonin 5-HT2B receptors are required for bone-marrow contribution to pulmonary arterial hypertension. Blood 2012, 119, 1772–1780. [Google Scholar] [CrossRef] [PubMed]
  136. Wu, C.; Su, J.; Wang, X.; Wang, J.; Xiao, K.; Li, Y.; Xiao, Q.; Ling, M.; Xiao, Y.; Qin, C.; et al. Overexpression of the phospholipase A2 group V gene in glioma tumors is associated with poor patient prognosis. Cancer Manag. Res. 2019, 11, 3139–3152. [Google Scholar] [CrossRef]
  137. Li, B.; Yang, H.; Shen, B.; Huang, J.; Qin, Z. Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 increases cellular proliferation and colony formation capacity in lung cancer via activation of E2F transcription factor 1. Oncol. Lett. 2021, 22, 851. [Google Scholar] [CrossRef]
  138. Li, J.; Lam, A.S.M.; Yau, S.T.Y.; Yiu, K.K.L.; Tsoi, K.K.F. Antihypertensive treatments and risks of lung Cancer: A large population-based cohort study in Hong Kong. BMC Cancer 2021, 21, 1202. [Google Scholar] [CrossRef]
  139. Tian, L.; Zhou, H.; Wang, G.; Wang, W.Y.; Li, Y.; Xue, X. The relationship between PLOD1 expression level and glioma prognosis investigated using public databases. PeerJ 2021, 9, e11422. [Google Scholar] [CrossRef]
  140. Mehta, M.B.; Shewale, S.V.; Sequeira, R.N.; Millar, J.S.; Hand, N.J.; Rader, D.J. Hepatic protein phosphatase 1 regulatory subunit 3B (Ppp1r3b) promotes hepatic glycogen synthesis and thereby regulates fasting energy homeostasis. J. Biol. Chem. 2017, 292, 10444–10454. [Google Scholar] [CrossRef]
  141. Oben, A.; Jauk, V.; Battarbee, A.; Longo, S.; Szychowski, J.; Tita, A.; Harper, L. Value of HbA1c in obese women with gestational diabetes. Am. J. Perinatol. 2021. [Google Scholar] [CrossRef] [PubMed]
  142. Panossian, A.; Seo, E.J.; Efferth, T. Novel molecular mechanisms for the adaptogenic effects of herbal extracts on isolated brain cells using systems biology. Phytomedicine 2018, 50, 257–284. [Google Scholar] [CrossRef] [PubMed]
  143. Tang, Y.; Fung, E.; Xu, A.; Lan, H.Y. C-reactive protein and ageing. Clin. Exp. Pharmacol. Physiol. 2017, 44, 9–14. [Google Scholar] [CrossRef] [PubMed]
  144. Touraine, P.; Martini, J.F.; Zafrani, B.; Durand, J.C.; Labaille, F.; Malet, C.; Nicolas, A.; Trivin, C.; Postel-Vinay, M.C.; Kuttenn, F.; et al. Increased expression of prolactin receptor gene assessed by quantitative polymerase chain reaction in human breast tumors versus normal breast tissues. J. Clin. Endocrinol. Metab. 1998, 83, 667–674. [Google Scholar] [CrossRef]
  145. Zhou, W.; Wang, Y.; Gao, H.; Jia, Y.; Xu, Y.; Wan, X.; Zhang, Z.; Yu, H.; Yan, S. Identification of key genes involved in pancreatic ductal adenocarcinoma with diabetes mellitus based on gene expression profiling analysis. Pathol. Oncol. Res. 2021, 27, 604730. [Google Scholar] [CrossRef]
  146. Zhao, C.Y.; Hua, C.H.; Li, C.H.; Zheng, R.Z.; Li, X.Y. High PYGL expression predicts poor prognosis in human gliomas. Front. Neurol. 2021, 12, 652931. [Google Scholar] [CrossRef]
  147. Xia, W.; Su, L.; Jiao, J. Cold-induced protein RBM3 orchestrates neurogenesis via modulating Yap mRNA stability in cold stress. J. Cell Biol. 2018, 217, 3464–3479. [Google Scholar] [CrossRef]
  148. Takahashi, Y.; Hori, M.; Shimoji, K.; Miyajima, M.; Akiyama, O.; Arai, H.; Aoki, S. Changes in delta ADC reflect intracranial pressure changes in craniosynostosis. Acta Radiol. Open 2017, 6, 2058460117728535. [Google Scholar] [CrossRef]
  149. Jogi, A.; Brennan, D.J.; Ryden, L.; Magnusson, K.; Ferno, M.; Stal, O.; Borgquist, S.; Uhlen, M.; Landberg, G.; Pahlman, S.; et al. Nuclear expression of the RNA-binding protein RBM3 is associated with an improved clinical outcome in breast cancer. Mod. Pathol. 2009, 22, 1564–1574. [Google Scholar] [CrossRef]
  150. Sarang, Z.; Saghy, T.; Budai, Z.; Ujlaky-Nagy, L.; Bedekovics, J.; Beke, L.; Mehes, G.; Nagy, G.; Ruhl, R.; Moise, A.R.; et al. Retinol saturase knock-out mice are characterized by impaired clearance of apoptotic cells and develop mild autoimmunity. Biomolecules 2019, 9, 737. [Google Scholar] [CrossRef]
  151. Martin Calderon, L.; Chaudhury, M.; Pope, J.E. Healthcare utilization and economic burden in systemic sclerosis: A systematic review. Rheumatology 2021, keab847. [Google Scholar] [CrossRef] [PubMed]
  152. Zhao, L.; Zhu, X.; Xia, M.; Li, J.; Guo, A.Y.; Zhu, Y.; Yang, X. Quercetin ameliorates gut microbiota dysbiosis that drives hypothalamic damage and hepatic lipogenesis in monosodium glutamate-induced abdominal obesity. Front. Nutr. 2021, 8, 671353. [Google Scholar] [CrossRef] [PubMed]
  153. Li, R.; Luo, S.Y.; Zuo, Z.G.; Yu, Z.; Chen, W.N.; Ye, Y.X.; Xia, M. Association between serum uric acid to creatinine ratio and metabolic syndrome based on community residents in Chashan town, Dongguan city. Zhonghua Yu Fang Yi Xue Za Zhi (Chin. J. Prev. Med.) 2021, 55, 1449–1455. [Google Scholar]
  154. Mei, J.; Hu, K.; Peng, X.; Wang, H.; Liu, C. Decreased expression of SLC16A12 mRNA predicts poor prognosis of patients with clear cell renal cell carcinoma. Medicine 2019, 98, e16624. [Google Scholar] [CrossRef]
  155. Liu, J.; Bao, J.; Zhang, W.; Li, Q.; Hou, J.; Wei, X.; Huang, Y. The potential of visceral adipose tissue in distinguishing clear cell renal cell carcinoma from renal angiomyolipoma with minimal fat. Cancer Manag. Res. 2021, 13, 8907–8914. [Google Scholar] [CrossRef]
  156. Zuercher, J.; Neidhardt, J.; Magyar, I.; Labs, S.; Moore, A.T.; Tanner, F.C.; Waseem, N.; Schorderet, D.F.; Munier, F.L.; Bhattacharya, S.; et al. Alterations of the 5’untranslated region of SLC16A12 lead to age-related cataract. Investig. Ophthalmol. Vis. Sci. 2010, 51, 3354–3361. [Google Scholar] [CrossRef]
  157. Ang, M.J.; Afshari, N.A. Cataract and systemic disease: A review. Clin. Exp. Ophthalmol. 2021, 49, 118–127. [Google Scholar] [CrossRef]
  158. Christensen, H.L.; Barbuskaite, D.; Rojek, A.; Malte, H.; Christensen, I.B.; Fuchtbauer, A.C.; Fuchtbauer, E.M.; Wang, T.; Praetorius, J.; Damkier, H.H. The choroid plexus sodium-bicarbonate cotransporter NBCe2 regulates mouse cerebrospinal fluid pH. J. Physiol. 2018, 596, 4709–4728. [Google Scholar] [CrossRef]
  159. Betz, M.V.; Nemec, K.B.; Zisman, A.L. Plant-based diets in kidney disease: Nephrology professionals’ perspective. J. Ren. Nutr. 2021. [Google Scholar] [CrossRef]
  160. Kant, S.; Stopa, E.G.; Johanson, C.E.; Baird, A.; Silverberg, G.D. Choroid plexus genes for CSF production and brain homeostasis are altered in Alzheimer’s disease. Fluids Barriers CNS 2018, 15, 34. [Google Scholar] [CrossRef]
  161. Coatl-Cuaya, H.; Tendilla-Beltran, H.; de Jesús-Vásquez, L.M.; Garces-Ramirez, L.; Gomez-Villalobos, M.J.; Flores, G. Losartan enhances cognitive and structural neuroplasticity impairments in spontaneously hypertensive rats. J. Chem. Neuroanat. 2021, 120, 102061. [Google Scholar] [CrossRef] [PubMed]
  162. Yuting, Y.; Lafeng, F.; Qiwei, H. Secreted modular calcium-binding protein 2 promotes high fat diet (HFD)-induced hepatic steatosis through enhancing lipid deposition, fibrosis and inflammation via targeting TGF-β1. Biochem. Biophys. Res. Commun. 2019, 509, 48–55. [Google Scholar] [CrossRef] [PubMed]
  163. Calvopina, D.A.; Lewindon, P.J.; Ramm, L.E.; Noble, C.; Hartel, G.F.; Leung, D.H.; Ramm, G.A. Gamma-glutamyl transpeptidase-to-platelet ratio as a biomarker of liver disease and hepatic fibrosis severity in paediatric cystic fibrosis. J. Cyst. Fibros. 2021. [Google Scholar] [CrossRef] [PubMed]
  164. Hyun, C.L.; Park, S.J.; Kim, H.S.; Song, H.J.; Kim, H.U.; Lee, C.; Lee, D.H.; Maeng, Y.H.; Kim, Y.S.; Jang, B. The intestinal stem cell marker SMOC2 is an independent prognostic marker associated with better survival in gastric cancer. Anticancer Res. 2021, 41, 3689–3698. [Google Scholar] [CrossRef] [PubMed]
  165. Gomez-Abenza, E.; Ibanez-Molero, S.; Garcia-Moreno, D.; Fuentes, I.; Zon, L.I.; Mione, M.C.; Cayuela, M.L.; Gabellini, C.; Mulero, V. Zebrafish modeling reveals that SPINT1 regulates the aggressiveness of skin cutaneous melanoma and its crosstalk with tumor immune microenvironment. J. Exp. Clin. Cancer Res. 2019, 38, 405. [Google Scholar] [CrossRef]
  166. Soffietti, R.; Ruda, R.; Mutani, R. Management of brain metastases. J. Neurol. 2002, 249, 1357–1369. [Google Scholar] [CrossRef]
  167. Huang, H.P.; Chang, M.H.; Chen, Y.T.; Hsu, H.Y.; Chiang, C.L.; Cheng, T.S.; Wu, Y.M.; Wu, M.Z.; Hsu, Y.C.; Shen, C.C.; et al. Persistent elevation of hepatocyte growth factor activator inhibitors in cholangiopathies affects liver fibrosis and differentiation. Hepatology 2012, 55, 161–172. [Google Scholar] [CrossRef]
  168. Takashima, Y.; Keino-Masu, K.; Yashiro, H.; Hara, S.; Suzuki, T.; van Kuppevelt, T.H.; Masu, M.; Nagata, M. Heparan sulfate 6-O-endosulfatases, Sulf1 and Sulf2, regulate glomerular integrity by modulating growth factor signaling. Am. J. Physiol. Renal Physiol. 2016, 310, F395–F408. [Google Scholar] [CrossRef]
  169. Saito, N.; Toyoda, M.; Ono, M.; Kondo, M.; Moriya, H.; Kimura, M.; Sawada, K.; Fukagawa, M. Regulation of blood pressure and phosphorylation of β1-integrin in renal tissue in a rat model of diabetic nephropathy. Tokai J. Exp. Clin. Med. 2021, 46, 172–179. [Google Scholar]
  170. Lee, H.Y.; Yeh, B.W.; Chan, T.C.; Yang, K.F.; Li, W.M.; Huang, C.N.; Ke, H.L.; Li, C.C.; Yeh, H.C.; Liang, P.I.; et al. Sulfatase-1 overexpression indicates poor prognosis in urothelial carcinoma of the urinary bladder and upper tract. Oncotarget 2017, 8, 47216–47229. [Google Scholar] [CrossRef]
  171. Chen, J.S.; Lu, C.L.; Huang, L.C.; Shen, C.H.; Chen, S.C. Chronic kidney disease is associated with upper tract urothelial carcinoma: A nationwide population-based cohort study in Taiwan. Medicine 2016, 95, e3255. [Google Scholar] [CrossRef] [PubMed]
  172. Clarke, W.T.; Edwards, B.; McCullagh, K.J.; Kemp, M.W.; Moorwood, C.; Sherman, D.L.; Burgess, M.; Davies, K.E. Syncoilin modulates peripherin filament networks and is necessary for large-calibre motor neurons. J. Cell Sci. 2010, 123, 2543–2552. [Google Scholar] [CrossRef] [PubMed]
  173. Silva, P.S.C.D.; Boing, A.F. Factors associated with leisure-time physical activity: Analysis of Brazilians with chronic diseases. Cien Saude Colet (Sci. Collect. Health) 2021, 26, 5727–5738. [Google Scholar] [CrossRef] [PubMed]
  174. Wang, D.; Deng, L.; Xu, X.; Ji, Y.; Jiao, Z. Elevated SYNC expression is associated with gastric tumorigenesis and infiltration of M2-polarized macrophages in the gastric tumor immune microenvironment. Genet. Test. Mol. Biomarkers 2021, 25, 236–246. [Google Scholar] [CrossRef]
  175. Hao, X.L.; Gao, L.Y.; Deng, X.J.; Han, F.; Chen, H.Q.; Jiang, X.; Liu, W.B.; Wang, D.D.; Chen, J.P.; Cui, Z.H.; et al. Identification of TC2N as a novel promising suppressor of PI3K-AKT signaling in breast cancer. Cell Death Dis. 2019, 10, 424. [Google Scholar] [CrossRef]
  176. Xu, J.; Ou, X.; Li, J.; Cai, Q.; Sun, K.; Ye, J.; Peng, J. Overexpression of TC2N is associated with poor prognosis in gastric cancer. J. Cancer. 2021, 12, 807–817. [Google Scholar] [CrossRef]
  177. Jeng, J.Y.; Harasztosi, C.; Carlton, A.J.; Corns, L.F.; Marchetta, P.; Johnson, S.L.; Goodyear, R.J.; Legan, K.P.; Ruttiger, L.; Richardson, G.P.; et al. MET currents and otoacoustic emissions from mice with a detached tectorial membrane indicate the extracellular matrix regulates Ca2+ near stereocilia. J. Physiol. 2021, 599, 2015–2036. [Google Scholar] [CrossRef]
  178. Frisina, R.D.; Wheeler, H.E.; Fossa, S.D.; Kerns, S.L.; Fung, C.; Sesso, H.D.; Monahan, P.O.; Feldman, D.R.; Hamilton, R.; Vaughn, D.J.; et al. Comprehensive audiometric analysis of hearing impairment and tinnitus after cisplatin-based chemotherapy in survivors of adult-onset cancer. J. Clin. Oncol. 2016, 34, 2712–2720. [Google Scholar] [CrossRef]
  179. Solares, C.A.; Edling, A.E.; Johnson, J.M.; Baek, M.J.; Hirose, K.; Hughes, G.B.; Tuohy, V.K. Murine autoimmune hearing loss mediated by CD4+ T cells specific for inner ear peptides. J. Clin. Investig. 2004, 113, 1210–1217. [Google Scholar] [CrossRef]
  180. Xu, Z.; Ruan, J.; Pan, L.; Chen, C. Candidate genes identified in systemic sclerosis-related pulmonary arterial hypertension were associated with immunity, inflammation, and cytokines. Cardiovasc. Ther. 2021, 2021, 6651009. [Google Scholar] [CrossRef]
  181. Kiermayer, C.; Northrup, E.; Schrewe, A.; Walch, A.; de Angelis, M.H.; Schoensiegel, F.; Zischka, H.; Prehn, C.; Adamski, J.; Bekeredjian, R.; et al. Heart-specific knockout of the mitochondrial thioredoxin reductase (Txnrd2) induces metabolic and contractile dysfunction in the aging myocardium. J. Am. Heart Assoc. 2015, 4, e002153. [Google Scholar] [CrossRef] [PubMed]
  182. Liang, J.; Zhu, R.; Yang, Y.; Li, R.; Hong, C.; Luo, C. A predictive model for dilated cardiomyopathy with pulmonary hypertension. ESC Heart Fail. 2021, 8, 4255–4264. [Google Scholar] [CrossRef] [PubMed]
  183. Mou, D.; Ding, D.; Yan, H.; Qin, B.; Dong, Y.; Li, Z.; Che, L.; Fang, Z.; Xu, S.; Lin, Y.; et al. Maternal supplementation of organic selenium during gestation improves sows and offspring antioxidant capacity and inflammatory status and promotes embryo survival. Food Funct. 2020, 11, 7748–7761. [Google Scholar] [CrossRef] [PubMed]
  184. Trinchese, G.; Cimmino, F.; Cavaliere, G.; Rosati, L.; Catapano, A.; Sorriento, D.; Murru, E.; Bernardo, L.; Pagani, L.; Bergamo, P.; et al. Heart mitochondrial metabolic flexibility and redox status are improved by donkey and human milk intake. Antioxidants 2021, 10, 1807. [Google Scholar] [CrossRef] [PubMed]
  185. Busceti, C.L.; Cotugno, M.; Bianchi, F.; Forte, M.; Stanzione, R.; Marchitti, S.; Battaglia, G.; Nicoletti, F.; Fornai, F.; Rubattu, S. Brain overexpression of uncoupling protein-2 (UCP2) delays renal damage and stroke occurrence in stroke-prone spontaneously hypertensive rats. Int. J. Mol. Sci. 2020, 21, 4289. [Google Scholar] [CrossRef] [PubMed]
  186. Kim, J.W.; Cardin, D.B.; Vaishampayan, U.N.; Kato, S.; Grossman, S.R.; Glazer, P.M.; Shyr, Y.; Ivy, S.P.; LoRusso, P.M. Clinical activity and safety of cediranib and olaparib combination in patients with metastatic pancreatic ductal adenocarcinoma without brca mutation. Oncologist 2021, 26, e1104–e1109. [Google Scholar] [CrossRef]
  187. Albert, F.W.; Somel, M.; Carneiro, M.; Aximu-Petri, A.; Halbwax, M.; Thalmann, O.; Blanco-Aguiar, J.A.; Plyusnina, I.Z.; Trut, L.; Villafuerte, R.; et al. A comparison of brain gene expression levels in domesticated and wild animals. PLoS Genet. 2012, 8, e1002962. [Google Scholar] [CrossRef]
  188. Sato, D.X.; Rafati, N.; Ring, H.; Younis, S.; Feng, C.; Blanco-Aguiar, J.A.; Rubin, C.J.; Villafuerte, R.; Hallbook, F.; Carneiro, M.; et al. Brain transcriptomics of wild and domestic rabbits suggests that changes in dopamine signaling and ciliary function contributed to evolution of tameness. Genome Biol. Evol. 2020, 12, 1918–1928. [Google Scholar] [CrossRef]
  189. Yang, X.; Zhang, H.; Shang, J.; Liu, G.; Xia, T.; Zhao, C.; Sun, G.; Dou, H. Comparative analysis of the blood transcriptomes between wolves and dogs. Anim. Genet. 2018, 49, 291–302. [Google Scholar] [CrossRef]
  190. Hekman, J.P.; Johnson, J.L.; Edwards, W.; Vladimirova, A.V.; Gulevich, R.G.; Ford, A.L.; Kharlamova, A.V.; Herbeck, Y.; Acland, G.M.; Raetzman, L.T.; et al. Anterior pituitary transcriptome suggests differences in ACTH release in tame and aggressive foxes. G3 2018, 8, 859–873. [Google Scholar] [CrossRef]
  191. Long, K.; Mao, K.; Che, T.; Zhang, J.; Qiu, W.; Wang, Y.; Tang, Q.; Ma, J.; Li, M.; Li, X. Transcriptome differences in frontal cortex between wild boar and domesticated pig. Anim. Sci. J. 2018, 89, 848–857. [Google Scholar] [CrossRef] [PubMed]
  192. Yang, Y.; Adeola, A.C.; Xie, H.B.; Zhang, Y.P. Genomic and transcriptomic analyses reveal selection of genes for puberty in Bama Xiang pigs. Zool. Res. 2018, 39, 424–430. [Google Scholar] [PubMed]
  193. Fallahshahroudi, A.; Lotvedt, P.; Belteky, J.; Altimiras, J.; Jensen, P. Changes in pituitary gene expression may underlie multiple domesticated traits in chickens. Heredity 2019, 122, 195–204. [Google Scholar] [CrossRef]
  194. Samet, H. A top-down quadtree traversal algorithm. IEEE Trans. Pattern Anal. Mach. Intell. 1985, 7, 94–98. [Google Scholar] [CrossRef] [PubMed]
  195. Sun, G.-L.; Shen, W.; Wen, J.-F. Triosephosphate Isomerase Genes in Two Trophic Modes of Euglenoids (Euglenophyceae) and Their Phylogenetic Analysis. J. Eukaryot. Microbiol. 2008, 55, 170–177. [Google Scholar] [CrossRef] [PubMed]
  196. Morozova, O.V.; Alekseeva, A.E.; Sashina, T.A.; Brusnigina, N.F.; Epifanova, N.V.; Kashnikov, A.U.; Zverev, V.V.; Novikova, N.A. Phylodynamics of G4P [8] and G2P [4] strains of rotavirus A isolated in Russia in 2017 based on full-genome analyses. Virus Genes 2020, 56, 537–545. [Google Scholar] [CrossRef] [PubMed]
  197. Hakizimana, J.N.; Yona, C.; Kamana, O.; Nauwynck, H.; Misinzo, G. African Swine Fever Virus Circulation between Tanzania and Neighboring Countries: A Systematic Review and Meta-Analysis. Viruses 2021, 13, 306. [Google Scholar] [CrossRef] [PubMed]
  198. Zhang, Y.; Katoh, T.K.; Finet, C.; Izumitani, H.F.; Toda, M.J.; Watabe, H.-A.; Katoh, T. Phylogeny and evolution of mycophagy in the Zygothrica genus group (Diptera: Drosophilidae). Mol. Phylogenetics Evol. 2021, 163, 107257. [Google Scholar] [CrossRef]
  199. Crowley, J.P.; Metzger, J.B.; Merrill, E.W.; Valeri, C.R. Whole blood viscosity in beta thalassemia minor. Ann. Clin. Lab. Sci. 1992, 22, 229–235. [Google Scholar]
  200. Philibert, C.; Bouillot, S.; Huber, P.; Faury, G. Protocadherin-12 deficiency leads to modifications in the structure and function of arteries in mice. Pathol. Biol. 2012, 60, 34–40. [Google Scholar] [CrossRef]
  201. Mukai, S.; Oue, N.; Oshima, T.; Imai, T.; Sekino, Y.; Honma, R.; Sakamoto, N.; Sentani, K.; Kuniyasu, H.; Egi, H.; et al. Overexpression of PCDHB9 promotes peritoneal metastasis and correlates with poor prognosis in patients with gastric cancer. J. Pathol. 2017, 243, 100–110. [Google Scholar] [CrossRef] [PubMed]
  202. Ponomarenko, M.; Rasskazov, D.; Chadaeva, I.; Sharypova, E.; Drachkova, I.; Oshchepkov, D.; Ponomarenko, P.; Savinkova, L.; Oshchepkova, E.; Nazarenko, M.; et al. Candidate SNP markers of atherogenesis significantly shifting the affinity of TATA-binding protein for human gene promoters show stabilizing natural selection as a sum of neutral drift accelerating atherogenesis and directional natural selection slowing it. Int. J. Mol. Sci. 2020, 21, 1045. [Google Scholar] [CrossRef] [PubMed]
  203. Ponomarenko, M.; Rasskazov, D.; Arkova, O.; Ponomarenko, P.; Suslov, V.; Savinkova, L.; Kolchanov, N. How to use SNP_TATA_Comparator to find a significant change in gene expression caused by the regulatory SNP of this gene’s promoter via a change in affinity of the TATA-binding protein for this promoter. Biomed. Res. Int. 2015, 2015, 359835. [Google Scholar] [CrossRef] [PubMed]
  204. Varzari, A.; Tudor, E.; Bodrug, N.; Corloteanu, A.; Axentii, E.; Deyneko, I.V. Age-specific association of CCL5 gene polymorphism with pulmonary tuberculosis: A case-control study. Genet. Test. Mol. Biomark. 2018, 22, 281–287. [Google Scholar] [CrossRef] [PubMed]
  205. Cho, S.N.; Choi, J.A.; Lee, J.; Son, S.H.; Lee, S.A.; Nguyen, T.D.; Choi, S.Y.; Song, C.H. Ang II-Induced hypertension exacerbates the pathogenesis of tuberculosis. Cells 2021, 10, 2478. [Google Scholar] [CrossRef] [PubMed]
  206. Haeussler, M.; Raney, B.; Hinrichs, A.; Clawson, H.; Zweig, A.; Karolchik, D.; Casper, J.; Speir, M.; Haussler, D.; Kent, W. Navigating protected genomics data with UCSC Genome Browser in a box. Bioinformatics 2015, 31, 764–766. [Google Scholar] [CrossRef] [PubMed]
  207. Stajich, J.E.; Block, D.; Boulez, K.; Brenner, S.E.; Chervitz, S.A.; Dagdigian, C.; Fuellen, G.; Gilbert, J.G.; Korf, I.; Lapp, H.; et al. The Bioperl toolkit: Perl modules for the life sciences. Genome Res. 2002, 12, 1611–1618. [Google Scholar] [CrossRef]
  208. Waardenberg, A.; Basset, S.; Bouveret, R.; Harvey, R. CompGO: An R package, for comparing and visualizing Gene Ontology enrichment differences between DNA binding experiments. BMC Bioinform. 2015, 16, 275. [Google Scholar] [CrossRef]
  209. Zerbino, D.; Wilder, S.; Johnson, N.; Juettemann, T.; Flicek, P. The Ensembl regulatory build. Genome Biol. 2015, 16, 56. [Google Scholar] [CrossRef]
  210. Day, I.N. dbSNP in the detail and copy number complexities. Hum. Mutat. 2010, 31, 2–4. [Google Scholar] [CrossRef]
  211. Martiney, J.A.; Cerami, A.; Slater, A.F. Inhibition of hemozoin formation in Plasmodium falciparum trophozoite extracts by heme analogs: Possible implication in the resistance to malaria conferred by the beta-thalassemia trait. Mol. Med. 1996, 2, 236–246. [Google Scholar] [CrossRef] [PubMed]
  212. Ponomarenko, P.; Savinkova, L.; Drachkova, I.; Lysova, M.; Arshinova, T.; Ponomarenko, M.; Kolchanov, N. A step-by-step model of TBP/TATA box binding allows predicting human hereditary diseases by single nucleotide polymorphism. Dokl. Biochem. Biophys. 2008, 419, 88–92. [Google Scholar] [CrossRef] [PubMed]
  213. Delgadillo, R.; Whittington, J.; Parkhurst, L.; Parkhurst, L. The TBP core domain in solution variably bends TATA sequences via a three-step binding mechanism. Biochemistry 2009, 48, 1801–1809. [Google Scholar] [CrossRef] [PubMed]
  214. Hahn, S.; Buratowski, S.; Sharp, P.; Guarente, L. Yeast TATA-binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl. Acad. Sci. USA 1989, 86, 5718–5722. [Google Scholar] [CrossRef]
  215. Karas, H.; Knuppel, R.; Schulz, W.; Sklenar, H.; Wingender, E. Combining structural analysis of DNA with search routines for the detection of transcription regulatory elements. Comput. Applic. Biosci. 1996, 12, 441–446. [Google Scholar] [CrossRef][Green Version]
  216. Ponomarenko, M.P.; Ponomarenko, J.V.; Frolov, A.S.; Podkolodny, N.L.; Savinkova, L.K.; Kolchanov, N.A.; Overton, G.C. Identification of sequence-dependent features correlating to activity of DNA sites interacting with proteins. Bioinformatics 1999, 15, 687–703. [Google Scholar] [CrossRef]
  217. Bucher, P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 1990, 212, 563–578. [Google Scholar] [CrossRef]
  218. Flatters, D.; Lavery, R. Sequence-dependent dynamics of TATA-Box binding sites. Biophys. J. 1998, 75, 372–381. [Google Scholar] [CrossRef][Green Version]
  219. Ponomarenko, P.M.; Suslov, V.V.; Savinkova, L.K.; Ponomarenko, M.P.; Kolchanov, N.A. A precise equilibrium equation for four steps of binding between TBP and TATA-box allows for the prediction of phenotypical expression upon mutation. Biophysics 2010, 55, 358–369. [Google Scholar] [CrossRef]
  220. Mogno, I.; Vallania, F.; Mitra, R.D.; and Cohen, B.A. TATA is a modular component of synthetic promoters. Genome Res. 2010, 20, 1391–1397. [Google Scholar] [CrossRef]
  221. Pugh, B. Purification of the human TATA-binding protein, TBP. Methods Mol. Biol. 1995, 37, 359–367. [Google Scholar]
  222. Savinkova, L.; Drachkova, I.; Arshinova, T.; Ponomarenko, P.; Ponomarenko, M.; Kolchanov, N. An experimental verification of the predicted effects of promoter TATA-box polymorphisms associated with human diseases on interactions between the TATA boxes and TATA-binding protein. PLoS ONE 2013, 8, e54626. [Google Scholar]
  223. Drachkova, I.; Savinkova, L.; Arshinova, T.; Ponomarenko, M.; Peltek, S.; Kolchanov, N. The mechanism by which TATA-box polymorphisms associated with human hereditary diseases influence interactions with the TATA-binding protein. Hum. Mutat. 2014, 35, 601–608. [Google Scholar] [CrossRef] [PubMed]
  224. Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
  225. Li, W.H.; Wu, C.I.; Luo, C.C. A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Mol. Biol. Evol. 1985, 2, 150–174. [Google Scholar] [PubMed]
  226. Oggenfuss, U.; Badet, T.; Wicker, T.; Hartmann, F.E.; Singh, N.K.; Abraham, L.; Karisto, P.; Vonlanthen, T.; Mundt, C.; McDonald, B.A.; et al. A population-level invasion by transposable elements triggers genome expansion in a fungal pathogen. eLife 2021, 10, e69249. [Google Scholar] [CrossRef] [PubMed]
  227. Kasowski, M.; Grubert, F.; Heffelfinger, C.; Hariharan, M.; Asabere, A.; Waszak, S.; Habegger, L.; Rozowsky, J.; Shi, M.; Urban, A.; et al. Variation in transcription factor binding among humans. Science 2010, 328, 232–235. [Google Scholar] [CrossRef]
  228. 1000 Genomes Project Consortium; Abecasis, G.; Auton, A.; Brooks, L.; DePristo, M.; Durbin, R.; Handsaker, R.; Kang, H.; Marth, G.; McVean, G.; et al. An integrated map of genetic variation from 1.092 human genomes. Nature 2012, 491, 56–65. [Google Scholar]
  229. Haldane, J.B.S. The cost of natural selection. J. Genet. 1957, 55, 511–524. [Google Scholar] [CrossRef]
  230. Kimura, M. Evolutionary rate at the molecular level. Nature 1968, 217, 624–626. [Google Scholar] [CrossRef]
  231. Hill, A.E.; Plyler, Z.E.; Tiwari, H.; Patki, A.; Tully, J.P.; McAtee, C.W.; Moseley, L.A.; Sorscher, E.J. Longevity and plasticity of CFTR provide an argument for noncanonical SNP organization in hominid DNA. PLoS ONE 2014, 9, e109186. [Google Scholar] [CrossRef] [PubMed][Green Version]
  232. Naumenko, E.; Popova, N.; Nikulina, E.; Dygalo, N.; Shishkina, G.; Borodin, P.; Markel, A. Behavior, adrenocortical activity, and brain monoamines in Norway rats selected for reduced aggressiveness towards man. Pharmacol. Biochem. Behav. 1989, 33, 85–91. [Google Scholar] [CrossRef]
  233. Paxinos, G.; Watson, C.R. The Rat Brain in Stereotaxic Coordinates, 7th ed.; Academic Press: London, UK, 2013; p. 472. [Google Scholar]
  234. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  235. Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, 36. [Google Scholar] [CrossRef]
  236. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
  237. Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
  238. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  239. Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, 106. [Google Scholar] [CrossRef]
  240. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
  241. Tian, L.; Chen, Y.; Wang, D.W.; Liu, X.H. Validation of reference genes via qRT-PCR in multiple conditions in brandt’s voles, lasiopodomys brandtii. Animals 2021, 11, 897. [Google Scholar] [CrossRef]
  242. Zamani, A.; Powell, K.L.; May, A.; Semple, B.D. Validation of reference genes for gene expression analysis following experimental traumatic brain injury in a pediatric mouse model. Brain Res. Bull. 2020, 156, 43–49. [Google Scholar] [CrossRef] [PubMed]
  243. Gholami, K.; Loh, S.Y.; Salleh, N.; Lam, S.K.; Hoe, S.Z. Selection of suitable endogenous reference genes for qPCR in kidney and hypothalamus of rats under testosterone influence. PLoS ONE 2017, 12, e0176368. [Google Scholar] [CrossRef] [PubMed]
  244. Penning, L.C.; Vrieling, H.E.; Brinkhof, B.; Riemers, F.M.; Rothuizen, J.; Rutteman, G.R.; Hazewinkel, H.A. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues. Vet. Immunol. Immunopathol. 2007, 120, 212–222. [Google Scholar] [CrossRef] [PubMed]
Figure 1. qPCR-based selective verification of the DEGs identified by RNA-Seq in this work in the hippocampus of tame versus aggressive rats. Legend: (a) in tame male adult rats (white bars) versus aggressive ones (grey bars), both DEGs examined (i.e., Ascl3 and Defb17) are statistically significantly overexpressed in the hippocampus (here, bar height (i.e., mean), error bars (i.e., standard error of the mean [SEM]), and asterisks denote statistical significance at p < 0.05 according to both the nonparametric Mann–Whitney U-test and parametric Fisher’s Z-test). Asterisk (symbol “*”), statistically significant at p < 0.05. (b) Statistically significant correlations between the relative expression levels of the two selected DEGs and three reference genes (i.e., B2m (β-2-microglobulin), Ppia (peptidylprolyl isomerase A), and Rpl30 (ribosomal protein L30)) in the hippocampus of tame versus aggressive rats (open circles), as measured experimentally by RNA-Seq (X-axis) and qPCR (Y-axis) and presented on the log2 scale (see “Materials and Methods”). Dashed and dash-and-dot lines denote linear regression and boundaries of its 95% confidence interval calculated using Statistica software (StatsoftTM, Tulsa, OK, USA). r, R, τ, and p are coefficients of Pearson’s linear correlation, Spearman’s rank correlation, Kendall’s rank correlation, and their p values (statistical significance), respectively.
Figure 1. qPCR-based selective verification of the DEGs identified by RNA-Seq in this work in the hippocampus of tame versus aggressive rats. Legend: (a) in tame male adult rats (white bars) versus aggressive ones (grey bars), both DEGs examined (i.e., Ascl3 and Defb17) are statistically significantly overexpressed in the hippocampus (here, bar height (i.e., mean), error bars (i.e., standard error of the mean [SEM]), and asterisks denote statistical significance at p < 0.05 according to both the nonparametric Mann–Whitney U-test and parametric Fisher’s Z-test). Asterisk (symbol “*”), statistically significant at p < 0.05. (b) Statistically significant correlations between the relative expression levels of the two selected DEGs and three reference genes (i.e., B2m (β-2-microglobulin), Ppia (peptidylprolyl isomerase A), and Rpl30 (ribosomal protein L30)) in the hippocampus of tame versus aggressive rats (open circles), as measured experimentally by RNA-Seq (X-axis) and qPCR (Y-axis) and presented on the log2 scale (see “Materials and Methods”). Dashed and dash-and-dot lines denote linear regression and boundaries of its 95% confidence interval calculated using Statistica software (StatsoftTM, Tulsa, OK, USA). r, R, τ, and p are coefficients of Pearson’s linear correlation, Spearman’s rank correlation, Kendall’s rank correlation, and their p values (statistical significance), respectively.
Ijms 23 02835 g001
Figure 2. A step-by-step diagram of verification of the obtained results on the hypertensive versus normotensive animals examined in this work with respect to all the transcriptomes (that we could find) of hypertensive versus normotensive patients (Table 5). Legend: see the footnote of Table 2; PC1 and PC2: principal components calculated using the PAST4.04 software [77].
Figure 2. A step-by-step diagram of verification of the obtained results on the hypertensive versus normotensive animals examined in this work with respect to all the transcriptomes (that we could find) of hypertensive versus normotensive patients (Table 5). Legend: see the footnote of Table 2; PC1 and PC2: principal components calculated using the PAST4.04 software [77].
Ijms 23 02835 g002
Table 1. Summary of searches for differentially expressed genes (DEGs) in hippocampal transcriptomes of three tame adult male rats (Rattus norvegicus) and three aggressive ones (all unrelated) in this work.
Table 1. Summary of searches for differentially expressed genes (DEGs) in hippocampal transcriptomes of three tame adult male rats (Rattus norvegicus) and three aggressive ones (all unrelated) in this work.
GroupTame vs. Aggressive Rats
Total number of sequence reads (NCBI SRA ID: PRJNA668014)169,529,658
Reads mapped to reference rat genome RGSC Rnor_6.0, UCSC Rn6, July 2014 (%)146,521,467 (88.74%)
Expressed genes identified14,039
Statistically significant DEGs (PADJ < 0.05, Fisher’s Z-test with Benjamini correction)42
Table 2. The statistically significant DEGs in the hippocampus (of tame versus aggressive adult male rats) that were for the first time unidentified in this study.
Table 2. The statistically significant DEGs in the hippocampus (of tame versus aggressive adult male rats) that were for the first time unidentified in this study.
#Rat Gene, NameSymbollog2pPADJ
1AlbuminAlb3.21<10−11<10−7
2Aquaporin 1 (Colton blood group)Aqp15.91<10−6<10−2
3Achaete-scute family bHLH transcription factor 3Ascl32.38<10−4<0.05
4BAG cochaperone 3 (synonym: BCL2-associated athanogene 3)Bag3−0.92<10−4<0.05
5BAR/IMD domain-containing adaptor protein 2-like 1Baiap2l13.67<10−4<0.05
63-hydroxybutyrate dehydrogenase 1Bdh10.40<10−4<0.05
7Cholecystokinin B receptorCckbr1.24<10−8<10−4
8Chondroitin sulfate proteoglycan 4BCspg4b3.47<10−4<0.05
9Defensin β17Defb175.94<10−4<0.05
10Ectonucleotide pyrophosphatase/phosphodiesterase 2Enpp22.41<10−3<0.05
11Fras1-related extracellular matrix 1Frem13.16<10−3<0.05
12Glycerol-3-phosphate dehydrogenase 1Gpd1−1.34<10−6<10−3
13Hemoglobin, β adult major chainHbb-b1−6.19<10−7<10−4
14Hepatocyte nuclear factor 4αHnf4a6.51<10−3<0.05
155-hydroxytryptamine receptor 2C (synonym: serotonin receptor 2C)Htr2c2.03<10−3<0.05
16Keratin 2Krt2−1.43<10−6<10−3
17Leukocyte immunoglobulin-like receptor, subfamily B, member 3-likeLilrb3l7.45<10−4<0.05
18Lymphocyte antigen 6 complex/Plaur domain-containing 1Lypd1−0.89<10−4<0.05
19MORN repeat-containing 1Morn11.42<10−11<10−7
20Myomesin 2Myom2−1.24<10−4<0.05
21Protocadherin β9Pcdhb9−1.03<10−4<0.05
22Protocadherin γ subfamily A1Pcdhga12.45<10−4<0.05
23ProdynorphinPdyn−0.89<10−4<0.05
24Phospholipase A2, group IIDPla2g2d2.84<10−4<0.05
25Phospholipase A2, group VPla2g53.85<10−4<0.05
26Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1Plod1−0.67<10−3<0.05
27Protein phosphatase 1, regulatory subunit 3BPpp1r3b2.45<10−4<0.05
28Prolactin receptorPrlr6.43<10−5<10−2
29Glycogen phosphorylase LPygl−1.21<10−5<0.05
30RNA-binding motif protein 3Rbm30.89<10−4<0.05
31Retinol saturaseRetsat−0.98<10−4<0.05
32Solute carrier family 16, member 12Slc16a123.08<10−3<0.05
33Solute carrier family 4, member 5Slc4a56.27<10−6<10−3
34SPARC-related modular calcium-binding 2Smoc2−2.09<10−4<0.05
35Serine peptidase inhibitor, Kunitz type 1Spint1−1.39<10−7<10−4
36Sulfatase 1Sulf13.72<10−6<10−2
37Syncoilin, intermediate filament proteinSync1.17<10−3<0.05
38Tandem C2 domains, nuclearTc2n3.47<10−5<10−2
39Tectorin αTecta1.38<10−8<10−5
40Transmembrane protein 60Tmem600.79<10−4<0.05
41Thioredoxin reductase 2Txnrd2−0.71<10−5<10−2
42Uncoupling protein 2Ucp20.73<10−4<0.05
Note. Hereinafter, log2: the log2-transformed fold change (i.e., ratio of an expression level of a given gene in tame rats to that in aggressive rats); p and PADJ: statistical significance according to Fisher’s Z-test without and with the Benjamini correction for multiple comparisons, respectively.
Table 3. qPCR data on the selected DEGs from the hippocampus of the independently obtained eight tame adult male rats and eight other aggressive ones (all unrelated animals).
Table 3. qPCR data on the selected DEGs from the hippocampus of the independently obtained eight tame adult male rats and eight other aggressive ones (all unrelated animals).
DesignBehavioral “Glove” Test [74] and the qPCR Data on Gene Expression [This Work]
RatSetNo. 12345678
GlovetestA−3−3−3−3−3−3−3−3
T33333333
DEGSetRelative expression with respect to four reference genes, qPCR, M0 ± SEMTOTAL
Ascl3A0.16 ± 0.020.88 ± 0.300.82 ± 0.080.09 ± 0.040.18 ± 0.030.07 ± 0.070.27 ± 0.110.32 ± 0.050.35 ± 0.17
T4.85 ± 4.383.40 ± 1.691.75 ± 0.242.21 ± 0.122.92 ± 0.054.48 ± 0.173.83 ± 0.332.64 ± 0.153.26 ± 1.71
Defb17A0.005 ± 0.0050.01 ± 0.0050.005 ± 0.0050.005 ± 0.0050.005 ± 0.005ND0.005 ± 0.0050.005 ± 0.0050.01 ± 0.01
T1.72 ± 0.043.22 ± 0.422.52 ± 0.141.82 ± 0.552.45 ± 0.104.43 ± 0.261.99 ± 0.892.34 ± 0.272.56 ± 0.53
Note. Sets: A, aggressive rats; T, tame rats; qPCR data: “M0 ± SEM” denotes the mean ± standard error of the mean for three technical replicates for each rat; ND, not detected.
Table 4. The DEGs—of hypertensive versus normotensive animals—that we could find (available in PubMed [69]).
Table 4. The DEGs—of hypertensive versus normotensive animals—that we could find (available in PubMed [69]).
#SpeciesHypertensive NormotensiveTissueNDEGRef.
1ratOXYS Wistar hippocampus85[40]
2ratOXYS Wistar prefrontal cortex73[41]
3ratOXYS Wistar retina85[42]
4ratISIAH WAG brain stem206[43]
5ratISIAH WAG hypothalamus137[44]
6ratISIAH WAG renal medulla882[45]
7ratISIAH WAG renal cortex309[46]
8ratISIAH WAG adrenal gland1020[47]
9ratSHR Wistar brain pericytes21[48]
10ratSHR Wistar kidney35[49]
11ratSD, monocrotaline-treatedSD, saline-treatedlung10[50]
12ratDahl-SS, water after salt diet Dahl-SS, QSYQ after salt diet kidney13[51]
13ratResp18-null Dahl-SS Dahl-SS kidney14[52]
14ratprenatal dexamethasone stress norm adrenal gland93[7]
15miceToxoplasma infection in pregnancynormuterus10[53]
16miceBPH/2J BPN/3J kidney883[54]
17rabbitG2K1C-treatednormmiddle cerebral artery230[55]
18chickenhigh (1.2%) Ca diet normal (0.8%) Ca diet kidney92[56]
19chickencold stress with salt diethealthy chicken pulmonary arteries18[57]
Σ4 species14 animal models of human hypertension 14 tissues4216
Note. NDEG: the number of DEGs; BPH/2J, BPN/3J Dahl-SS, ISIAH, OXIS, SD, SHR, WAG, and Wistar: laboratory animal strains; QSYQ: QiShenYiQi pills, a cardioprotective remedy from traditional Chinese medicine; G2K1C: Goldblatt 2-kidney 1-clip; Ref.: reference.
Table 5. The analyzed DEGs—of hypertensive versus normotensive patients—that we could find (available in PubMed [69]).
Table 5. The analyzed DEGs—of hypertensive versus normotensive patients—that we could find (available in PubMed [69]).
#Hypertensive NormotensiveTissueNDEGRef.
1renal medullary hypertensionnormrenal medulla13[26]
2pulmonary arterial hypertension normlung49[27]
3pulmonary arterial hypertension normlung119[28]
4men with pulmonary arterial hypertensionnormal menblood14[29]
5women with pulmonary arterial hypertensionnormal womenblood15[29]
6pulmonary hypertension during pulmonary fibrosisnormlung3520[30]
7BMPR2-deficient human cells normal cellspulmonary artery endothelial cells483[31]
8preeclampsia normal pregnantplacenta1228[32]
9preeclampsianormal pregnantplacenta10[33]
10preeclampsianormal pregnantvenous blood64[34]
11preeclampsianormal pregnantdecidua basalis 372[35]
12excessive miR-210 in SWAN-71 cellsnormal SWAN-71 cells trophoblast cell line SWAN-7119[36]
13hypertension-induced nephrosclerosisnormkidney16[37]
14hypertension-related pre-invasive squamous cancernormal cells, the same biopsiessquamous lung cancer cells119[38]
15hypertension-induced atrial fibrillation normauricle tissue biopsy300[39]
16hypertension-induced coronary artery disease normperipheral blood1524[39]
Σ10 human hypertension-related disorders12 tissues7865
Note. See the footnote of Table 4.
Table 6. Searching for hypertension-related molecular markers among the human genes orthologous to the 42 hippocampal DEGs (of tame versus aggressive rats) identified in this work. Here, we took into account the number of their homologous DEGs in the tissues of hypertensive versus normotensive subjects (patients and animals).
Table 6. Searching for hypertension-related molecular markers among the human genes orthologous to the 42 hippocampal DEGs (of tame versus aggressive rats) identified in this work. Here, we took into account the number of their homologous DEGs in the tissues of hypertensive versus normotensive subjects (patients and animals).
Rat GeneTotal Number of DEGsBinomial DistributionRat GeneTotal Number of DEGsBinomial Distribution
#SymbolNPC1: Opposite SignsNPC2: Matching SignspPADJ#SymbolNPC1: Opposite SignsNPC2: Matching SignspPADJ
iiiiiiivvviiiiiiiivvvi
1Alb110.751.0022Pcdhga1110.751.00
2Aqp1660.611.0023Pdyn00NDND
3Ascl3110.751.0024Pla2g2d19120.141.00
4Bag3220.691.0025Pla2g519120.141.00
5Baiap2l1100.501.0026Plod1310.311.00
6Bdh1200.251.0027Ppp1r3b230.501.00
7Cckbr100.501.0028Prlr010.501.00
8Cspg4b00NDND29Pygl010.501.00
9Defb17230.501.0030Rbm315120.351.00
10Enpp2380.111.0031Retsat520.231.00
11Frem1110.751.0032Slc16a12760.501.00
12Gpd1410.191.0033Slc4a5750.831.00
13Hbb-b124310−410−334Smoc2310.311.00
14Hnf4a00NDND35Spint1110.751.00
15Htr2c330.651.0036Sulf100NDND
16Krt222130.091.0037Sync00NDND
17Lilrb3l10110−20.2438Tc2n200.251.00
18Lypd11170.241.0039Tecta010.501.00
19Morn1040.061.0040Tmem6000NDND
20Myom2210.501.0041Txnrd2200.251.00
21Pcdhb910010−30.0542Ucp2110.751.00
Note. p and PADJ: a significance estimate according to the binomial distribution without or with Bonferroni’s correction for multiple comparisons, respectively; ND: not detected; underlining: statistically significant hypertension-related molecular markers identified in this work.
Table 7. Statistically significant upregulation of the hemoglobin subunit and β-protocadherin DEGs—in the tissues of the hypertensive versus normotensive subjects (i.e., patients and animals)—that were for the first time compiled together here.
Table 7. Statistically significant upregulation of the hemoglobin subunit and β-protocadherin DEGs—in the tissues of the hypertensive versus normotensive subjects (i.e., patients and animals)—that were for the first time compiled together here.
#SpeciesHypertensiveNormotensiveTissueDEGlog2PADJRef.
iiiiiiivvvviviiviii
1ratISIAHWAGbrain stemHbb-b11.4210−2[43]
2ratISIAHWAGhypothalamusHbb-b12.0210−2[44]
3ratISIAHWAGrenal medullaHbb-b11.1810−2[45]
4ratISIAHWAGadrenal glandHbb-b11.3210−2[47]
5ratISIAHWAGadrenal glandHba20.6910−2[47]
6ratISIAHWAGadrenal glandHbb2.0210−2[47]
7ratISIAHWAGadrenal glandHbb-m3.7810−2[47]
8ratISIAHWAGbrain stemHba20.580.05[43]
9ratISIAHWAGbrain stemHbb1.8810−2[43]
10ratISIAHWAGbrain stemHbb-m3.6510−2[43]
11ratISIAHWAGhypothalamusHba11.1410−2[44]
12ratISIAHWAGhypothalamusHba21.3210−2[44]
13ratISIAHWAGhypothalamusHbb3.2310−2[44]
14ratISIAHWAGhypothalamusHbb-m1.0910−2[44]
15ratISIAHWAGrenal medullaHbb−0.6810−2[45]
16ratISIAHWAGrenal medullaHbb-m2.7210−2[45]
17ratISIAHWAGrenal medullaHbb-s2.3810−2[45]
18humanpreeclampsianormplacentaHBD−0.6310−3[32]
19humanpulmonary hypertension during pulmonary fibrosisnormlungsHBD−2.8310−3[30]
20humanpulmonary hypertensionnormlungsHBA12.0810−9[28]
21humanpulmonary hypertensionnormlungsHBB2.4610−10[28]
22humanHT-induced coronary diseasenormperipheral bloodHBBP11.030.05[39]
23humanHT-induced coronary diseasenormperipheral bloodHBE11.420.05[39]
24humanHT-induced coronary diseasenormperipheral bloodHBG24.490.05[39]
25humanHT-induced coronary diseasenormperipheral bloodHBM5.330.05[39]
26humanHT-induced coronary diseasenormperipheral bloodHBQ13.100.05[39]
27humanHT-induced atrial fibrillationnormauricle tissue biopsyHBA22.3710−2[39]
28ratISIAHWAGbrain stemPcdhb71.6010−2[43]
29mouseBPH/2JBPN/3JkidneysPcdhb161.2210−3[54]
30humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB101.8910−2[30]
31humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB151.4710−4[30]
32humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB161.3810−4[30]
33humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB17P1.2110−2[30]
34humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB42.9310−4[30]
35humanpulmonary hypertension during pulmonary fibrosisnormlungsPCDHB61.3510−2[30]
36humanHT-induced coronary diseasenormperipheral bloodPCDHB111.120.05[39]
37humanHT-induced coronary diseasenormperipheral bloodPCDHB131.040.05[39]
Notes. HT, hypertension.
Table 8. The investigated genome-wide RNA-Seq transcriptomes (of domestic animals with their wild congeners) that we could find in the PubMed database [69].
Table 8. The investigated genome-wide RNA-Seq transcriptomes (of domestic animals with their wild congeners) that we could find in the PubMed database [69].
#Domestic AnimalsWild AnimalsTissueNDEGRef.
1tame rats aggressive ratshypothalamus46[72]
2tame rats aggressive rats frontal cortex20[187]
3guinea pigs cavyfrontal cortex883[187]
4domestic rabbits wild rabbitsfrontal cortex17[187]
5domestic rabbits wild rabbitsparietal-temporal cortex216[188]
6domestic rabbits wild rabbitsamygdala118[188]
7domestic rabbits wild rabbitshypothalamus43[188]
8domestic rabbits wild rabbitshippocampus100[188]
9dogswolves blood450[189]
10dogswolves frontal cortex13[187]
11tame foxes aggressive foxes pituitary327[190]
12pigs boarsfrontal cortex30[187]
13pigs boarsfrontal cortex34[191]
14pigs boarspituitary22[192]
15domestic chickenwild chickenpituitary474[193]
Σ7 domestic animal species 7 wild animal species 8 tissues2393
Table 9. Comparing the effects of changes to the expression of homologous genes (a) on hypertension development in humans and (b) during the divergence of domestic and wild animals from their most recent common ancestors.
Table 9. Comparing the effects of changes to the expression of homologous genes (a) on hypertension development in humans and (b) during the divergence of domestic and wild animals from their most recent common ancestors.
(a) Humans(b) Animals
GeneEffect of Gene Expression Changes on Hypertension (HT): Hypertensive (→) or Normotensive (←) RNA-SeqEffect of Gene Expression Changes during Divergence from the Most Recent Common AncestorRef.
DownregulationHTUpregulationHTDEG log2DownregulationUpregulationTissue
iiiiiiivvviviiviiiixxxi
HBB, HBDlow blood viscosity [199] high-altitude environment provokes hyperhemoglobinemia and hypertension [103]Hbb-b1−6.19tame rataggressive rathippocampus[this work]
Hbb-b1−3.97tame rataggressive rathypothalamus[72]
Hbbl−5.92dogswolvesblood[189]
Hba1−4.06dogswolvesblood[189]
Hbad−1.07domestic chickenswild chickenspituitary[193]
Hbm−6.46dogswolvesblood[189]
Hbz1−7.10dogswolvesblood[189]
PCDHB9wide vascular inner diameter [200]higher risks of gastric cancer [93], surgical removal of which relieves hypertension [12]Pcdhb9−1.03tame rataggressive rathippocampus[this work]
Pcdhb9−1.01tame rataggressive rathypothalamus[72]
Pcdhb15−1.04domestic rabbitswild rabbitsparietal-temporal cortex[188]
Table 10. Correlations between the effects of unidirectional changes in the expression of homologous genes (a) on human hypertension and (b) during the divergence of studied domestic and wild animals from their most recent common ancestor.
Table 10. Correlations between the effects of unidirectional changes in the expression of homologous genes (a) on human hypertension and (b) during the divergence of studied domestic and wild animals from their most recent common ancestor.
(a) Humans Effect of Expression Changes of Genes Encoding Hemoglobin Subunits and β-Protocadherins in Patients Binomial DistributionPearson’s χ2 TestFisher’s Exact Test
(b) Animals Hypertensive Normotensive χ2p
Effect of expression changes of genes encoding hemoglobin subunits and β-protocadherins during animal microevolutionwild 10010−420.0010−310−5
domestic01010−4
Table 11. The hypertension-related candidate SNP markers within HBB, HBD, and PCDHB9 promoters (predicted here) and their comparison with genome-wide patterns.
Table 11. The hypertension-related candidate SNP markers within HBB, HBD, and PCDHB9 promoters (predicted here) and their comparison with genome-wide patterns.
Data: GRCh38, dbSNP rel. 153 [210]H0: Neutral Drift [229,230]H0: “→HT and ←HT Equivalence”
SNPs NGENENSNPNRESN>N<p(H0: N> < N<) [227]N→HTN←HTp(H0: N→HT ≡ N←HT )
Whole-genome norm for SNPs of TBP sites [228]104105103200800>0.99---
HT-related candidate SNP markers at TBP sites [this work]38527819>0.99819<0.05
Notes. Hypertension (HT): normotensive (←HT) and hypertensive (→HT). NGENE and NSNP: total numbers of the human genes and of their SNPs meeting the criteria for this study. NRES: the total number of the candidate SNP markers that can increase (N>) or decrease (N<) the affinity of TATA-binding protein (TBP) for these promoters and to respectively affect the expression of these genes. N←HT and N→HT: total numbers of the candidate SNP markers that can prevent or provoke hypertension. p(H0): the estimate of probability for the acceptance of this H0 hypothesis, in accordance with the binomial distribution. TBP-site: TATA-binding-protein binding site.
Table 12. qPCR primers selected using publicly available Web service PrimerBLAST [240].
Table 12. qPCR primers selected using publicly available Web service PrimerBLAST [240].
No.GeneForward, 5′→3′Reverse, 5′→3′
DEGs identified in hippocampus of tame versus aggressive adult male rats [this work]
1Ascl3CCTCTGCTGCCCTTTTCCAGACTTGACTCGCTGCCTCTCT
2Defb17TGGTAGCTTGGACTTGAGGAAAGAATGCAGCAGTGTGTTCCAGGTC
Reference genes
3B2mGTGTCTCAGTTCCACCCACCTTACATGTCTCGGTCCCAGG
4Hprt1TCCCAGCGTCGTGATTAGTGACCTTCATGACATCTCGAGCAAG
5PpiaTTCCAGGATTCATGTGCCAGCTTGCCATCCAGCCACTC
6Rpl30CATCTTGGCGTCTGATCTTGTCAGAGTCTGTTTGTACCCC
Notes. Regarding the DEGs subjected to this qPCR verification, see Table 2; reference rat genes: B2m, β-2-microglobulin [241]; Hprt1, hypoxanthine phosphoribosyltransferase 1 [242]; Ppia, peptidylprolyl isomerase A [243]; Rpl30, ribosomal protein L30 [244].
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Oshchepkov, D.; Chadaeva, I.; Kozhemyakina, R.; Zolotareva, K.; Khandaev, B.; Sharypova, E.; Ponomarenko, P.; Bogomolov, A.; Klimova, N.V.; Shikhevich, S.; et al. Stress Reactivity, Susceptibility to Hypertension, and Differential Expression of Genes in Hypertensive Compared to Normotensive Patients. Int. J. Mol. Sci. 2022, 23, 2835. https://doi.org/10.3390/ijms23052835

AMA Style

Oshchepkov D, Chadaeva I, Kozhemyakina R, Zolotareva K, Khandaev B, Sharypova E, Ponomarenko P, Bogomolov A, Klimova NV, Shikhevich S, et al. Stress Reactivity, Susceptibility to Hypertension, and Differential Expression of Genes in Hypertensive Compared to Normotensive Patients. International Journal of Molecular Sciences. 2022; 23(5):2835. https://doi.org/10.3390/ijms23052835

Chicago/Turabian Style

Oshchepkov, Dmitry, Irina Chadaeva, Rimma Kozhemyakina, Karina Zolotareva, Bato Khandaev, Ekaterina Sharypova, Petr Ponomarenko, Anton Bogomolov, Natalya V. Klimova, Svetlana Shikhevich, and et al. 2022. "Stress Reactivity, Susceptibility to Hypertension, and Differential Expression of Genes in Hypertensive Compared to Normotensive Patients" International Journal of Molecular Sciences 23, no. 5: 2835. https://doi.org/10.3390/ijms23052835

APA Style

Oshchepkov, D., Chadaeva, I., Kozhemyakina, R., Zolotareva, K., Khandaev, B., Sharypova, E., Ponomarenko, P., Bogomolov, A., Klimova, N. V., Shikhevich, S., Redina, O., Kolosova, N. G., Nazarenko, M., Kolchanov, N. A., Markel, A., & Ponomarenko, M. (2022). Stress Reactivity, Susceptibility to Hypertension, and Differential Expression of Genes in Hypertensive Compared to Normotensive Patients. International Journal of Molecular Sciences, 23(5), 2835. https://doi.org/10.3390/ijms23052835

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop