Protein Disulfide Isomerase A3 Regulates Influenza Neuraminidase Activity and Influenza Burden in the Lung
Abstract
:1. Introduction
2. Results
2.1. Disulfide Bonds Are Required for NA Activity, and PDIA3 Interacts with IAV NA
2.2. LOC14 Treatment Alters Disulfides and Activity of NA and Decreases the Viral Burden
2.3. LOC14 Decreases IAV Burden and Inflammation in Mice
3. Discussion
4. Material and Methods
4.1. Ethics Statement
4.2. Viruses
4.3. Cells and Treatments
4.4. Transfection
4.5. NA Activity Assay
4.6. Dead Cell Protease Assay
4.7. CRISPR Lines
4.8. Mouse Model of IAV-Infection and LOC14 Treatment
4.9. BALF Processing
4.10. Analysis of mRNA Expression
4.11. Biotin Switch Assay
4.12. Non-Reducing Gel Electrophoresis
4.13. Western Blot Analysis
4.14. Image Processing
4.15. ELISA
4.16. Serum ALT Determination
4.17. Immunoprecipitation
4.18. Virus Plaque Assay
4.19. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jung, H.E.; Lee, H.K. Host Protective Immune Responses against Influenza A Virus Infection. Viruses 2020, 12, 504. [Google Scholar] [CrossRef]
- Solda, T.; Garbi, N.; Hammerling, G.J.; Molinari, M. Consequences of ERp57 deletion on oxidative folding of obligate and facultative clients of the calnexin cycle. J. Biol. Chem. 2006, 281, 6219–6226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chamberlain, N.; Korwin-Mihavics, B.R.; Nakada, E.M.; Bruno, S.R.; Heppner, D.E.; Chapman, D.G.; Hoffman, S.M.; van der Vliet, A.; Suratt, B.T.; Dienz, O.; et al. Lung epithelial protein disulfide isomerase A3 (PDIA3) plays an important role in influenza infection, inflammation, and airway mechanics. Redox Biol. 2019, 22, 101129. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Chang, K.O. Protein disulfide isomerases as potential therapeutic targets for influenza A and B viruses. Virus Res. 2018, 247, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Patil, N.A.; Tailhades, J.; Hughes, R.A.; Separovic, F.; Wade, J.D.; Hossain, M.A. Cellular disulfide bond formation in bioactive peptides and proteins. Int. J. Mol. Sci. 2015, 16, 1791–1805. [Google Scholar] [CrossRef] [PubMed]
- Wedemeyer, W.J.; Welker, E.; Narayan, M.; Scheraga, H.A. Disulfide bonds and protein folding. Biochemistry 2000, 39, 4207–4216. [Google Scholar] [CrossRef]
- Chamberlain, N.; Anathy, V. Pathological consequences of the unfolded protein response and downstream protein disulphide isomerases in pulmonary viral infection and disease. J. Biochem. 2020, 167, 173–184. [Google Scholar] [CrossRef]
- Galligan, J.J.; Petersen, D.R. The human protein disulfide isomerase gene family. Hum. Genom. 2012, 6, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, J.; Wang, Y.; Wei, Y.; Xu, Z.; Tan, X.; Wu, Z.; Zheng, J.; Liu, G.D.; Cao, Y.; Xue, C. Disulfide isomerase ERp57 improves the stability and immunogenicity of H3N2 influenza virus hemagglutinin. Virol. J. 2020, 17, 55. [Google Scholar] [CrossRef] [Green Version]
- Kaplan, A.; Gaschler, M.M.; Dunn, D.E.; Colligan, R.; Brown, L.M.; Palmer, A.G., 3rd; Lo, D.C.; Stockwell, B.R. Small molecule-induced oxidation of protein disulfide isomerase is neuroprotective. Proc. Natl. Acad. Sci. USA 2015, 112, E2245–E2252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gamblin, S.J.; Skehel, J.J. Influenza hemagglutinin and neuraminidase membrane glycoproteins. J. Biol. Chem. 2010, 285, 28403–28409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McAuley, J.L.; Gilbertson, B.P.; Trifkovic, S.; Brown, L.E.; McKimm-Breschkin, J.L. Influenza Virus Neuraminidase Structure and Functions. Front. Microbiol. 2019, 10, 39. [Google Scholar] [CrossRef] [Green Version]
- Yen, H.L.; McKimm-Breschkin, J.L.; Choy, K.T.; Wong, D.D.Y.; Cheung, P.P.H.; Zhou, J.; Ng, I.H.; Zhu, H.; Webby, R.J.; Guan, Y.; et al. Resistance to neuraminidase inhibitors conferred by an R292K mutation in a human influenza virus H7N9 isolate can be masked by a mixed R/K viral population. mBio 2013, 4, e00396-13. [Google Scholar] [CrossRef] [Green Version]
- Krammer, F.; Smith, G.J.D.; Fouchier, R.A.M.; Peiris, M.; Kedzierska, K.; Doherty, P.C.; Palese, P.; Shaw, M.L.; Treanor, J.; Webster, R.G.; et al. Influenza. Nat. Rev. Dis. Primers 2018, 4, 3. [Google Scholar] [CrossRef]
- Basler, C.F.; García-Sastre, A.; Palese, P. Mutation of neuraminidase cysteine residues yields temperature-sensitive influenza viruses. J. Virol. 1999, 73, 8095–8103. [Google Scholar] [CrossRef] [Green Version]
- Veerapandian, R.; Snyder, J.D.; Samarasinghe, A.E. Influenza in Asthmatics: For Better or for Worse? Front. Immunol. 2018, 9, 1843. [Google Scholar] [CrossRef] [Green Version]
- Hoffstrom, B.G.; Kaplan, A.; Letso, R.; Schmid, R.S.; Turmel, G.J.; Lo, D.C.; Stockwell, B.R. Inhibitors of protein disulfide isomerase suppress apoptosis induced by misfolded proteins. Nat. Chem. Biol. 2010, 6, 900–906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paget, J.; Spreeuwenberg, P.; Charu, V.; Taylor, R.J.; Iuliano, A.D.; Bresee, J.; Simonsen, L.; Viboud, C.; Global Seasonal Influenza-associated Mortality Collaborator; GLaMOR Collaborating Teams. Global mortality associated with seasonal influenza epidemics: New burden estimates and predictors from the GLaMOR Project. J. Glob. Health 2019, 9, 020421. [Google Scholar] [CrossRef] [PubMed]
- Simonsen, L.; Spreeuwenberg, P.; Lustig, R.; Taylor, R.J.; Fleming, D.M.; Kroneman, M.; Van Kerkhove, M.D.; Mounts, A.W.; Paget, W.J.; Teams, G.L.C. Global mortality estimates for the 2009 Influenza Pandemic from the GLaMOR project: A modeling study. PLoS Med. 2013, 10, e1001558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Talbot, H.K. Influenza in Older Adults. Infect. Dis. Clin. N. Am. 2017, 31, 757–766. [Google Scholar] [CrossRef]
- Bright, R.A.; Medina, M.J.; Xu, X.; Perez-Oronoz, G.; Wallis, T.R.; Davis, X.M.; Povinelli, L.; Cox, N.J.; Klimov, A.I. Incidence of adamantane resistance among influenza A (H3N2) viruses isolated worldwide from 1994 to 2005: A cause for concern. Lancet 2005, 366, 1175–1181. [Google Scholar] [CrossRef]
- Sheu, T.G.; Fry, A.M.; Garten, R.J.; Deyde, V.M.; Shwe, T.; Bullion, L.; Peebles, P.J.; Li, Y.; Klimov, A.I.; Gubareva, L.V. Dual resistance to adamantanes and oseltamivir among seasonal influenza A(H1N1) viruses: 2008–2010. J. Infect. Dis. 2011, 203, 13–17. [Google Scholar] [CrossRef] [Green Version]
- Kikuchi, T.; Watanabe, A. Baloxavir heralds a new era in influenza virus biology. Respir. Investig. 2019, 57, 1–2. [Google Scholar] [CrossRef]
- Bright, R.A.; Shay, D.K.; Shu, B.; Cox, N.J.; Klimov, A.I. Adamantane resistance among influenza A viruses isolated early during the 2005-2006 influenza season in the United States. JAMA 2006, 295, 891–894. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayden, F.G.; de Jong, M.D. Emerging influenza antiviral resistance threats. J. Infect. Dis. 2011, 203, 6–10. [Google Scholar] [CrossRef] [Green Version]
- Kaufman, M.B. Pharmaceutical Approval Update. Pharm. Ther. 2019, 44, 42–44. [Google Scholar]
- Imai, M.; Yamashita, M.; Sakai-Tagawa, Y.; Iwatsuki-Horimoto, K.; Kiso, M.; Murakami, J.; Yasuhara, A.; Takada, K.; Ito, M.; Nakajima, N.; et al. Influenza A variants with reduced susceptibility to baloxavir isolated from Japanese patients are fit and transmit through respiratory droplets. Nat. Microbiol. 2020, 5, 27–33. [Google Scholar] [CrossRef]
- Baz, M.; Abed, Y.; Papenburg, J.; Bouhy, X.; Hamelin, M.-È.; Boivin, G. Emergence of Oseltamivir-Resistant Pandemic H1N1 Virus during Prophylaxis. N. Engl. J. Med. 2009, 361, 2296–2297. [Google Scholar] [CrossRef] [PubMed]
- Jessop, C.E.; Watkins, R.H.; Simmons, J.J.; Tasab, M.; Bulleid, N.J. Protein disulphide isomerase family members show distinct substrate specificity: P5 is targeted to BiP client proteins. J. Cell Sci. 2009, 122, 4287–4295. [Google Scholar] [CrossRef] [Green Version]
- Roberson, E.C.; Tully, J.E.; Guala, A.S.; Reiss, J.N.; Godburn, K.E.; Pociask, D.A.; Alcorn, J.F.; Riches, D.W.H.; Dienz, O.; Janssen-Heininger, Y.M.W.; et al. Influenza Induces Endoplasmic Reticulum Stress, Caspase-12–Dependent Apoptosis, and c-Jun N-Terminal Kinase–Mediated Transforming Growth Factor–β Release in Lung Epithelial Cells. Am. J. Resp. Cell. Mol. Biol. 2012, 46, 573–581. [Google Scholar] [CrossRef] [Green Version]
- Anathy, V.; Roberson, E.; Cunniff, B.; Nolin, J.D.; Hoffman, S.; Spiess, P.; Guala, A.S.; Lahue, K.G.; Goldman, D.; Flemer, S.; et al. Oxidative processing of latent Fas in the endoplasmic reticulum controls the strength of apoptosis. Mol. Cell. Biol. 2012, 32, 3464–3478. [Google Scholar] [CrossRef] [Green Version]
- Hoffman, S.M.; Chapman, D.G.; Lahue, K.G.; Cahoon, J.M.; Rattu, G.K.; Daphtary, N.; Aliyeva, M.; Fortner, K.A.; Erzurum, S.C.; Comhair, S.A.A.; et al. Protein disulfide isomerase-endoplasmic reticulum resident protein 57 regulates allergen-induced airways inflammation, fibrosis, and hyperresponsiveness. J. Allergy Clin. Immunol. 2016, 137, 822–832.e827. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, A.; Elko, E.; Bruno, S.R.; Mark, Z.F.; Chamberlain, N.; Mihavics, B.K.; Chandrasekaran, R.; Walzer, J.; Ruban, M.; Gold, C.; et al. Inhibition of PDIA3 in club cells attenuates osteopontin production and lung fibrosis. Thorax, 2021; online first. [Google Scholar] [CrossRef]
- Snouwaert, J.N.; Leebeek, F.W.; Fowlkes, D.M. Role of disulfide bonds in biologic activity of human interleukin-6. J. Biol. Chem. 1991, 266, 23097–23102. [Google Scholar] [CrossRef]
- Simpson, R.J.; Moritz, R.L.; Van, R.; Van Snick, J. Characterization of a recombinant murine interleukin-6: Assignment of disulfide bonds. Biochem. Biophys. Res. Commun. 1988, 157, 364–372. [Google Scholar] [CrossRef]
- Lu, H.S.; Boone, T.C.; Souza, L.M.; Lai, P.H. Disulfide and secondary structures of recombinant human granulocyte colony stimulating factor. Arch. Biochem. Biophys. 1989, 268, 81–92. [Google Scholar] [CrossRef]
- Martens, E.; Alloza, I.; Scott, C.J.; Billiau, A.; Vandenbroeck, K. Protein disulfide isomerase-mediated cell-free assembly of recombinant interleukin-12 p40 homodimers. Eur. J. Biochem. 2000, 267, 6679–6683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hurt, A.C.; Kelly, H. Debate Regarding Oseltamivir Use for Seasonal and Pandemic Influenza. Emerg. Infect. Dis. 2016, 22, 949–955. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, Q.; Fang, H.; Xu, W.; Liu, A.; Du, G. Design, synthesis, inhibitory activity, and SAR studies of pyrrolidine derivatives as neuraminidase inhibitors. Bioorg. Med. Chem. 2007, 15, 2749–2758. [Google Scholar] [CrossRef] [PubMed]
- Dobson, J.; Whitley, R.J.; Pocock, S.; Monto, A.S. Oseltamivir treatment for influenza in adults: A meta-analysis of randomised controlled trials. Lancet 2015, 385, 1729–1737. [Google Scholar] [CrossRef]
- Leang, S.K.; Hurt, A.C. Fluorescence-based Neuraminidase Inhibition Assay to Assess the Susceptibility of Influenza Viruses to The Neuraminidase Inhibitor Class of Antivirals. J. Vis. Exp. 2017, 122, 55570. [Google Scholar] [CrossRef] [PubMed]
- Motulsky, H.J.; Brown, R.E. Detecting outliers when fitting data with nonlinear regression—A new method based on robust nonlinear regression and the false discovery rate. BMC Bioinform. 2006, 7, 123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benjamini, Y.; Krieger, A.M.; Yekutieli, D. Adaptive linear step-up procedures that control the false discovery rate. Biometrika 2006, 93, 491–507. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) |
---|---|
Polymerase acidic–FW | CGGTCCAAATTCCTGCTGA |
Polymerase acidic–REV | CATTTGGGTTCCTTCCATCC |
mPP1B–FW | TTTTCATCTGCACTGCCAAG |
mPP1B–REV | TGCAGTTGTCCACAGTCAGC |
mRP2–FW | TTGCCAGCAATTCGTGTGA |
mRP2–REV | CCAGTTGACCTCTTCTGACA |
mGAPDH–FW | AGGTCGGTGTGAACGGATTTG |
mGAPDH–REV | TGTAGACCATGTAGTTGACCTCA |
mIRF7–FW | GAAGACCCTGATCCTGGTGA |
mIRF7–REV | CCAGGTCCATGAGGAAGTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chamberlain, N.; Ruban, M.; Mark, Z.F.; Bruno, S.R.; Kumar, A.; Chandrasekaran, R.; Souza De Lima, D.; Antos, D.; Nakada, E.M.; Alcorn, J.F.; et al. Protein Disulfide Isomerase A3 Regulates Influenza Neuraminidase Activity and Influenza Burden in the Lung. Int. J. Mol. Sci. 2022, 23, 1078. https://doi.org/10.3390/ijms23031078
Chamberlain N, Ruban M, Mark ZF, Bruno SR, Kumar A, Chandrasekaran R, Souza De Lima D, Antos D, Nakada EM, Alcorn JF, et al. Protein Disulfide Isomerase A3 Regulates Influenza Neuraminidase Activity and Influenza Burden in the Lung. International Journal of Molecular Sciences. 2022; 23(3):1078. https://doi.org/10.3390/ijms23031078
Chicago/Turabian StyleChamberlain, Nicolas, Mona Ruban, Zoe F. Mark, Sierra R. Bruno, Amit Kumar, Ravishankar Chandrasekaran, Dhemerson Souza De Lima, Danielle Antos, Emily M. Nakada, John F. Alcorn, and et al. 2022. "Protein Disulfide Isomerase A3 Regulates Influenza Neuraminidase Activity and Influenza Burden in the Lung" International Journal of Molecular Sciences 23, no. 3: 1078. https://doi.org/10.3390/ijms23031078
APA StyleChamberlain, N., Ruban, M., Mark, Z. F., Bruno, S. R., Kumar, A., Chandrasekaran, R., Souza De Lima, D., Antos, D., Nakada, E. M., Alcorn, J. F., & Anathy, V. (2022). Protein Disulfide Isomerase A3 Regulates Influenza Neuraminidase Activity and Influenza Burden in the Lung. International Journal of Molecular Sciences, 23(3), 1078. https://doi.org/10.3390/ijms23031078