Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice
Abstract
1. Introduction
2. Results
2.1. Characterization of CPDNL
2.1.1. Expression and Purification of Recombinant CPD Photolyase Protein
2.1.2. Optimization of CPDNL Preparation Conditions
2.1.3. Properties of the Optimized CPDNL
2.1.4. Enzyme Activity of CPDNL
2.2. Protective Effects of CPDNL on Skin Damage Induced by UVB Radiation
2.2.1. Effects of CPDNL on the External Appearance and Histopathology of Skin
2.2.2. CPDNL Reduced CPD Formation
2.2.3. CPDNL Enhanced Hydroxyproline Content
2.2.4. CPDNL Ameliorated Oxidative Stress Level
2.2.5. CPDNL Attenuated Inflammation
2.2.6. CPDNL Inhibited MMPs via the Suppression of MAPK/AP-1 Signaling Pathways
3. Discussion
4. Materials and Methods
4.1. DNA Photolayses Expression and Purification
4.2. Preparation of CPD Photolyase Nanoliposomes
4.3. Characterization of CPD Photolyase Nanoliposomes
4.4. Animal Experiments
4.5. Histological Analysis
4.6. Quantitation of CPDs
4.7. Determination of Hydroxyproline Content
4.8. Analysis of Oxidative Stress Level
4.9. RNA Extraction and Quantitative RT-PCR
4.10. Western Blotting Analysis
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| 6-4 PP | pyrimidine-pyrimidone (6-4) photoproducts |
| AK | actinic keratosis |
| AP-1 | activator protein-1 |
| COX-2 | cyclooxygenase-2 |
| CPD | cyclobutane pyrimidine dimer |
| CPDNL | nanoliposomes of CPD photolyases |
| ERK | extracellular signal-regulated kinase |
| JNK | c-Jun-N-terminal kinase |
| MAPK | mitogen-activated protein kinases |
| MDA | malondialdehyde |
| MMP | matrix metalloproteinase |
| NER | nucleotide excision repair |
| NF-κB | nuclear factor-κB |
| NMSC | non-melanoma skin cancer |
| PBS | phosphate-buffered saline |
| PDI | polydispersity index |
| ROS | reactive oxygen species |
| RSM | response surface methodology |
| SDS-PAGE | sodium dodecyl sulfate polyacrylamide gel electrophoresis |
| TNF-α | tumor necrosis factor-α |
| UVB | ultraviolet-B |
| XP | xeroderma pigmentosum |
References
- Pfeifer, G.P.; You, Y.H.; Besaratinia, A. Mutations induced by ultraviolet light. Mutat. Res. Mol. Mech. Mutagen. 2005, 571, 19–31. [Google Scholar] [CrossRef]
- Vechtomova, Y.; Telegina, T.; Buglak, A.; Kritsky, M. UV radiation in DNA damage and repair iInvolving DNA-photolyases and cryptochromes. Biomedicines 2021, 9, 1564. [Google Scholar] [CrossRef]
- Kwei, J.S.M.; Kuraoka, I.; Horibata, K.; Ubukata, M.; Kobatake, E.; Iwai, S.; Handa, H.; Tanaka, K. Blockage of RNA polymerase II at a cyclobutane pyrimidine dimer and 6–4 photoproduct. Biochem. Biophys. Res. Commun. 2004, 320, 1133–1138. [Google Scholar] [CrossRef]
- Kozma, B.; Eide, M.J. Photocarcinogenesis: An epidemiologic perspective on ultraviolet light and skin cancer. Dermatol. Clin. 2014, 32, 301–313. [Google Scholar] [CrossRef]
- Wei, L.; Christensen, S.R.; Fitzgerald, M.E.; Graham, J.; Hutson, N.D.; Zhang, C.; Huang, Z.; Hu, Q.; Zhan, F.; Xie, J.; et al. Ultradeep sequencing differentiates patterns of skin clonal mutations associated with sun-exposure status and skin cancer burden. Sci. Adv. 2021, 7, eabd7703. [Google Scholar] [CrossRef] [PubMed]
- You, Y.H.; Lee, D.H.; Yoon, J.H.; Nakajima, S.; Yasui, A.; Pfeifer, G.P. Cyclobutane pyrimidine dimers are responsible for the vast majority of mutations induced by UVB irradiation in mammalian cells. J. Biol. Chem. 2001, 276, 44688–44694. [Google Scholar] [CrossRef] [PubMed]
- Ikehata, H.; Mori, T.; Kamei, Y.; Douki, T.; Cadet, J.; Yamamoto, M. Wavelength- and tissue-dependent variations in the mutagenicity of cyclobutane pyrimidine dimers in mouse skin. Photochem. Photobiol. 2019, 96, 94–104. [Google Scholar] [CrossRef] [PubMed]
- Park, J.M.; Kang, T.H. Transcriptional and posttranslational regulation of nucleotide excision repair: The guardian of the genome against ultraviolet radiation. Int. J. Mol. Sci. 2016, 17, 1840. [Google Scholar] [CrossRef]
- Schärer, O.D. Nucleotide excision repair in eukaryotes. Cold Spring Harb. Perspect. Biol. 2013, 5, a012609. [Google Scholar] [CrossRef] [PubMed]
- Lima-Bessa, K.M.d.; Armelini, M.G.; Chiganças, V.; Jacysyn, J.F.; Amarante-Mendes, G.P.; Sarasin, A.; Menck, C.F.M. CPDs and 6-4PPs play different roles in UV-induced cell death in normal and NER-deficient human cells. DNA Repair 2008, 7, 303–312. [Google Scholar] [CrossRef]
- Sancar, A. Photolyase and cryptochrome blue-light photoreceptors. Adv. Protein Chem. 2004, 69, 73–100. [Google Scholar] [PubMed]
- Todo, T.; Takemori, H.; Ryo, H.; Lhara, M.; Matsunaga, T.; Nikaido, O.; Sato, K.; Nomura, T. A new photoreactivating enzyme that specifically repairs ultraviolet light-induced (6-4) photoproducts. Nature 1993, 361, 371–374. [Google Scholar] [CrossRef] [PubMed]
- Sancar, A. Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors. Chem. Rev. 2003, 103, 2203–2237. [Google Scholar] [CrossRef]
- Kato, T.J.; Todo, T.; Ayaki, H.; Ishizaki, K.; Morita, T.; Mitra, S.; Ikenaga, M. Cloning of a marsupial DNA photolyase gene and the lack of related nucleotide sequences in placental mammals. Nucleic Acids Res. 1994, 22, 4119–4124. [Google Scholar] [CrossRef] [PubMed]
- Menck, C.F. Shining a light on photolyases. Nat. Genet. 2002, 32, 338–339. [Google Scholar] [CrossRef] [PubMed]
- Park, H.W.; Kim, S.T.; Sancar, A.; Deisenhofer, J. Crystal structure of DNA photolyase from Escherichia coli. Science 1995, 268, 1866–1872. [Google Scholar] [CrossRef] [PubMed]
- Mees, A.; Klar, T.; Gnau, P.; Hennecke, U.; Eker, A.P.M.; Carell, T.; Essen, L.O. Crystal structure of a photolyase bound to a CPD-like DNA lesion after in situ repair. Science 2004, 306, 1789–1793. [Google Scholar] [CrossRef]
- Kavakli, I.H.; Ozturk, N.; Gul, S. DNA repair by photolyases. Adv. Protein Chem. Struct. Biol. 2019, 115, 1–19. [Google Scholar]
- Li, C.J.; Ma, L.; Mou, S.L.; Wang, Y.B.; Zheng, Z.; Liu, F.M.; Qi, X.Q.; An, M.L.; Chen, H.; Miao, J.L. Cyclobutane pyrimidine dimers photolyase from extremophilic microalga: Remarkable UVB resistance and efficient DNA damage repair. Mutat. Res. Mol. Mech. Mutagen. 2015, 773, 37–42. [Google Scholar] [CrossRef]
- Marizcurrena, J.J.; Martínez-López, W.; Ma, H.; Lamparter, T.; Castro-Sowinski, S. A highly efficient and cost-effective recombinant production of a bacterial photolyase from the Antarctic isolate Hymenobacter sp. UV11. Extremophiles 2019, 23, 49–57. [Google Scholar] [CrossRef]
- Bilal, M.; Zhao, Y.; Noreen, S.; Shah, S.Z.H.; Bharagava, R.N.; Iqbal, H.M.N. Modifying bio-catalytic properties of enzymes for efficient biocatalysis: A review from immobilization strategies viewpoint. Biocatal. Biotransform. 2019, 37, 159–182. [Google Scholar] [CrossRef]
- Guimarães, D.; Cavaco-Paulo, A.; Nogueira, E. Design of liposomes as drug delivery system for therapeutic applications. Int. J. Pharmaceut. 2021, 601, 120571. [Google Scholar] [CrossRef]
- Boros, G.; Miko, E.; Muramatsu, H.; Weissman, D.; Emri, E.; Rozsa, D.; Nagy, G.; Juhasz, A.; Juhasz, I.; van der Horst, G. Transfection of pseudouridinemodified mRNA encoding CPD-photolyase leads to repair of DNA damage in human keratinocytes: A new approach with future therapeutic potential. J. Photochem. Photobiol. B Biol. 2013, 129, 93–99. [Google Scholar] [CrossRef] [PubMed]
- Garinis, G.A.; Mitchell, J.R.; Moorhouse, M.J.; Hanada, K.; de Waard, H.; Vandeputte, D.; Jans, J.; Brand, K.; Smid, M.; van der Spek, P.J.; et al. Transcriptome analysis reveals cyclobutane pyrimidine dimers as a major source of UV-induced DNA breaks. EMBO J. 2005, 24, 3952–3962. [Google Scholar] [CrossRef] [PubMed]
- Hegedűs, C.; Juhász, T.; Fidrus, E.; Janka, E.A.; Juhász, G.; Boros, G.; Paragh, G.; Uray, K.; Emri, G.; Remenyik, É.; et al. Cyclobutane pyrimidine dimers from UVB exposure induce a hypermetabolic state in keratinocytes via mitochondrial oxidative stress. Redox Biol. 2021, 38, 101808. [Google Scholar] [CrossRef]
- Hofer, A.; Legat, F.J.; Gruber-Wackernagel, A.; Quehenberger, F.; Wolf, P. Topical liposomal DNA-repair enzymes in polymorphic light eruption. Photochem. Photobiol. Sci. 2011, 10, 1118–1128. [Google Scholar] [CrossRef] [PubMed]
- Jans, J.; Schul, W.; Sert, Y.G.; Rijksen, Y.; Rebel, H.; Eker, A.P.; Nakajima, S.; van Steeg, H.; de Gruijl, F.R.; Yasui, A. Powerful skin cancer protection by a CPD-photolyase transgene. Curr. Biol. 2005, 15, 105–115. [Google Scholar] [CrossRef]
- Puig, S.; Granger, C.; Garre, A.; Trullàs, C.; Sanmartin, O.; Argenziano, G. Review of clinical evidence over 10 years on prevention and treatment of a film-forming medical device containing photolyase in the management of field cancerization in Actinic Keratosis. Dermatol. Ther. 2019, 9, 259–270. [Google Scholar] [CrossRef]
- Rahman, H.; Kumar, D.; Liu, T.; Okwundu, N.; Lum, D.; Florell, S.R.; Burd, C.E.; Boucher, K.M.; VanBrocklin, M.W.; Grossman, D. Aspirin protects melanocytes and keratinocytes against UVB-induced DNA damage in vivo. J. Investig. Dermatol. 2021, 141, 132–141.e133. [Google Scholar] [CrossRef]
- Schul, W.; Jans, J.; Rijksen, Y.M.; Klemann, K.H.; Eker, A.P.; deWit, J.; Nikaido, O.; Nakajima, S.; Yasui, A.; Hoeijmakers, J.H. Enhanced repair of cyclobutane pyrimidine dimers and improved UV resistance in photolyase transgenic mice. EMBO J. 2002, 21, 4719–4729. [Google Scholar] [CrossRef]
- Stege, H.; Roza, L.; Vink, A.A.; Grewe, M.; Ruzicka, T.; Grether-Beck, S.; Krutmann, J. Enzyme plus light therapy to repair DNA damage in ultraviolet-B-irradiated human skin. Proc. Natl. Acad. Sci. USA 2000, 97, 1790–1795. [Google Scholar] [CrossRef]
- Berardesca, E.; Bertona, M.; Altabas, K.; Altabas, V.; Emanuele, E. Reduced ultraviolet-induced DNA damage and apoptosis in human skin with topical application of a photolyase-containing DNA repair enzyme cream: Clues to skin cancer prevention. Mol. Med. Rep. 2012, 5, 570–574. [Google Scholar] [PubMed]
- Emanuele, E.; Spencer, J.M.; Braun, M. An experimental double-blind irradiation study of a novel topical product (TPF50) compared to other topical products with DNA repair enzymes, antioxidants, and growth factors with sunscreens: Implications for preventing skin aging and cancer. J. Drugs Dermatol. 2014, 13, 309–314. [Google Scholar]
- Luze, H.; Nischwitz, S.P.; Zalaudek, I.; Müllegger, R.; Kamolz, L.P. DNA repair enzymes in sunscreens and their impact on photoageing—A systematic review. Photodermatol. Photoimmunol. Photomed. 2020, 36, 424–432. [Google Scholar] [CrossRef] [PubMed]
- DeBoyes, T.; Kouba, D.; Ozog, D.; Fincher, E.; Moy, L.; Iwata, K.; Moy, R. Reduced number of actinic keratoses with topical application of DNA repair enzyme creams. J. Drugs Dermatol. 2010, 9, 1519–1521. [Google Scholar] [PubMed]
- Puviani, M.; Barcella, A.; Milani, M. Efficacy of a photolyase-based device in the treatment of cancerization field in patients with actinic keratosis and non-melanoma skin cancer. Giornale italiano di dermatologia e venereologia 2013, 148, 693–698. [Google Scholar] [PubMed]
- Giustini, S.; Miraglia, E.; Berardesca, E.; Milani, M.; Calvieri, S. Preventive long-term effects of a topical film-forming medical device with ultra-high UV protection filters and DNA repair enzyme in Xeroderma Pigmentosum: A retrospective study of eight cases. Case Rep. Dermatol. 2015, 6, 222–226. [Google Scholar] [CrossRef]
- Carducci, M.; Pavone, P.; De Marco, G.; Lovati, S.; Altabas, V.; Altabas, K.; Emanuele, E. Comparative effects of sunscreens alone vs sunscreens plus DNA repair enzymes in patients with actinic keratosis: Clinical and molecular findings from a 6-month, randomized, clinical study. J. Drugs Dermatol. 2015, 14, 986–990. [Google Scholar]
- Zhang, Z.H.; Qu, C.F.; Zhang, K.J.; He, Y.Y.; Zhao, X.; Yang, L.X.; Zheng, Z.; Ma, X.Y.; Wang, X.X.; Wang, W.Y.; et al. Adaptation to extreme antarctic environments revealed by the genome of a sea ice green alga. Curr. Biol. 2020, 30, 3330–3341. [Google Scholar] [CrossRef]
- An, M.L.; Zheng, Z.; Qu, C.F.; Wang, X.X.; Chen, H.; Shi, C.L.; Miao, J.L. The first (6-4) photolyase with DNA damage repair activity from the Antarctic microalga Chlamydomonas sp. ICE-L. Mutat. Res./Fundam. Mol. Mech. Mutagen. 2018, 809, 13–19. [Google Scholar] [CrossRef]
- Sidney, U. Formation of hydroxyproline in collagen. Science 1966, 152, 1335–1340. [Google Scholar]
- Liebel, F.; Kaur, S.; Ruvolo, E.; Kollias, N.; Southall, M.D. Irradiation of skin with visible light induces reactive oxygen species and matrix-degrading enzymes. J. Investig. Dermatol. 2012, 132, 1901–1907. [Google Scholar] [CrossRef] [PubMed]
- Montes de Oca, M.K.; Pearlman, R.L.; McClees, S.F.; Strickland, R.; Afaq, F. Phytochemicals for the prevention of photocarcinogenesis. Photochem. Photobiol. 2017, 93, 956–974. [Google Scholar] [PubMed]
- Chen, W.X.; Tang, Q.B.; Gonzales, M.S.; Bowden, G.T. Role of p38 MAP kinases and ERK in mediating ultraviolet-B induced cyclooxygenase-2 gene expression in human keratinocytes. Oncogene 2001, 20, 3921–3926. [Google Scholar] [CrossRef]
- Bhogal, R.K.; Bona, C.A. Regulatory effect of extracellular signal-regulated kinases (ERK) on type I collagen synthesis in human dermal fibroblasts stimulated by IL-4 and IL-13. Int. Rev. Immunol. 2008, 27, 472–496. [Google Scholar] [CrossRef] [PubMed]
- Efimova, T. p38 delta mitogen-activated protein kinase regulates skin homeostasis and tumorigenesis. Cell Cycle 2010, 9, 498–505. [Google Scholar] [CrossRef]
- Hammouda, M.B.; Ford, A.E.; Liu, Y.; Zhang, J.Y. The JNK signaling pathway in inflammatory skin disorders and cancer. Cells 2020, 9, 857. [Google Scholar] [CrossRef]
- Cooper, S.J.; Bowden, G.T. Ultraviolet B regulation of transcription factor families Roles of nuclear factor-kappa B (NF-κB) and activator protein-1 (AP-1) in UVB-induced skin carcino-genesis. Curr. Cancer Drug Tar. 2007, 7, 325–334. [Google Scholar] [CrossRef]
- Chakraborti, S.; Mandal, M.; Das, S.; Mandal, A.; Chakraborti, T. Regulation of matrix metalloproteinases: An overview. Mol. Cell. Biochem. 2003, 253, 269–285. [Google Scholar] [CrossRef]
- Kahari, V.M.; Saarialho-Kere, U. Matrix metalloproteinases in skin. Exp. Dermatol. 1997, 6, 199–213. [Google Scholar] [CrossRef]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef]
- Ramírez, N.; Serey, M.; Illanes, A.; Piumetti, M.; Ottone, C. Immobilization strategies of photolyases: Challenges and perspectives for DNA repairing application. J. Photoch. Photobio. B 2021, 215, 112113. [Google Scholar] [CrossRef] [PubMed]
- Costa, C.; Liu, Z.; Simões, S.I.; Correia, A.; Rahikkala, A.; Seitsonen, J.; Ruokolainen, J.; Aguiar-Ricardo, A.; Santos, H.A.; Corvo, M.L. One-step microfluidics production of enzyme-loaded liposomes for the treatment of inflammatory diseases. Colloids Surf. B Biointerfaces 2021, 199, 111556. [Google Scholar] [CrossRef]
- Matsumura, Y.; Ananthaswamy, H.N. Toxic effects of ultraviolet radiation on the skin. Toxicol. Appl. Pharmacol. 2004, 195, 298–308. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.Y.R.; Tan, C.L.; Chin, T.; Morenc, M.; Ho, C.Y.; Rovito, H.A.; Quek, L.S.; Soon, A.L.; Lim, J.S.Y.; Dreesen, O.; et al. Nicotinamide prevents UVB- and oxidative stress–induced photoaging in human primary keratinocytes. J. Investig. Dermatol. 2022, 142, 1670–1681.e1612. [Google Scholar] [CrossRef] [PubMed]
- Bérubé, R.; Drigeard Desgarnier, M.-C.; Douki, T.; Lechasseur, A.; Rochette, P.J. Persistence and tolerance of DNA damage Induced by chronic UVB irradiation of the human genome. J. Investig. Dermatol. 2018, 138, 405–412. [Google Scholar] [CrossRef]
- Bickers, D.R.; Athar, M. Oxidative stress in the pathogenesis of skin disease. J. Drugs Dermatol. 2006, 126, 2565–2575. [Google Scholar] [CrossRef]
- Dhar, A.; Young, M.R.; Colburn, N.H. The role of AP-1, NF-κB and ROS/NOS in skin carcinogenesis the JB6 model is predictive. Mol. Cell. Biochem. 2002, 234/235, 185–193. [Google Scholar] [CrossRef]
- Zhang, J.X.; Wang, X.L.; Vikash, V.; Ye, Q.; Wu, D.D.; Liu, Y.L.; Dong, W.G. ROS and ROS-mediated cellular signaling. Oxid. Med. Cell. Longev. 2016, 2016, 4350965. [Google Scholar] [CrossRef]
- Pillai, S.; Oresajo, C.; Hayward, J. Ultraviolet radiation and skin aging Roles of reactive oxygen species, inflammation and protease activation, and strategies for prevention of inflammation-induced matrix degradation—A review. Int. J. Cosmetic Sci. 2005, 27, 17–34. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.C.; Liao, P.Y.; Hung, S.J.; Ge, J.S.; Chen, S.M.; Lai, J.C.; Hsiao, Y.P.; Yang, J.H. Topical application of glycolic acid suppresses the UVB induced IL-6, IL-8, MCP-1 and COX-2 inflammation by modulating NF-κB signaling pathway in keratinocytes and mice skin. J. Dermatol. Sci. 2017, 86, 238–248. [Google Scholar] [CrossRef] [PubMed]
- Sharma, M.R.; Mitrani, R.; Werth, V.P. Effect of TNFα blockade on UVB-induced inflammatory cell migration and collagen loss in mice. J. Photochem. Photobiol. B Bio. 2020, 213, 112072. [Google Scholar] [CrossRef] [PubMed]
- Johnson, G.L.; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002, 298, 1911–1912. [Google Scholar] [CrossRef] [PubMed]
- Peus, D.; Vasa, R.A.; Meves, A.; Beyerle, A.; Pittelkow, M.R. UVB-induced epidermal growth factor receptor phosphorylation is critical for downstream signaling and keratinocyte survival. Photochem. Photobiol. 2010, 72, 135–140. [Google Scholar]
- Brennan, M.; Bhatti, H.; Nerusu, K.C.; Bhagavathula, N.; Kang, S.; Fisher, G.J. Matrix metalloproteinase-1 is the major collagenolytic enzyme responsible for collagen damage in UV-irradiated human skin. Photochem. Photobiol. 2010, 78, 43–48. [Google Scholar] [CrossRef]
- Dong, K.K.; Damaghi, N.; Picart, S.D.; Markova, N.G.; Obayashi, K.; Okano, Y.; Masaki, H.; Grether-Beck, S.; Krutmann, J.; Smiles, K.A.; et al. UV-induced DNA damage initiates release of MMP-1 in human skin. Exp. Dermatol. 2008, 17, 1037–1044. [Google Scholar] [CrossRef]
- Muthusamy, V.; Piva, T.J. The UV response of the skin: A review of the MAPK, NF-κB and TNF-α signal transduction pathways. Arch. Dermatol. Res. 2010, 302, 5. [Google Scholar] [CrossRef]
- Klotz, L.O.; Pellieux, C.; Briviba, K.; Pierlot, C.; Aubry, J.M.; Sies, H. Mitogen-activated protein kinase (p38-, JNK-, ERK-) activation pattern induced by extracellular and intracellular singlet oxygen and UVA. FEBS J. 1999, 260, 917–922. [Google Scholar] [CrossRef]
- Peus, D.; Vasa, R.A.; Beyerle, A.; Meves, A.; Pittelkow, M.R. UVB activates ERK1/2 and p38 signaling pathways via reactive oxygen species in cultured keratinocytes. J. Investig. Dermatol. 1999, 112, 751. [Google Scholar] [CrossRef]
- Kamata, H.; Honda, S.-I.; Maeda, S.; Chang, L.; Hirata, H.; Karin, M. Reactive oxygen species promote TNF-α-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell 2005, 120, 649–661. [Google Scholar] [CrossRef]










| No. | Independent Variables | Y1 (nm) | Y2 (%) | |||
|---|---|---|---|---|---|---|
| A | B | C | D | |||
| 1 | 1 | 0.066 | 3 | 12.5 | 215 | 60.0 |
| 2 | 4 | 0.066 | 3 | 12.5 | 110 | 24.5 |
| 3 | 1 | 0.2 | 3 | 12.5 | 153 | 40.0 |
| 4 | 4 | 0.2 | 3 | 12.5 | 120 | 20.0 |
| 5 | 2.5 | 0.133 | 1 | 5 | 200 | 62.0 |
| 6 | 2.5 | 0.133 | 5 | 5 | 200 | 55.0 |
| 7 | 2.5 | 0.133 | 1 | 20 | 97 | 49.0 |
| 8 | 2.5 | 0.133 | 5 | 20 | 116 | 44.3 |
| 9 | 1 | 0.133 | 3 | 5 | 170 | 74.4 |
| 10 | 4 | 0.133 | 3 | 5 | 81 | 50.0 |
| 11 | 1 | 0.133 | 3 | 20 | 117 | 50.0 |
| 12 | 4 | 0.133 | 3 | 20 | 58 | 40.0 |
| 13 | 2.5 | 0.066 | 1 | 12.5 | 163 | 74.7 |
| 14 | 2.5 | 0.2 | 1 | 12.5 | 146 | 60.0 |
| 15 | 2.5 | 0.066 | 5 | 12.5 | 213 | 47.9 |
| 16 | 2.5 | 0.2 | 5 | 12.5 | 53 | 42.0 |
| 17 | 1 | 0.133 | 1 | 12.5 | 155 | 67.8 |
| 18 | 4 | 0.133 | 1 | 12.5 | 102 | 40.0 |
| 19 | 1 | 0.133 | 5 | 12.5 | 253 | 78.2 |
| 20 | 4 | 0.133 | 5 | 12.5 | 150 | 50.0 |
| 21 | 2.5 | 0.066 | 3 | 5 | 262 | 71.0 |
| 22 | 2.5 | 0.2 | 3 | 5 | 98 | 65.0 |
| 23 | 2.5 | 0.066 | 3 | 20 | 140 | 60.0 |
| 24 | 2.5 | 0.2 | 3 | 20 | 66 | 52.0 |
| 25 | 2.5 | 0.133 | 3 | 12.5 | 99 | 78.5 |
| 26 | 2.5 | 0.133 | 3 | 12.5 | 118 | 72.3 |
| 27 | 2.5 | 0.133 | 3 | 12.5 | 115 | 74.0 |
| 28 | 2.5 | 0.133 | 3 | 12.5 | 89 | 68.8 |
| 29 | 2.5 | 0.133 | 3 | 12.5 | 69 | 60.8 |
| No. | Y1 | Y2 | ||||
|---|---|---|---|---|---|---|
| Mean Square | F-Value | p-Value | Mean Square | F-Value | p-Value | |
| Model | 5138.53 | 4.39 | 0.0045 | 337.75 | 2.50 | 0.0488 |
| A | 16,280.33 | 13.92 | 0.0022 | 1773.90 | 13.13 | 0.0028 |
| B | 18,174.08 | 15.54 | 0.0015 | 291.07 | 2.15 | 0.1642 |
| C | 1240.33 | 1.06 | 0.3205 | 108.60 | 0.80 | 0.3851 |
| D | 14,490.75 | 12.39 | 0.0034 | 561.70 | 4.16 | 0.0608 |
| AB | 1296.00 | 1.11 | 0.3103 | 60.06 | 0.44 | 0.5157 |
| AC | 625.00 | 0.53 | 0.4768 | 0.04 | 0.0003 | 0.9865 |
| AD | 225.00 | 0.19 | 0.6676 | 51.84 | 0.38 | 0.5455 |
| BC | 5112.25 | 4.37 | 0.0552 | 19.36 | 0.14 | 0.7107 |
| BD | 2025.00 | 1.73 | 0.2093 | 1.00 | 0.007 | 0.9327 |
| CD | 90.25 | 0.08 | 0.7852 | 1.32 | 0.01 | 0.9226 |
| A2 | 2160.41 | 1.85 | 0.1956 | 1329.98 | 9.85 | 0.0073 |
| B2 | 4094.70 | 3.50 | 0.0823 | 864.44 | 6.40 | 0.0240 |
| C2 | 9739.86 | 8.33 | 0.012 | 150.64 | 1.12 | 0.3088 |
| D2 | 454.97 | 0.39 | 0.5428 | 136.91 | 1.01 | 0.3311 |
| Residual | 1169.27 | 135.08 | ||||
| Lack of fit | 1475.77 | 3.66 | 0.1113 | 171.54 | 3.90 | 0.1006 |
| Pure error | 403.00 | 43.94 | ||||
| Gene | Prime Sequences (5′-3′) | |
|---|---|---|
| β-actin | Forward | TATGCTCTCCCTCACGCCATCC |
| Reverse | GTCACGCACGATTTCCCTCTCAG | |
| TNF-α | Forward | AGATGATCTGAGTGTGAGGGTCTGG |
| Reverse | CACCACGCTCTTCTGTCTACTGAAC | |
| COX-2 | Forward | CTGGTGCCTGGTCTGATGATGTATG |
| Reverse | GGATGCTCCTGCTTGAGTATGTCG | |
| IL-6 | Forward | CTTCTTGGGACTGATGCTGGTGAC |
| Reverse | TCTGTTGGGAGTGGTATCCTCTGT | |
| NF-κВ | Forward | GGATATGAGGAAGCGGCATGTAGAG |
| Reverse | CCTGATACTGGCACTTCGGACAAC | |
| JNK | Forward | CGCCTTATGTGGTGACTCGCTAC |
| Reverse | CTCCCATGATGCACCCAACTGAC | |
| ERK | Forward | GCCTTCCAACCTCCTGCTGAAC |
| Reverse | CGTACTCTGTCAAGAACCCTGTGTG | |
| P38 | Forward | CTGGCTCGGCACACTGATGATG |
| Reverse | GCCCACGGACCAAATATCCACTG | |
| AP-1 | Forward | CTTCTACGACGATGCCCTCAACG |
| Reverse | GCCAGGTTCAAGGTCATGCTCTG | |
| MMP-1 | Forward | ACAGTTGACAGGCTCCGAGAAATG |
| Reverse | CCACATCAGGCACTCCACATCTTG | |
| MMP-2 | Forward | ACCATGCGGAAGCCAAGATGTG |
| Reverse | AGGGTCCAGGTCAGGTGTGTAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qu, C.; Li, N.; Liu, T.; He, Y.; Miao, J. Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice. Int. J. Mol. Sci. 2022, 23, 15148. https://doi.org/10.3390/ijms232315148
Qu C, Li N, Liu T, He Y, Miao J. Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice. International Journal of Molecular Sciences. 2022; 23(23):15148. https://doi.org/10.3390/ijms232315148
Chicago/Turabian StyleQu, Changfeng, Nianxu Li, Tianlong Liu, Yingying He, and Jinlai Miao. 2022. "Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice" International Journal of Molecular Sciences 23, no. 23: 15148. https://doi.org/10.3390/ijms232315148
APA StyleQu, C., Li, N., Liu, T., He, Y., & Miao, J. (2022). Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice. International Journal of Molecular Sciences, 23(23), 15148. https://doi.org/10.3390/ijms232315148
