SYNCRIP Modulates the Epithelial-Mesenchymal Transition in Hepatocytes and HCC Cells
Abstract
:1. Introduction
2. Results
2.1. SYNCRIP Is Involved in TGFβ-Induced EMT of Hepatocytes
2.2. SYNCRIP Impairment Affects Mesenchymal Phenotype and Migratory Properties of HCC Cells
2.3. SYNCRIP Controls Anti- and Pro-EMT miRNA Levels
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.2. SYNCRIP Knockdown
4.3. RNA Extraction, RT-PCR, and Real-Time qPCR
4.4. Western Blotting
4.5. Immunofluorescence Analysis
4.6. Scratch Assay
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Dongre, A.; Weinberg, R.A. New insights into the mechanisms of epithelial–mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol. 2019, 20, 69–84. [Google Scholar] [CrossRef] [PubMed]
- Stemmler, P.; Eccles, R.L.; Brabletz, S.; Brabletz, T. Non-redundant functions of EMT transcription factors. Nat Cell Biol. 2019, 21, 102–112. [Google Scholar] [CrossRef]
- Pastushenko, I.; Blanpain, C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019, 29, 212–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serrano-Gomez, S.J.; Maziveyi, M.; Alahari, S.K. Regulation of epithelial–mesenchymal transition through epigenetic and post-translational modifications. Mol Cancer. 2016, 15, 18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garibaldi, F.; Cicchini, C.; Conigliaro, A.; Santangelo, L.; Cozzolino, A.M.; Grassi, G.; Marchetti, A.; Tripodi, M.; Amicone, L. An epistatic mini-circuitry between the transcription factors Snail and HNF4α controls liver stem cell and hepatocyte features exhorting opposite regulation on stemness-inhibiting microRNAs. Cell Death Differ. 2012, 19, 937–946. [Google Scholar] [CrossRef] [Green Version]
- Silveira, D.A.; Gupta, S.; Mombach, C.M. System biology approach suggests miRNAs as phenotypic stability factors in the epithelial–mesenchymal transition. Interface 2020, 17, 20200693. [Google Scholar] [CrossRef]
- Battistelli, C.; Cicchini, C.; Santangelo, L.; Tramontano, A.; Grassi, L.; Gonzalez, F.J.; de Nonno, V.; Grassi, G.; Amicone, L.; Tripodi, M. The Snail repressor recruits EZH2 to specific genomic sites through the enrollment of the lncRNA HOTAIR in epithelial-to-mesenchymal transition. Oncogene 2017, 36, 942–955. [Google Scholar] [CrossRef] [Green Version]
- Battistelli, C.; Sabarese, G.; Santangelo, L.; Montaldo, C.; Gonzalez, F.J.; Tripodi, M.; Cicchini, C. The lncRNA HOTAIR transcription is controlled by HNF4-induced chromatin topology modulation. Cell Death Differ. 2019, 26, 890–901. [Google Scholar] [CrossRef]
- Silveira, D.A.; Mombach, J.C.M. Dynamics of the feedback loops required for the phenotypic stabilization in the epithelial-mesenchymal transition. FEBS J. 2020, 287, 578–588. [Google Scholar] [CrossRef]
- Selvaggio, G.; Canato, S.; Pawar, A.; Monteiro, P.T.; Guerreiro, P.S.; Brás, M.M.; Janody, F.; Chaouiya, C. Hybrid Epithelial–Mesenchymal Phenotypes Are Controlled by Microenvironmental Factors. Cancer Res. 2020, 80, 2407–2420. [Google Scholar] [CrossRef] [Green Version]
- Geuens, T.; Bouhy, D.; Timmerman, V. The hnRNP family: Insights into their role in health and disease. Hum. Genet. 2016, 135, 851–867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Michelotti, E.F.; Michelotti, G.A.; Aronsohn, A.I.; Levens, D. Heterogeneous nuclear ribonucleoprotein K is a transcription factor. Mol. Cell Biol. 1996, 16, 2350–2360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ostrowski, J.; Kawata, Y.; Schullery, D.S.; Denisenko, O.N.; Bomsztyk, K. Transient recruitment of the hnRNP K protein to inducibly transcribed gene loci. Nucleic Acids Res. 2003, 31, 3954–3962. [Google Scholar] [CrossRef] [Green Version]
- Tomonaga, T.; Levens, D. Heterogeneous nuclear ribonucleoprotein K is a DNA-binding transactivator. J. Biol. Chem. 1995, 270, 4875–4881. [Google Scholar] [CrossRef] [Green Version]
- Mohanty, B.K.; Karam, J.A.Q.; Howley, B.V.; Dalton, A.C.; Grelet, S.; Dincman, T.; Streitfeld, W.S.; Yoon, J.H.; Balakrishnan, L.; Chazin, W.J.; et al. Heterogeneous nuclear ribonucleoprotein E1 binds polycytosine DNA and monitors genome integrity. Life Sci. Alliance 2021, 4, e202000995. [Google Scholar] [CrossRef]
- Tauler, J.; Zudaire, E.; Liu, H.; Shih, J.; Mulshine, J.L. HnRNP A2/B1 modulates epithelial-mesenchymal transition in lung cancer cell lines. Cancer Res. 2010, 70, 7137–7147. [Google Scholar] [CrossRef] [Green Version]
- Li, F.; Zhao, H.; Su, M.; Xie, W.; Fang, Y.; Du, Y.; Yu, Z.; Hou, L.; Tan, W. HnRNP-F regulates EMT in bladder cancer by mediating the stabilization of Snail1 mRNA by binding to its 3′ UTR. E Bio. Med. 2019, 45, 208–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hussey, G.S.; Chaudhury, A.; Dawson, A.E.; Lindner, D.J.; Knudsen, C.R.; Wilce, M.C.J.; Merrick, W.C.; Howe, P.H. Identification of an mRNP complex regulating tumorigenesis at the translational elongation step. Mol Cell. 2011, 41, 419–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaudhury, A.; Hussey, G.S.; Ray, P.S.; Jin, G.; Fox, P.L.; Howe, P.H. TGF-beta-mediated phosphorylation of hnRNP E1 induces EMT via transcript—Selective translational induction of Dab2 and ILEI. Nat. Cell Biol. 2010, 12, 286–293. [Google Scholar] [CrossRef] [Green Version]
- Zhang, T.; Huang, X.H.; Dong, L.; Hu, D.; Ge, C.; Zhan, Y.Q.; Xu, W.X.; Yu, M.; Li, W.; Wang, X.; et al. PCBP-1 regulates alternative splicing of the CD44 gene and inhibits invasion in human hepatoma cell line HepG2 cells. Mol Cancer. 2010, 9, 72. [Google Scholar] [CrossRef] [Green Version]
- Weidensdorfer, D.; Stöhr, N.; Baude, A.; Lederer, M.; Köhn, M.; Schierhorn, A.; Buchmeier, S.; Wahle, E.; Hüttelmaier, S. Control of c-myc mRNA stability by IGF2BP1-associated cytoplasmic RNPs. RNA 2009, 15, 104–115. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Chan, J.; Chen, W.; Li, J.; Sun, M.; Kannan, G.S.; Mok, Y.K.; Yuan, Y.A.; Jobichen, C. SYNCRIP, a new player in pri-let-7a processing. RNA 2020, 26, 290–305. [Google Scholar] [CrossRef]
- McDermott, S.M.; Meignin, C.; Rappsilber, J.; Davis, I. Drosophila Syncrip binds the gurken mRNA localization signal and regulates localized transcripts during axis specification. Biol. Open. 2012, 1, 488–497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McDermott, S.M.; Yang, L.; Halstead, J.M.; Hamilton, R.S.; Meignin, C.; Davis, I. Drosophila Syncrip modulates the expression of mRNAs encoding key synaptic proteins required for morphology at the neuromuscular junction. RNA 2014, 20, 1593–1606. [Google Scholar] [CrossRef] [Green Version]
- Kabat, J.L.; Barberan-Soler, S.; Zahler, A.M. HRP-2, the Caenorhabditis elegans homolog of mammalian heterogeneous nuclear ribonucleoproteins Q and R, is an alternative splicing factor that binds to UCUAUC splicing regulatory elements. J. Biol. Chem. 2009, 284, 28490–28497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Svitkin, Y.V.; Yanagiya, A.; Karetnikov, A.E.; Alain, T.; Fabian, M.R.; Khoutorsky, A.; Perreault, S.; Topisirovic, I.; Sonenberg, N. Control of translation and miRNA-dependent repression by a novel poly(A) binding protein, hnRNP-Q. PLoS Biol. 2013, 11, e1001564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bannai, H.; Fukatsu, K.; Mizutani, A.; Natsume, T.; Iemura, S.; Ikegami, T.; Inoue, T.; Mikoshiba, K. An RNA-interacting protein, SYNCRIP is a component of mRNA granule transported with inositol 1,4,5-trisphosphate receptor type 1 mRNA in neuronal dendrites. Mol. Basis Cell Dev. Biol. 2004, 279, 53427–53434. [Google Scholar] [CrossRef] [Green Version]
- Blanc, V.; Navaeatman, N.; Henderson, O.; Anant, S.; Kennedy, S.; Jarmuz, A.; Scott, J.; Davidson, N.O. Identification of GRY-RBP as an apolipoprotein B RNA-binding protein that interacts with both apobec-1 and apobec-1 complementation factor to odulate C to U editing. J. Biol. Chem. 2001, 276, 10272–10283. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.C.; Chang, J.G.; Lu, R.M.; Peng, T.Y.; Tarn, W.Y. The RNA binding protein hnRNP Q modulates the utilization of exon 7 in the survival motor neuron 2 (SMN2) gene. Mol. Cell Biol. 2008, 28, 6929–6938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grosset, C.; Chen, C.Y.; Xu, N.; Sonenberg, N.; Jacquemin-Sablon, H.; Shyu, A.B. A mechanism for translationally coupled mRNA turnover: Interaction between the poly(A) tail and c-fos RNA coding determinant via a protein complex. Cell 2000, 103, 29–40. [Google Scholar] [CrossRef] [Green Version]
- Kanai, Y.; Dohmae, N.; Hirokawa, N. Kinesin transports RNA: Isolation and characterization of an RNA-transporting granule. Neuron 2004, 43, 513–525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mourelatos, Z.; Abel, L.; Yong, J.; Kataoka, N.; Dreyfuss, G. SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J. 2001, 20, 5443–5452. [Google Scholar] [CrossRef] [Green Version]
- Santangelo, L.; Giurato, G.; Cicchini, C.; Montaldo, C.; Mancone, C.; Tarallo, R.; Battistelli, C.; Alonzi, T.; Weisz, A.; Tripodi, M. The RNA-binding protein SYNCRIP is a component of the hepatocyte exosomal machinery controlling microRNA sorting. Cell Rep. 2016, 17, 799–808. [Google Scholar] [CrossRef] [Green Version]
- Hobor, F.; Dallmann, A.; Ball, N.J.; Cicchini, C.; Battistelli, C.; Ogrodowicz, R.W.; Christodoulou, E.; Martin, S.R.; Castello, A.; Tripodi, M.; et al. A cryptic RNA-binding domain Syncrip recognition and exosomal partitioning of miRNA targets. Nat. Commun. 2018, 9, 831. [Google Scholar] [CrossRef] [PubMed]
- Williams, K.R.; McAnicnch, D.S.; Stefanovic, S.; Xing, L.; Allen, M.; Li, W.; Feng, Y.; Mihailescu, M.R.; Bassell, G.J. HnRNP-Q1 represses nascent axon growth in cortical neurons by inhibiting Gap-43 mRNA translation. Mol. Biol. Cell. 2016, 27, 518–534. [Google Scholar] [CrossRef] [PubMed]
- Yoo, B.C.; Hong, S.H.; Ku, J.L.; Kim, Y.H.; Shin, Y.K.; Jang, S.G.; Kim, I.J.; Jeong, S.Y.; Park, J.G. Galectin-3 stabilizes heterogeneous nuclear ribonucleoprotein Q to maintain proliferation of human colon cancer cells. Cell Mol. Life Sci. 2009, 66, 350–364. [Google Scholar] [CrossRef]
- Vu, L.P.; Prieto, C.; Amin, E.M.; Chhangawala, S.; Krivtsov, A.; Calvo-Vidal, M.N.; Chou, T.; Chow, A.; Minuesa, G.; Park, S.M.; et al. Functional screen of MSI2 interactors identifies an essential role for SYNCRIP in myeloid leukemia stem cells. Nat. Genet. 2017, 49, 866–875. [Google Scholar] [CrossRef] [Green Version]
- Yuan, L.; Xiao, Y.; Zhou, Q.; Yuan, D.; Wu, B.; Chen, G.; Zhou, J. Proteomic analysis reveals that MAEL, a component of nuage, interacts with stress granule proteins in cancer cells. Oncol. Rep. 2014, 31, 342–350. [Google Scholar] [CrossRef] [Green Version]
- Zhang, P.; Cao, M.; Zhang, Y.; Xu, L.; Meng, F.; Wu, X.; Xia, T.; Chen, Q.; Shi, G.; Wu, P.; et al. A novel antisense lncRNA NT5E promotes progression by modulating the expression of SYNCRIP and predicts a poor prognosis in pancreatic cancer. J. Cell. Mol. Med. 2020, 24, 10898–10912. [Google Scholar] [CrossRef]
- Uhlen, M.; Zhang, C.; Lee, S.; Sjöstedt, E.; Fagerberg, L.; Bidkhori, G.; Benfeitas, R.; Arif, M.; Liu, Z.; Edfors, F.; et al. A pathology atlas of the human cancer transcriptome. Science 2017, 357, 6352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giannelli, G.; Koudelkova, P.; Dituri, F.; Mikulits, W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J. Hepatol. 2016, 65, 798–808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, Y.; Wang, J.; Han, J.; Luo, D.; Sun, Z. MiR-122 inhibits epithelial-mesenchymal transition in hepatocellular carcinoma by targeting Snail1 and Snail2 and suppressing WNT/beta-cadherin signaling pathway. Exp. Cell Res. 2017, 360, 210–217. [Google Scholar] [CrossRef]
- Gregory, P.A.; Bert, A.G.; Paterson, E.L.; Barry, S.C.; Tsykin, A.; Farshid, G.; Vadas, M.A.; Khew-Goodall, Y.; Goodall, G.J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol. 2008, 10, 593–601. [Google Scholar] [CrossRef] [PubMed]
- Park, S.M.; Gaur, A.B.; Lengyel, E.; Peter, M.E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008, 22, 894–907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korpal, M.; Lee, E.S.; Hu, G.; Kang, K. The miR-200 family inhibits epithelial–mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J. Biol. Chem. 2008, 283, 14910–14914. [Google Scholar] [CrossRef] [Green Version]
- Burk, U.; Schubert, J.; Wellner, U.; Schmalhofer, O.; Vincan, E.; Spaderna, S.; Brabletz, T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep. 2008, 9, 582–589. [Google Scholar] [CrossRef] [Green Version]
- Yoo, J.O.; Kwak, S.Y.; An, Y.J.; Bae, I.H.; Park, M.J.; Han, Y.H. miR-181b-3p promotes epithelial–mesenchymal transition in breast cancer cells through Snail stabilization by directly targeting YWHAG. Biochim. Biophys. Acta 2016, 1863, 1601–1611. [Google Scholar] [CrossRef]
- Taylor, M.A.; Sossey-Alaoui, K.; Thompson, C.L.; Danielpour, D.; Schiemann, W.P. TGF-beta upregulates miR-181a expression to promote breast cancer metastasis. J. Clin. Investig. 2013, 123, 150–163. [Google Scholar] [CrossRef] [Green Version]
- Chen, K.J.; Hou, Y.; Wang, K.; Li, J.; Xia, Y.; Yang, X.; Lv, G.; Xing, X.L.; She, F. Repression of Let-7g microRNA inhibits the proliferation and migration via K-Ras/HMGA2/Snail axis in hepatocellular carcinoma. BioMed Res. Int. 2014, 2014, 742417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, L.; Wang, Y. Long non-coding RNA NEAT1 facilitates the growth, migration, and invasion of ovarian cancer cells via the let-7g/MEST/ATGL axis. Cancer Cell Int. 2021, 21, 437. [Google Scholar] [CrossRef] [PubMed]
- Gao, Z.; Shi, Y.; Wang, J.; Li, W.; Bao, Y.; Wu, D.; Gu, Y. Long non-coding RNA NEAT1 absorbs let-7g-5p to induce epithelial–mesenchymal transition of colon cancer cells through upregulating BACH1. Dig. Liver Dis. 2021; in press. [Google Scholar] [CrossRef]
- Noce, V.; Battistelli, C.; Cozzolino, A.M.; Consalvi, V.; Cicchini, C.; Strippoli, R.; Tripodi, M.; Marchetti, A.; Amicone, L. YAP integrates the regulatory Snail/HNF4 circuitry controlling epithelial/hepatocyte differentiation. Cell Death Diff. 2019, 10, 768. [Google Scholar] [CrossRef]
- Bisceglia, F.; Battistelli, C.; Noce, V.; Montaldo, C.; Zammataro, A.; Strippoli, R.; Tripodi, M.; Amicone, L.; Marchetti, A. TGF impairs HNF1 functional activity in epithelial-to-mesenchymal transition interfering with the recruitment of CBP/p300 acetyltransferases. Front. Pharmacol. 2019, 10, 942. [Google Scholar] [CrossRef]
- Santangelo, L.; Marchetti, A.; Cicchini, C.; Conigliaro, A.; Conti, B.; Mancone, C.; Bonzo, J.A.; Gonzalez, F.J.; Alonzi, T.; Amicone, L.; et al. The stable repression of mesenchymal program is required for hepatocyte identity: A novel role for hepatocyte nuclear factor 4. Hepatology 2011, 53, 2063–2074. [Google Scholar] [CrossRef]
- Bracken, C.P.; Li, X.; Wright, J.A.; Lawrence, D.M.; Pillman, K.A.; Salmanidis, M.; Anderson, M.A.; Dredge, K.; Gregory, P.A.; Tsykin, A.; et al. Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion. EMBO J. 2014, 33, 2040–2056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lagos-Quintana, M.; Rauhut, R.; Yalcin, A.; Meyer, J.; Lendeckel, W.; Tuschl, T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002, 12, 735–739. [Google Scholar] [CrossRef] [Green Version]
- Gohring, F.; Fackelmayer, F.O. The scaffold/matrix attachment region binding protein hnRNP-U (SAF-A) is directly bound to chromosomal DNA in vivo: A chemical crosslinking study. Biochemistry 1997, 36, 8276–8283. [Google Scholar] [CrossRef]
- Ritchie, S.A.; Pasha, M.K.; Batten, D.J.P.; Sharma, R.K.; Olson, D.J.H.; Ross, A.R.S.; Bonham, K. Identification of the SRC pyrimidine-binding protein (Spy) as hnRNP K: Implications in the regulation of SRC1A transcription. Nucleic Acids Res. 2003, 31, 1502–1513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martens, J.H.A.; Verlaan, M.; Kalkhoven, E.; Dorsman, J.C.; Zantema, A. Scaffold/matrix attachment region elements interact with a p300-scaffold attachment factor a complex and are bound by acetylated nucleosomes. Mol. Cell Biol. 2002, 22, 2598–2606. [Google Scholar] [CrossRef] [Green Version]
- Shnyreva, M.; Schullery, D.S.; Suzuki, H.; Higaki, Y.; Bomsztyk, K. Interaction of two multifunctional proteins: Heterogeneous nuclear ribonucleoprotein K and Y-BOX-binding protein. J. Biol. Chem. 2000, 275, 15498–15503. [Google Scholar] [CrossRef] [Green Version]
- Fontana, A.; Barbano, R.; Dama, E.; Pasculli, B.; Rendina, M.; Morritti, M.G.; Melocchi, V.; Castelvetere, M.; Valori, V.M.; Ravaioli, S. Combined analysis of miR-200 family and its significance for breast cancer. Sci. Rep. 2021, 11, 2980. [Google Scholar] [CrossRef]
- Pichler, M.; Ress, A.L.; Winter, E.; Stiegelbauer, V.; Karbiener, M.; Schwarzenbacher, D.; Scheideler, M.; Ivan, C.; Jahn, S.W.; Kiesslich, T.; et al. MiR-200a regulates epithelial to mesenchymal transition-related gene expression and determines prognosis in colorectal patients. Br. J. Cancer 2014, 110, 1614–1621. [Google Scholar] [CrossRef] [Green Version]
- Deng, J.; Chen, S.; Wang, F.; Zhao, H.; Xie, Z.; Xu, Z.; Zhang, Q.; Liang, P.; Zhai, X.; Cheng, Y. Effects of hnRNP 12/B1 knockdown on inhibition of glioblastoma cell invasion, growth and survival. Mol. Neurobiol. 2016, 53, 1132–1144. [Google Scholar] [CrossRef] [PubMed]
- Gu, W.J.; Liu, H.L. Induction of pancreatic cancer cell apoptosis, invasion, migration, and enhancement of chemotherapy sensitivity of gemcitabine, 5-FU, and oxaliplatin by hnRNP A2/B1 siRNA. Anticancer. Drugs 2013, 24, 566–576. [Google Scholar] [CrossRef]
- Zhang, J.F.; Liu, X.L.; Lin, Y.D.; Li, Y.L.; Pan, J.W.; Zong, S.; Li, Y.K.; Zhou, Y. HnRNP-K contributes to drug resistance in acute myeloid leukemia through the regulation of autophagy. Exp. Hematol. 2016, 44, 850–856. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Kim, C.; Kang, H.; Tak, H.; Ahn, S.; Yoon, S.K.; Kuh, H.J.; Kim, W.; Lee, E.K. microRNA-200a-3p increases 5-fluorouracil resistance by regulating dual specificity phosphatase 6 expression. Exp. Mol. Med. 2017, 49, e327. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.H.; Mohan, C.D.; Deivasigamani, A.; Jung, Y.Y.; Rangappa, S.; Basappa, S.; Chinnathambi, A.; Alahmadi, T.A.; Alharbi, S.A.; Garg, M.; et al. Brustanol suppresses STAT3-driven metastasis by downregulating epithelial-mesenchymal transition in hepatocellular carcinoma. J. Adv. Res. 2020, 13, 83–94. [Google Scholar] [CrossRef] [PubMed]
- Conigliaro, A.; Amicone, L.; Costa, V.; De Santis Puzzonia, M.; Mancone, C.; Sacchetti, B.; Cicchini, C.; Garibaldi, F.; Brenner, D.A.; Kisseleva, T.; et al. Evidence for a common progenitor of epithelial and mesenchymal components of the liver. Cell Death Differ. 2013, 20, 1116–1123. [Google Scholar] [CrossRef] [Green Version]
- Battistelli, C.; Garbo, S.; Riccioni, V.; Montaldo, C.; Santangelo, L.; Vandelli, A.; Strippoli, R.; Tartaglia, G.G.; Tripodi, M.; Cicchini, C. Design and Functional Validation of a Mutant Variant of the LncRNA HOTAIR to Counteract Snail Function in Epithelial-to-Mesenchymal Transition. Cancer Res. 2021, 81, 103–113. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence |
---|---|
SYNCRIP | For ACCTTGCCAACACGTAACA Rev CCATAGCCTTGACACACCA |
Snail | For CCACTGCAACCGTGCTTTT Rev CACATCCGATGGGTTTGG |
E-cadherin | For CTACTGTTTCTACGGAGGAG Rev CTCAAATCAAAGTCCTGGTC |
HNF1 | For TATCATGGCCTCGCTACCTG Rev ACTCCCCATGCTGTTGATGA |
Vimentin | For AGCAGTATGAAAGCGTGGCT Rev CTCCAGGGACTCGTTAGTGC |
N-cadherin | For GTGGAGGCTTCTGGTGAAAT Rev CTGCTGGCTCGCTGCTT |
18S | For ACGACCCATTCGAACGTCTG Rev GCACGGCGACTACCATCG |
mmu-pri-mir-122 | For GCTGTGGAGTGTGACAATGG Rev GAGTGGACGGATTGCCTAGC |
mmu-pri-mir-let7g | For CGCTCCGTTCTCTTTTGCC Rev CTCCTGTACCGGGTGGTATC |
mmu-pri-mir-200a | For GGCCTCTGTGGGCATCTTAC Rev GGTGGGTCACCTTTGAACAT |
mmu-pri-mir-181a-1 | For CACATCTCTGCCTCACAGGT Rev AGGGTACAATCAACGGTCG |
mmu-pri-mir-181b-1 | For ATTCATTGCTGTCGGTGGGT Rev AAAAAGCGGGGCCACAGTTG |
mmu-miR-122-5p | TGGATGTGACAATGGTGTTTG |
mmu-miR-let7g-5p | TGAGGTAGTAGTTGTACAGTT |
mmu-miR-200a-5p | CATCTTACCGGACATGCTGGA |
mmu-miR-181a1-3p | ACCATCGACCGTGATTGTACC |
mmu-miR-181b1-3p | CTCACTGAACAATGAATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Riccioni, V.; Trionfetti, F.; Montaldo, C.; Garbo, S.; Marocco, F.; Battistelli, C.; Marchetti, A.; Strippoli, R.; Amicone, L.; Cicchini, C.; et al. SYNCRIP Modulates the Epithelial-Mesenchymal Transition in Hepatocytes and HCC Cells. Int. J. Mol. Sci. 2022, 23, 913. https://doi.org/10.3390/ijms23020913
Riccioni V, Trionfetti F, Montaldo C, Garbo S, Marocco F, Battistelli C, Marchetti A, Strippoli R, Amicone L, Cicchini C, et al. SYNCRIP Modulates the Epithelial-Mesenchymal Transition in Hepatocytes and HCC Cells. International Journal of Molecular Sciences. 2022; 23(2):913. https://doi.org/10.3390/ijms23020913
Chicago/Turabian StyleRiccioni, Veronica, Flavia Trionfetti, Claudia Montaldo, Sabrina Garbo, Francesco Marocco, Cecilia Battistelli, Alessandra Marchetti, Raffaele Strippoli, Laura Amicone, Carla Cicchini, and et al. 2022. "SYNCRIP Modulates the Epithelial-Mesenchymal Transition in Hepatocytes and HCC Cells" International Journal of Molecular Sciences 23, no. 2: 913. https://doi.org/10.3390/ijms23020913