Characterization of Adherent-Invasive Escherichia coli (AIEC) Outer Membrane Proteins Provides Potential Molecular Markers to Screen Putative AIEC Strains
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Phylogenetic Analyses
2.3. Phenotypic Identification of AIEC Strains
2.4. Outer Membrane Protein Extraction
2.5. Two-Dimensional Polyacrylamide Gel Electrophoresis (2D-PAGE)
2.6. Images Analysis and Protein Identification
2.7. PCR Assay
2.8. Gene Screening
2.9. Gene Markers and Classifier Validation
2.10. Statistical Analysis
3. Results
3.1. Identification of AIEC Strains Isolated from Patients with Crohn’s Disease
3.2. Outer Membrane Protein Profiles of Putative AIEC Strains
3.3. Frequency of Detection and Distribution of the Genes Encoding OMPs of Interest
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Darfeuille-Michaud, A.; Neut, C.; Barnich, N.; Lederman, E.; Di Martino, P.; Desreumaux, P.; Gambiez, L.; Joly, B.; Cortot, A.; Colombel, J.F. Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn’s disease. Gastroenterology 1998, 115, 1405–1413. [Google Scholar] [CrossRef]
- Glasser, A.-L.; Boudeau, J.; Barnich, N.; Perruchot, M.-H.; Colombel, J.-F.; Darfeuille-Michaud, A. Adherent Invasive Escherichia coli Strains from Patients with Crohn’s Disease Survive and Replicate within Macrophages without Inducing Host Cell Death. Infect. Immun. 2001, 69, 5529–5537. [Google Scholar] [CrossRef]
- Boudeau, J.; Glasser, A.-L.; Masseret, E.; Joly, B.; Darfeuille-Michaud, A. Invasive Ability of an Escherichia coli Strain Isolated from the Ileal Mucosa of a Patient with Crohn’s Disease. Infect. Immun. 1999, 67, 4499–4509. [Google Scholar] [CrossRef] [PubMed]
- Darfeuille-Michaud, A.; Boudeau, J.; Bulois, P.; Neut, C.; Glasser, A.-L.; Barnich, N.; Bringer, M.-A.; Swidsinski, A.; Beaugerie, L.; Colombel, J.-F. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn’s disease. Gastroenterology 2004, 127, 412–421. [Google Scholar] [CrossRef] [PubMed]
- Dogan, B.; Klaessig, S.; Rishniw, M.; Almeida, R.A.; Oliver, S.P.; Simpson, K.; Schukken, Y.H. Adherent and invasive Escherichia coli are associated with persistent bovine mastitis. Vet. Microbiol. 2006, 116, 270–282. [Google Scholar] [CrossRef]
- Manchester, A.C.; Hill, S.; Sabatino, B.; Armentano, R.; Carroll, M.; Kessler, B.; Miller, M.; Dogan, B.; McDonough, S.P.; Simpson, K.W. Association between Granulomatous Colitis in French Bulldogs and Invasive Escherichia coli and Response to Fluoroquinolone Antimicrobials. J. Vet. Intern. Med. 2013, 27, 56–61. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Medina, M.; Garcia-Gil, J.; Barnich, N.; Wieler, L.H.; Ewers, C. Adherent-invasive Escherichia coli phenotype displayed by intestinal pathogenic E. coli strains from cats, dogs, and swine. Appl. Environ. Microbiol. 2011, 77, 5813–5817. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Medina, M.; Garcia-Gil, L.J. Escherichia coli in chronic inflammatory bowel diseases: An update on adherent invasive Escherichia coli pathogenicity. World J. Gastrointest. Pathophysiol. 2014, 5, 213. [Google Scholar] [CrossRef]
- Lai, X.-H.; Xu, J.-G.; Melgar, S.; Uhlin, B.E. An apoptotic response by J774 macrophage cells is common upon infection with diarrheagenic Escherichia coli. FEMS Microbiol. Lett. 1999, 172, 29–34. [Google Scholar] [CrossRef]
- Barnich, N.; Boudeau, J.; Claret, L.; Darfeuille-Michaud, A. Regulatory and functional co-operation of flagella and type 1 pili in adhesive and invasive abilities of AIEC strain LF82 isolated from a patient with Crohn’s disease. Mol. Microbiol. 2003, 48, 781–794. [Google Scholar] [CrossRef]
- Carvalho, F.A.; Barnich, N.; Sauvanet, P.; Darcha, C.; Gelot, A.; Darfeuille-Michaud, A. Crohn’s disease-associated Escherichia coli LF82 aggravates colitis in injured mouse colon via signaling by flagellin. Inflamm. Bowel Dis. 2008, 14, 1051–1060. [Google Scholar] [CrossRef] [PubMed]
- Chassaing, B.; Rolhion, N.; De Vallée, A.; Salim, S.Y.; Prorok-Hamon, M.; Neut, C.; Campbell, B.J.; Söderholm, J.D.; Hugot, J.P.; Colombel, J.F.; et al. Crohn disease-associated adherent-invasive E. coli bacteria target mouse and human Peyer’s patches via long polar fimbriae. J. Clin. Investig. 2011, 121, 966–975. [Google Scholar] [CrossRef] [PubMed]
- Cieza, R.J.; Hu, J.; Ross, B.N.; Sbrana, E.; Torres, A.G. The IbeA invasin of adherent-invasive Escherichia coli mediates nteraction with intestinal epithelia and macrophages. Infect. Immun. 2015, 83, 1904–1918. [Google Scholar] [CrossRef] [PubMed]
- Dogan, B.; Suzuki, H.; Herlekar, D.; Sartor, B.R.B.; Campbell, B.J.; Roberts, C.L.; Stewart, K.; Scherl, E.J.; Araz, Y.; Bitar, P.P.; et al. Inflammation-associated adherent-invasive escherichia coli are enriched in pathways for use of propanediol and iron and M-cell translocation. Inflamm. Bowel Dis. 2014, 20, 1919–1932. [Google Scholar] [CrossRef] [PubMed]
- Nash, J.H.E.; Villegas, A.; Kropinski, A.M.; Aguilar-Valenzuela, R.; Konczy, P.; Mascarenhas, M.; Ziebell, K.; Torres, A.G.; Karmali, M.A.; Coombes, B.K. Genome sequence of adherent-invasive Escherichia coli and comparative genomic analysis with other E. coli pathotypes. BMC Genom. 2010, 11, 667. [Google Scholar] [CrossRef]
- Camprubí-Font, C.; Martinez-Medina, M. Why the discovery of adherent-invasive Escherichia coli molecular markers is so challenging? World J. Biol. Chem. 2020, 11, 1–13. [Google Scholar] [CrossRef]
- Martinez-Medina, M.; Aldeguer, X.; Lopez-Siles, M.; González-Huix, F.; López-Oliu, C.; Dahbi, G.; Blanco, J.E.; Blanco, J.; Garcia-Gil, J.L.; Darfeuille-Michaud, A. Molecular diversity of Escherichia coli in the human gut: New ecological evidence supporting the role of adherent-invasive E. coli (AIEC) in Crohnʼs disease. Inflamm. Bowel Dis. 2009, 15, 872–882. [Google Scholar] [CrossRef]
- De la Fuente, M.; Franchi, L.; Araya, D.; Díaz-Jiménez, D.; Olivares, M.; Álvarez-Lobos, M.; Golenbock, D.; González, M.-J.; López-Kostner, F.; Quera, R.; et al. Escherichia coli isolates from inflammatory bowel diseases patients survive in macrophages and activate NLRP3 inflammasome. Int. J. Med. Microbiol. 2014, 304, 384–392. [Google Scholar] [CrossRef]
- Zhang, Y.; Rowehl, L.; Krumsiek, J.M.; Orner, E.P.; Shaikh, N.; Tarr, P.I.; Sodergren, E.; Weinstock, G.M.; Boedeker, E.C.; Xiong, X.; et al. Identification of candidate adherent-invasive E. coli signature transcripts by genomic/transcriptomic analysis. PLoS ONE 2015, 10, e0130902. [Google Scholar] [CrossRef]
- Delmas, J.; Gibold, L.; Faïs, T.; Batista, S.; Leremboure, M.; Sinel, C.; Vazeille, E.; Cattoir, V.; Buisson, A.; Barnich, N.; et al. Metabolic adaptation of adherent-invasive Escherichia coli to exposure to bile salts. Sci. Rep. 2019, 9, 1–13. [Google Scholar]
- Koebnik, R.; Locher, K.P.; Van Gelder, P. Structure and function of bacterial outer membrane proteins: Barrels in a nutshell. Mol. Microbiol. 2000, 37, 239–253. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Huang, S.; Zhang, Q. Outer membrane proteins: Key players for bacterial adaptation in host niches. Microbes Infect. 2002, 4, 325–331. [Google Scholar] [CrossRef]
- Céspedes, S.; Saitz, W.; Del Canto, F.; De la Fuente, M.; Quera, R.; Hermoso, M.; Muñoz, R.; Ginard, D.; Khorrami, S.; Girón, J.; et al. Genetic Diversity and Virulence Determinants of Escherichia coli Strains Isolated from Patients with Crohn’s Disease in Spain and Chile. Front. Microbiol. 2017, 8, 639. [Google Scholar] [CrossRef] [PubMed]
- Clarke, D.J.; Chaudhuri, R.R.; Martin, H.M.; Campbell, B.J.; Rhodes, J.M.; Constantinidou, C.; Pallen, M.J.; Loman, N.J.; Cunningham, A.F.; Browning, D.F.; et al. Complete Genome Sequence of the Crohn’s Disease-Associated Adherent-Invasive Escherichia coliStrain HM605. J. Bacteriol. 2011, 193, 4540. [Google Scholar] [CrossRef]
- Dupont, H.L.; Formal, S.B.; Hornick, R.B.; Snyder, M.J.; Libonati, J.P.; Sheahan, D.G.; Labrec, E.H.; Kalas, J.P. Pathogenesis of Escherichia coli Diarrhea. N. Engl. J. Med. 1971, 285, 1–9. [Google Scholar] [CrossRef]
- Montero, D.; Orellana, P.; Gutiérrez, D.; Araya, D.; Salazar, J.C.; Prado, V.; Oñate, A.; Del Canto, F.; Vidal, R. Immunoproteomic analysis to identify Shiga toxin-producing Escherichia coli outer membrane proteins expressed during human infection. Infect. Immun. 2014, 82, 4767–4777. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ribot, E.M.; Fair, M.A.; Gautom, R.; Cameron, D.N.; Hunter, S.B.; Swaminathan, B.; Barrett, T.J. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog. Dis. 2006, 3, 59–67. [Google Scholar] [CrossRef]
- Gardner, S.N.; Slezak, T.; Hall, B.G. kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome. Bioinformatics 2015, 31, 2877–2878. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, W242–W245. [Google Scholar] [CrossRef]
- Waters, N.R.; Abram, F.; Brennan, F.; Holmes, A.; Pritchard, L. Easy phylotyping of Escherichia coli via the EzClermont web app and command-line tool. Access Microbiol. 2020, 2, acmi000143. [Google Scholar] [CrossRef]
- Iebba, V.; Conte, M.P.; Lepanto, M.S.; Di Nardo, G.; Santangelo, F.; Aloi, M.; Totino, V.; Checchi, M.P.; Longhi, C.; Cucchiara, S.; et al. Microevolution in fimH Gene of Mucosa-Associated Escherichia coli Strains Isolated from Pediatric Patients with Inflammatory Bowel Disease. Infect. Immun. 2012, 80, 1408–1417. [Google Scholar] [CrossRef] [PubMed]
- Rosa, A.C.P.; Vieira, M.A.M.; Tibana, A.; Gomes, T.A.T.; Andrade, J.R.C. Interactions of Escherichia coli strains of non-EPEC serogroups that carry eae and lack the EAF and stx gene sequences with undifferentiated and differentiated intestinal human Caco-2 cells. FEMS Microbiol. Lett. 2001, 200, 117–122. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chassaing, B.; Etienne-Mesmin, L.; Bonnet, R.; Darfeuille-Michaud, A. Bile salts induce long polar fimbriae expression favouring Crohn’s disease-associated adherent-invasive Escherichia coli interaction with Peyer’s patches. Environ. Microbiol. 2013, 15, 355–371. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Clermont, O.; Bonacorsi, S.; Bingen, E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef]
- Sahl, J.W.; Gregory Caporaso, J.; Rasko, D.A.; Keim, P. The large-scale blast score ratio (LS-BSR) pipeline: A method to rapidly compare genetic content between bacterial genomes. PeerJ 2014, 2014, e332. [Google Scholar] [CrossRef] [PubMed]
- Haldane, J.B.S. The Mean and Variance of|chi 2, When Used as a Test of Homogeneity, When Expectations are Small. Biometrika 1940, 31, 346. [Google Scholar] [CrossRef]
- Kendrick, N.; Darie, C.C.; Hoelter, M.; Powers, G.; Johansen, J. 2D SDS PAGE in Combination with Western Blotting and Mass Spectrometry Is a Robust Method for Protein Analysis with Many Applications. In Advancements of Mass Spectrometry in Biomedical Research; Springer: Berlin/Heidelberg, Germany, 2019; Volume 1140, pp. 563–574. ISBN 978-3-030-15949-8. [Google Scholar]
- Perna, A.; Hay, E.; Contieri, M.; De Luca, A.; Guerra, G.; Lucariello, A. Adherent-invasive Escherichia coli (AIEC): Cause or consequence of inflammation, dysbiosis, and rupture of cellular joints in patients with IBD? J. Cell. Physiol. 2020, 235, 5041–5049. [Google Scholar] [CrossRef]
- Zgur-bertok, D.; Star, M. Virulence potential for extraintestinal infections among commensal Escherichia coli isolated from healthy humans—The Trojan horse within our gut. FEMS Microbiol. Lett. 2015, 362, fnu061. [Google Scholar]
- Kotlowski, R.; Bernstein, C.N.; Sepehri, S.; Krause, D.O. High prevalence of Escherichia coli belonging to the B2+D phylogenetic group in inflammatory bowel disease. Gut 2007, 56, 669–675. [Google Scholar] [CrossRef] [PubMed]
- Bingen, E.; Picard, B.; Brahimi, N.; Mathy, S.; Desjardins, P.; Elion, J.; Denamur, E. Phylogenetic analysis of Escherichia coli strains causing neonatal meningitis suggests horizontal gene transfer from a predominant pool of highly virulent B2 group strains. J. Infect. Dis. 1998, 177, 642–650. [Google Scholar] [CrossRef] [PubMed]
- Picard, B.; Garcia, J.S.; Gouriou, S.; Duriez, P.; Brahimi, N.; Bingen, E.; Elion, J.; Denamur, E. The link between phylogeny and virulence in Escherichia coli extraintestinal infection? Infect. Immun. 1999, 67, 546–553. [Google Scholar] [CrossRef] [PubMed]
- Kukkonen, M.; Korhonen, T.K. The omptin family of enterobacterial surface proteases/adhesins: From housekeeping in Escherichia coli to systemic spread of Yersinia pestis. Int. J. Med. Microbiol. 2004, 294, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Vazeille, E.; Chassaing, B.; Buisson, A.; Dubois, A.; De Vallée, A.; Billard, E.; Neut, C.; Bommelaer, G.; Colombel, J.F.; Barnich, N.; et al. GipA Factor Supports Colonization of Peyer’s Patches by Crohn’s Disease-associated Escherichia coli. Inflamm. Bowel Dis. 2016, 22, 68–81. [Google Scholar] [CrossRef] [PubMed]
- Camprubí-Font, C.; Ewers, C.; Lopez-Siles, M.; Martinez-Medina, M. Genetic and phenotypic features to screen for putative adherent-invasive Escherichia coli. Front. Microbiol. 2019, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Mills, M.; Payne, S.M. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutant. Infect. Immun. 1997, 65, 5358–5363. [Google Scholar] [CrossRef]
- Torres, A.G.; Payne, S.M. Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 1997, 23, 825–833. [Google Scholar] [CrossRef] [PubMed]
- Torres, A.G.; Redford, P.; Welch, R.A.; Payne, S.M. TonB-dependent systems of uropathogenic escherichia coli: Aerobactin and heme transport and TonB are required for virulence in the mouse. Infect. Immun. 2001, 69, 6179–6185. [Google Scholar] [CrossRef]
- Nègre, V.L.; Bonacorsi, S.; Schubert, S.; Bidet, P.; Nassif, X.; Bingen, E. The Siderophore Receptor IroN, but Not the High-Pathogenicity Island or the Hemin Receptor ChuA, Contributes to the Bacteremic Step of Escherichia coli Neonatal Meningitis. Infect. Immun. 2004, 72, 1216–1220. [Google Scholar] [CrossRef] [PubMed]
- Rivilla, R.; Sutton, J.M.; Downie, J.A. Rhizobium leguminosarum NodT is related to a family of outer-membrane transport proteins that includes TolC, PrtF, CyaE and AprF. Gene 1995, 161, 27–31. [Google Scholar] [CrossRef]
- Fricke, W.F.; Wright, M.S.; Lindell, A.H.; Harkins, D.M.; Baker-Austin, C.; Ravel, J.; Stepanauskas, R. Insights into the environmental resistance gene pool from the genome sequence of the multidrug-resistant environmental isolate Escherichia coli SMS-3-5. J. Bacteriol. 2008, 190, 6779–6794. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) | Tm (°C) | Product Length (pb) | Control (+) | Reference |
---|---|---|---|---|---|
chuA | GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA | 59 | 279 | NRG 857c | [35] |
fitA | ATCCCGCAGGTGGTCAATAC GGCATCGGCAACGAAATAGC | 60 | 1758 | NRG 857c | This study |
eefC/NodT | TTGAGTGCGGGATGTGTCTC CCGTCAACACGGTCAGGTAA | 60 | 1225 | NRG 857c | This study |
nmpC | ACTGATGGCGATGTCTGCTC ACGCACCCAAGTCTTTTCCT | 62 | 863 | NRG 857c | This study |
irpC | ATCAGCCAACAACGTCTCGT GCGTATCAATCACGCCGTTC | 60 | 1622 | NRG 857c | This study |
ompT | GCCTGCACCATTTTTGCTGT TCCTGACAACCCCTATTGCG | 59 | 878 | NRG 857c | This study |
lgc | ACAGCAGGCTGGGAAGAATC TGCTGTACGGTAGCGTTTGT | 60 | 1539 | 541-1 | This study |
Strains | Initial Uptake (3 h.p.i) | % 24 h.p.i | ||
---|---|---|---|---|
1I06 | 292.0 | ±78.0 | 6.9 | ±0.5 |
2C05 | 143.0 | ±11.9 | 3.3 | ±1.0 |
4C01 | 679.8 | ±108.5 | 409.8 | ±71.7 |
4I01 | 606.8 | ±104.5 | 127.3 | ±21.1 |
5C08 | 124.3 | ±15.2 | 16.3 | ±4.4 |
5I01 | 168.7 | ±10.5 | 83.8 | ±16.6 |
6I01 | 45.1 | ±39.1 | 5.1 | ±4.1 |
6I09 | 110.7 | ±9.9 | 27.0 | ±10.6 |
6I10 | 8.4 | ±1.0 | 1.0 | ±0.3 |
7C02 | 737.0 | ±148.6 | 5.7 | ±1.3 |
7C08 | 128.7 | ±23.8 | 3.0 | ±1.9 |
9C01 | 250.7 | ±44.1 | 59.8 | ±12.4 |
10C01 | 50.6 | ±4.6 | 9.0 | ±3.9 |
10I01 | 88.7 | ±6.2 | 30.0 | ±7.0 |
18I08 | 83.2 | ±16.8 | 45.1 | ±7.7 |
24C01 | 119.2 | ±9.5 | 0.003 | ±0.004 |
NRG 857c | 74.3 | ±5.2 | 31.3 | ±5.2 |
HM605 | 58.3 | ±9.7 | 22.9 | ±4.4 |
HB101 | 29.7 | ±7.1 | 0.0 | ±0.0 |
Function | No. Spot | Protein | Description | E-Value |
---|---|---|---|---|
Iron uptake | 1 | ChuA | Hemo/iron group receptor | 1.58114 × 1092 |
2 | CirA | Siderophore, colicin, microcin receptor | 1.25594 × 1036 | |
3 | FitA | Iron-ferrichrome receptor | 1.25594 × 1079 | |
4,5 | FepA | Ferrienterobactin receptor | 5 × 1050 6.29463 × 1055 | |
6 | Lgc * | Ligand-regulated channel (potential iron receptor) | 3.97164 × 1021 | |
18 | IrpC | Yersiniabactin/pesticin receptor | 1.58114 × 1054 3.15479 × 1036 | |
Porins | 10 | OmpT | Protease, outer membrane protein | 6.29463 × 1044 |
8 | NmpC | Outer membrane protein | 3.15479 × 1077 | |
21,22 | OmpA | Outer membrane protein | 7.92447 × 1061 1.25594 × 1067 | |
13 | EefC/NodT | Outer membrane channel | 3.97164 × 1056 | |
14,15 | TolC | Outer membrane protein | 3.15479 × 1020 | |
Specific channel | 16,17 | BtuB | B12 vitamin transporter | 3.15479 × 1017 |
Stress response | 19,20 | Dps | DNA-protecting protein | 9.97631 × 1072 8.34568 × 1060 |
Others | 11,12 | LptD | LPS-assembly protein | 9.97631 × 1053 3.15479 × 105 |
7 | Tsx | Nucleoside receptor, phage T6 and colicin K receptor | 1.58114 × 1028 | |
9 | EF-Tu | Elongation factor Tu | 3.15479 × 1023 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saitz, W.; Montero, D.A.; Pardo, M.; Araya, D.; De la Fuente, M.; Hermoso, M.A.; Farfán, M.J.; Ginard, D.; Rosselló-Móra, R.; Rasko, D.A.; et al. Characterization of Adherent-Invasive Escherichia coli (AIEC) Outer Membrane Proteins Provides Potential Molecular Markers to Screen Putative AIEC Strains. Int. J. Mol. Sci. 2022, 23, 9005. https://doi.org/10.3390/ijms23169005
Saitz W, Montero DA, Pardo M, Araya D, De la Fuente M, Hermoso MA, Farfán MJ, Ginard D, Rosselló-Móra R, Rasko DA, et al. Characterization of Adherent-Invasive Escherichia coli (AIEC) Outer Membrane Proteins Provides Potential Molecular Markers to Screen Putative AIEC Strains. International Journal of Molecular Sciences. 2022; 23(16):9005. https://doi.org/10.3390/ijms23169005
Chicago/Turabian StyleSaitz, Waleska, David A. Montero, Mirka Pardo, Daniela Araya, Marjorie De la Fuente, Marcela A. Hermoso, Mauricio J. Farfán, Daniel Ginard, Ramon Rosselló-Móra, Dave A. Rasko, and et al. 2022. "Characterization of Adherent-Invasive Escherichia coli (AIEC) Outer Membrane Proteins Provides Potential Molecular Markers to Screen Putative AIEC Strains" International Journal of Molecular Sciences 23, no. 16: 9005. https://doi.org/10.3390/ijms23169005
APA StyleSaitz, W., Montero, D. A., Pardo, M., Araya, D., De la Fuente, M., Hermoso, M. A., Farfán, M. J., Ginard, D., Rosselló-Móra, R., Rasko, D. A., Del Canto, F., & Vidal, R. M. (2022). Characterization of Adherent-Invasive Escherichia coli (AIEC) Outer Membrane Proteins Provides Potential Molecular Markers to Screen Putative AIEC Strains. International Journal of Molecular Sciences, 23(16), 9005. https://doi.org/10.3390/ijms23169005