Whole Genome Sequencing and CRISPR/Cas9 Gene Editing of Enterotoxigenic Escherichia coli BE311 for Fluorescence Labeling and Enterotoxin Analyses
Abstract
:1. Introduction
2. Results
2.1. Identification and Characterization of E. coli BE311
2.2. Whole Genome Sequencing of E. coli BE311
2.3. Expression and Analysis of mCherry in E. coli BE311
2.4. Construction and Functional Analysis of STKO-BE311
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Plasmids
4.2. Screening of ETEC for Heterologous Gene Expression and Identification of Virulence Factors
4.3. Whole-Genome Sequencing (WGS)
4.3.1. DNA Preparation
4.3.2. Analysis of DNA Sequence Data
4.4. Construction of mCherry-Labeled E. coli Based on CRISPR/Cas9
4.4.1. Plasmid Construction
4.4.2. Genome Editing
4.4.3. Verification of the E. coli BE311–mCherry Strain
4.4.4. Fluorescence Intensity Determination of E. coli BE311–mCherry
4.5. Construction of an ST-Knock-Out E. coli BE311 Strain Based on CRISPR/Cas9
4.5.1. Plasmid and Editing Template DNA Construction
4.5.2. Genome Editing with Chemical Transformation
4.5.3. Verification of the Editing Efficiency
4.6. Stability Detection of E. coli BE311–mCherry and BE311-STKO
4.7. E. coli BE311–mCherry–pQE30 Challenge In Vivo
4.8. Flow Cytometry Analysis of Apoptosis in Cells Infected with E. coli BE311-STKO
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Francis, D.H. Enterotoxigenic Escherichia coli infection in pigs and its diagnosis. J. Swine Health Prod. 2002, 10, 171–175. [Google Scholar]
- Kim, N.; Gu, M.J.; Kye, Y.C.; Ju, Y.J.; Hong, R.; Ju, D.B.; Pyung, Y.J.; Han, S.H.; Park, B.C.; Yun, C.H. Bacteriophage EK99P-1 alleviates enterotoxigenic Escherichia coli K99-induced barrier dysfunction and inflammation. Sci. Rep. 2022, 12, 941. [Google Scholar] [CrossRef]
- Dubreuil, J.D.; Isaacson, R.E.; Schifferli, D.M. Animal enterotoxigenic Escherichia coli. EcoSal Plus 2016, 7, 1128. [Google Scholar] [CrossRef] [Green Version]
- Brubaker, J.; Zhang, X.; Bourgeois, A.L.; Harro, C.; Sack, D.A.; Chakraborty, S. Intestinal and systemic inflammation induced by symptomatic and asymptomatic enterotoxigenic E. coli infection and impact on intestinal colonization and ETEC specific immune responses in an experimental human challenge model. Gut Microbes. 2021, 13, 1891852. [Google Scholar] [CrossRef]
- Roussel, C.; Sivignon, A.; de Vallée, A.; Garrait, G.; Denis, S.; Tsilia, V.; Ballet, N.; Vandekerckove, P.; Van de Wiele, T.; Barnich, N.; et al. Anti-infectious properties of the probiotic Saccharomyces cerevisiae CNCM I-3856 on enterotoxigenic E. coli (ETEC) strain H10407. Appl. Microbiol. Biotechnol. 2018, 102, 6175–6189. [Google Scholar] [CrossRef]
- Laird, T.J.; Abraham, S.; Jordan, D.; Pluske, J.R.; Hampson, D.J.; Trott, D.J.; O’Dea, M. Porcine enterotoxigenic Escherichia coli: Antimicrobial resistance and development of microbial-based alternative control strategies. Vet. Microbiol. 2021, 258, 109117. [Google Scholar] [CrossRef]
- Luo, Y.; Liu, L.; Chen, D.; Yu, B.; Zheng, P.; Mao, X.; Huang, Z.; Yu, J.; Luo, J.; Yan, H.; et al. Dietary supplementation of fructooligosaccharides alleviates enterotoxigenic E. coli-induced disruption of intestinal epithelium in a weaned piglet model. Br. J. Nutr. 2021, 1–27. [Google Scholar] [CrossRef]
- Mirhoseini, A.; Amani, J.; Nazarian, S. Review on pathogenicity mechanism of enterotoxigenic Escherichia coli and vaccines against it. Microb. Pathog. 2018, 117, 162–169. [Google Scholar] [CrossRef]
- Wang, W.; Ma, H.; Yu, H.; Qin, G.; Tan, Z.; Wang, Y.; Pang, H. Screening of Lactobacillus plantarum Subsp. plantarum with potential probiotic activities for inhibiting ETEC K88 in weaned piglets. Molecules 2020, 25, 4481. [Google Scholar] [CrossRef]
- Hur, J.; Lee, J.H. Comparative evaluation of a vaccine candidate expressing enterotoxigenic Escherichia coli (ETEC) adhesins for colibacillosis with a commercial vaccine using a pig model. Vaccine 2012, 30, 3829–3833. [Google Scholar] [CrossRef]
- Ramakrishnan, A.; Joseph, S.S.; Reynolds, N.D.; Poncet, D.; Maciel, M.; Nunez, G.; Espinoza, N.; Nieto, M.; Castillo, R.; Royal, J.M.; et al. Evaluation of the immunogenicity and protective efficacy of a recombinant CS6-based ETEC vaccine in an Aotus nancymaae CS6+ ETEC challenge model. Vaccine 2021, 39, 487–494. [Google Scholar] [CrossRef]
- Chakraborty, S.; Randall, A.; Vickers, T.J.; Molina, D.; Harro, C.D.; DeNearing, B.; Brubaker, J.; Sack, D.A.; Bourgeois, A.L.; Felgner, P.L. Interrogation of a live-attenuated enterotoxigenic Escherichia coli vaccine highlights features unique to wild-type infection. NPJ Vaccines 2019, 4, 37. [Google Scholar] [CrossRef]
- Harro, C.; Bourgeois, A.L.; Sack, D.; Walker, R.; DeNearing, B.; Brubaker, J.; Maier, N.; Fix, A.; Dally, L.; Chakraborty, S. Live attenuated enterotoxigenic Escherichia coli (ETEC) vaccine with dmLT adjuvant protects human volunteers against virulent experimental ETEC challenge. Vaccine 2019, 37, 1978–1986. [Google Scholar] [CrossRef]
- Darsley, M.J.; Chakraborty, S.; DeNearing, B.; Sack, D.A.; Feller, A.; Buchwaldt, C.; Bourgeois, A.L.; Walker, R.; Harro, C.D. The oral, live attenuated enterotoxigenic Escherichia coli vaccine ACE527 reduces the incidence and severity of diarrhea in a human challenge model of diarrheal disease. Clin. Vaccine Immunol. 2012, 19, 1921–1931. [Google Scholar] [CrossRef] [Green Version]
- Holmgren, J.; Bourgeois, L.; Carlin, N.; Clements, J.; Gustafsson, B.; Lundgren, A.; Nygren, E.; Tobias, J.; Walker, R.; Svennerholm, A.M. Development and preclinical evaluation of safety and immunogenicity of an oral ETEC vaccine containing inactivated E. coli bacteria overexpressing colonization factors CFA/I, CS3, CS5 and CS6 combined with a hybrid LT/CT B subunit antigen, administered alone and together with dmLT adjuvant. Vaccine 2013, 31, 2457–2464. [Google Scholar]
- Harutyunyan, S.; Neuhauser, I.; Mayer, A.; Aichinger, M.; Szijártó, V.; Nagy, G.; Nagy, E.; Girardi, P.; Malinoski, F.J.; Henics, T. Characterization of shigetec, a novel live attenuated combined vaccine against shigellae and etec. Vaccines 2020, 8, 689. [Google Scholar] [CrossRef]
- McKenzie, R.; Darsley, M.; Thomas, N.; Randall, R.; Carpenter, C.; Forbes, E.; Finucane, M.; Sack, R.B.; Hall, E.; Bourgeois, A.L. A double-blind, placebo-controlled trial to evaluate the efficacy of PTL-003, an attenuated enterotoxigenic E. coli (ETEC) vaccine strain, in protecting against challenge with virulent ETEC. Vaccine 2008, 26, 4731–4739. [Google Scholar] [CrossRef]
- McKenzie, R.; Bourgeois, A.L.; Engstrom, F.; Hall, E.; Chang, H.S.; Gomes, J.G.; Kyle, J.L.; Cassels, F.; Turner, A.K.; Randall, R. Comparative safety and immunogenicity of two attenuated enterotoxigenic Escherichia coli vaccine strains in healthy adults. Infect. Immun. 2006, 74, 994–1000. [Google Scholar] [CrossRef] [Green Version]
- Santiago-Mateo, K.; Zhao, M.; Lin, J.; Zhang, W.; Francis, D.H. Avirulent K88 (F4)+ Escherichia coli strains constructed to express modified enterotoxins protect young piglets from challenge with a virulent enterotoxigenic Escherichia coli strain that expresses the same adhesion and enterotoxins. Vet. Microbiol. 2012, 159, 337–342. [Google Scholar] [CrossRef]
- Zhang, H.; Xu, Y.; Zhang, Z.; You, J.; Yang, Y.; Li, X. Protective immunity of a multivalent vaccine candidate against piglet diarrhea caused by enterotoxigenic Escherichia coli (ETEC) in a pig model. Vaccine 2018, 36, 723–728. [Google Scholar] [CrossRef]
- Chen, S.; Wu, X.; Xia, Y.; Wang, M.; Liao, S.; Li, F.; Yin, J.; Ren, W.; Tan, B.; Yin, Y. Effects of dietary gamma-aminobutyric acid supplementation on amino acid profile, intestinal immunity, and microbiota in ETEC-challenged piglets. Food Funct. 2020, 11, 9067–9074. [Google Scholar] [CrossRef]
- Yang, K.; Jiang, Z.; Zheng, C.; Wang, L.; Yang, X. Effect of Lactobacillus plantarum on diarrhea and intestinal barrier function of young piglets challenged with enterotoxigenic Escherichia coli K88. J. Anim. Sci. 2014, 92, 1496–1503. [Google Scholar] [CrossRef] [Green Version]
- Peng, X.; Wang, R.; Hu, L.; Zhou, Q.; Liu, Y.; Yang, M.; Fang, Z.; Lin, Y.; Xu, S.; Feng, B. Enterococcus faecium NCIMB 10415 administration improves the intestinal health and immunity in neonatal piglets infected by enterotoxigenic Escherichia coli K88. J. Anim. Sci. Biotechnol. 2019, 10, 72. [Google Scholar] [CrossRef]
- Spitzer, F.; Vahjen, W.; Pieper, R.; Martinez-Vallespin, B.; Zentek, J. A standardised challenge model with an enterotoxigenic F4+ Escherichia coli strain in piglets assessing clinical traits and faecal shedding of fae and est-II toxin genes. Arch. Anim. Nutr. 2014, 68, 448–459. [Google Scholar] [CrossRef]
- Ghapoutsa, R.N.; Boda, M.; Gautam, R.; Ndze, V.N.; Mugyia, A.E.; Etoa, F.X.; Bowen, M.D.; Esona, M.D. Detection of diarrhoea associated rotavirus and co-infection with diarrhoeagenic pathogens in the littoral region of Cameroon using ELISA, RT-PCR and Luminex xTAG GPP assays. BMC Infect. Dis. 2021, 21, 614. [Google Scholar] [CrossRef]
- Rocha, L.B.; Ozaki, C.Y.; Horton, D.S.; Menezes, C.A.; Silva, A.; Fernandes, I.; Magnoli, F.C.; Vaz, T.M.; Guth, B.E.; Piazza, R.M. Different assay conditions for detecting the production and release of heat-labile and heat-stable toxins in enterotoxigenic Escherichia coli isolates. Toxins 2013, 5, 2384–2402. [Google Scholar] [CrossRef] [Green Version]
- Gonzales-Siles, L.; Sjöling, Å. The different ecological niches of enterotoxigenic Escherichia coli. Environ. Microbiol. 2016, 18, 741–751. [Google Scholar] [CrossRef]
- Farling, S.; Rogers, T.; Knee, J.S.; Tilley, E.A.; Brown, J.; Deshusses, M.A. Bioaerosol emissions associated with pit latrine emptying operations. Sci. Total Environ. 2019, 648, 1082–1086. [Google Scholar] [CrossRef]
- Ginn, O.; Rocha-Melogno, L.; Bivins, A.; Lowry, S.; Cardelino, M.; Nichols, D.; Tripathi, S.N.; Soria, F.; Andrade, M.; Bergin, M.; et al. Detection and quantification of enteric pathogens in aerosols near open wastewater canals in cities with poor sanitation. Environ. Sci. Technol. 2021, 55, 14758–14771. [Google Scholar] [CrossRef]
- Billard, P.; DuBow, M.S. Bioluminescence-based assays for detection and characterization of bacteria and chemicals in clinical laboratories. Clin. Biochem. 1998, 31, 1–14. [Google Scholar] [CrossRef]
- Wu, C.M.; Chung, T.C. Mice protected by oral immunization with Lactobacillus reuteri secreting fusion protein of Escherichia coli enterotoxin subunit protein. FEMS Immunol. Med. Microbiol. 2007, 50, 354–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zimmer, M. Green fluorescent protein (GFP): Applications, structure, and related photophysical behavior. Chem. Rev. 2002, 102, 759–782. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lin, Z.; Huang, C.; Zhang, Y.; Wang, Z.; Tang, Y.J.; Chen, T.; Zhao, X. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab. Eng. 2015, 31, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Chung, M.E.; Yeh, I.H.; Sung, L.Y.; Wu, M.Y.; Chao, Y.P.; Ng, I.S.; Hu, Y.C. Enhanced integration of large DNA into E. coli chromosome by CRISPR/Cas9. Biotechnol. Bioeng. 2017, 114, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Hou, M.; Sun, S.; Feng, Q.; Dong, X.; Zhang, P.; Shi, B.; Liu, J.; Shi, D. Genetic editing of the virulence gene of Escherichia coli using the CRISPR system. PeerJ 2020, 8, e8881. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Chen, B.; Duan, C.; Sun, B.; Yang, J.; Yang, S. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl. Environ. Microbiol. 2015, 81, 2506–2514. [Google Scholar] [CrossRef] [Green Version]
- Wan, P.; Cui, S.; Ma, Z.; Chen, L.; Li, X.; Zhao, R.; Xiong, W.; Zeng, Z. Reversal of mcr-1-mediated colistin resistance in Escherichia coli by CRISPR-Cas9 system. Infect. Drug Resist. 2020, 13, 1171–1178. [Google Scholar] [CrossRef] [Green Version]
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef]
- Kraemer, S.A.; Ramachandran, A.; Perron, G.G. Antibiotic pollution in the environment: From microbial ecology to public policy. Microorganisms 2019, 7, 180. [Google Scholar] [CrossRef] [Green Version]
- Busso, D.; Delagoutte-Busso, B.; Moras, D. Construction of a set Gateway-based destination vectors for high-throughput cloning and expression screening in Escherichia coli. Anal. Biochem. 2005, 343, 313–321. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, X.; Yu, L.; Tian, Y.; Li, S.; Leng, F.; Ma, J.; Chen, J. Effects of Sr2+ on the preparation of Escherichia coli DH5α competent cells and plasmid transformation. PeerJ 2020, 8, e9480. [Google Scholar] [CrossRef]
- Kang, D.; Kim, Y.; Cha, H. Comparison of green fluorescent protein expression in two industrial Escherichia coli strains, BL21 and W3110, under co-expression of bacterial hemoglobin. Appl. Microbiol. Biotechnol. 2002, 59, 523–528. [Google Scholar] [PubMed]
- Drew, D.E.; Von Heijne, G.; Nordlund, P.; de Gier, J.-W.L. Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli. FEBS Lett. 2001, 507, 220–224. [Google Scholar] [CrossRef] [Green Version]
- Richards, H.; Halfhill, M.; Millwood, R.; Stewart, C. Quantitative GFP fluorescence as an indicator of recombinant protein synthesis in transgenic plants. Plant. Cell Rep. 2003, 22, 117–121. [Google Scholar] [CrossRef]
- Robins-Browne, R.M.; Holt, K.E.; Ingle, D.J.; Hocking, D.M.; Yang, J.; Tauschek, M. Are Escherichia coli pathotypes still relevant in the era of whole-genome sequencing? Front. Cell Infect. Microbiol. 2016, 6, 141. [Google Scholar] [CrossRef] [Green Version]
- Ji, X.; Liang, B.; Sun, Y.; Zhu, L.; Zhou, B.; Guo, X.; Liu, J. An Extended-spectrum beta-lactamase-producing hybrid Shiga-toxigenic and enterotoxigenic Escherichia coli strain isolated from a piglet with diarrheal disease in northeast China. Foodborne Pathog. Dis. 2020, 17, 382–387. [Google Scholar] [CrossRef]
- Morita, S.; Sato, S.; Maruyama, S.; Nagasaka, M.; Murakami, K.; Inada, K.; Uchiumi, M.; Yokoyama, E.; Asakura, H.; Sugiyama, H.; et al. Whole-genome sequence analysis of Shiga toxin-producing Escherichia coli O157 strains isolated from wild deer and boar in Japan. J. Vet. Med. Sci. 2021, 83, 1860–1868. [Google Scholar] [CrossRef]
- García, V.; Gambino, M.; Pedersen, K.; Haugegaard, S.; Olsen, J.E.; Herrero-Fresno, A. F4- and F18-positive enterotoxigenic Escherichia coli isolates from diarrhea of postweaning pigs: Genomic characterization. Appl. Environ. Microbiol. 2020, 86, e01913-20. [Google Scholar] [CrossRef]
- Da Silva, W.M.; Bei, J.; Amigo, N.; Valacco, M.P.; Amadio, A.; Zhang, Q.; Wu, X.; Yu, T.; Larzabal, M.; Chen, Z.; et al. Quantification of enterohemorrhagic Escherichia coli O157:H7 protein abundance by high-throughput proteome. PLoS ONE 2018, 13, e0208520. [Google Scholar] [CrossRef]
- von Mentzer, A.; Tobias, J.; Wiklund, G.; Nordqvist, S.; Aslett, M.; Dougan, G.; Sjöling, Å.; Svennerholm, A.M. Identification and characterization of the novel colonization factor CS30 based on whole genome sequencing in enterotoxigenic Escherichia coli (ETEC). Sci. Rep. 2017, 7, 12514. [Google Scholar] [CrossRef] [Green Version]
- Han, X.; Ding, S.; Ma, Y.; Fang, J.; Jiang, H.; Li, Y.; Liu, G. Lactobacillus plantarum and Lactobacillus brevis alleviate intestinal inflammation and microbial disorder induced by ETEC in a murine model. Oxid. Med. Cell Longev. 2021, 2021, 6867962. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Zhang, Y.; Zhang, D.; Bai, Y.; Liu, G.; Li, P.; Li, J.; Li, Y. Immunogenicity and protective efficacy of enterotoxigenic Escherichia coli (ETEC) total RNA against ETEC challenge in a mouse model. Sci. Rep. 2020, 10, 20530. [Google Scholar] [CrossRef] [PubMed]
- Vermeire, B.; Gonzalez, L.M.; Jansens, R.J.J.; Cox, E.; Devriendt, B. Porcine small intestinal organoids as a model to explore ETEC-host interactions in the gut. Vet. Res. 2021, 52, 94. [Google Scholar] [CrossRef]
- Bussalleu, E.; Pinart, E.; Yeste, M.; Briz, M.; Sancho, S.; Torner, E.; Bonet, S. A PCR technique to detect enterotoxigenic and verotoxigenic Escherichia coli in boar semen samples. Res. Vet. Sci. 2012, 93, 31–33. [Google Scholar] [CrossRef] [PubMed]
- Prieto, A.; López-Novo, C.; Díaz, P.; Díaz-Cao, J.M.; López-Lorenzo, G.; Antón, C.; Remesar, S.; García-Dios, D.; López, C.; Panadero, R.; et al. Antimicrobial susceptibility of enterotoxigenic Escherichia coli from diarrhoeic neonatal calves in spain. Animals 2022, 12, 264. [Google Scholar] [CrossRef]
- Matsuo, T.; Okoda, Y.; Badgar, B.; Inoue, N.; Xuan, X.; Taylor, D.; Fujisaki, K. Fate of GFP-expressing Escherichia coli in the midgut and response to ingestion in a tick, Ornithodoros moubata (Acari: Argasidae). Exp. Parasitol. 2004, 108, 67–73. [Google Scholar] [CrossRef]
- Park, P.-G.; Cho, M.-H.; Rhie G-e Jeong, H.; Youn, H.; Hong, K.-J. GFP-tagged E. coli shows bacterial distribution in mouse organs: Pathogen tracking using fluorescence signal. Clin. Exp. Vaccine Res. 2012, 1, 83–87. [Google Scholar] [CrossRef] [Green Version]
- Barolo, S.; Castro, B.; Posakony, J.W. New Drosophila transgenic reporters: Insulated P-element vectors expressing fast-maturing RFP. Biotechniques 2004, 36, 436–442. [Google Scholar] [CrossRef] [Green Version]
- Hua, Z.; Wu, C.; Fan, G.; Tang, Z.; Cao, F. The antibacterial activity and mechanism of ginkgolic acid C15:1. BMC Biotechnol. 2017, 17, 5. [Google Scholar] [CrossRef] [Green Version]
- Rocha, E.M.; Marinotti, O.; Serrão, D.M.; Correa, L.V.; Katak, R.M.; de Oliveira, J.C.; Muniz, V.A.; de Oliveira, M.R.; do Nascimento Neto, J.F.; Pessoa, M.C.F.; et al. Culturable bacteria associated with Anopheles darlingi and their paratransgenesis potential. Malar. J. 2021, 20, 40. [Google Scholar] [CrossRef]
- Ferris, R.A.; McCue, P.M.; Borlee, G.I.; Glapa, K.E.; Martin, K.H.; Mangalea, M.R.; Hennet, M.L.; Wolfe, L.M.; Broeckling, C.D.; Borlee, B.R. Model of chronic equine endometritis involving a pseudomonas aeruginosa biofilm. Infect. Immun. 2017, 85, e00332-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Douglas, G.L.; Klaenhammer, T.R. Directed chromosomal integration and expression of the reporter gene gusA3 in Lactobacillus acidophilus NCFM. Appl. Environ. Microbiol. 2011, 77, 7365–7371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Xu, Y.; Li, X.; Li, G.; Zhao, H.; Wang, L. Expression and purification of a recombinant enterotoxin protein using different E. coli host strains and expression vectors. Protein J. 2021, 40, 245–254. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhong, Z.; Luo, Y.; Cox, E.; Devriendt, B. Heat-stable enterotoxins of enterotoxigenic Escherichia coli and their impact on host immunity. Toxins 2019, 11, 24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fleckenstein, J.M.; Hardwidge, P.R.; Munson, G.P.; Rasko, D.A.; Sommerfelt, H.; Steinsland, H. Molecular mechanisms of enterotoxigenic Escherichia coli infection. Microbes Infect. 2010, 12, 89–98. [Google Scholar] [CrossRef]
- Wang, X.; He, J.; Le, K. Making point mutations in Escherichia coli BL21 genome using the CRISPR-Cas9 system. FEMS Microbiol. Lett. 2018, 365, fny060. [Google Scholar] [CrossRef]
E. coli | Strains | pQE30-GFP | pET28a-GFP | pET9a-GFP |
---|---|---|---|---|
Standard E. coli recipient hosts | E. coli BL21 | — | — | — |
E. coli Rosetta | ++ | — | — | |
E. coli TG1 | ++ | — | — | |
E. coli Top10 | +++ | — | — | |
Standard ETEC | E. coli K88ab | + | — | — |
E. coli K99 | +++ | — | — | |
E. coli 987P | / | / | / | |
Wild-type ETEC | E. coli BE209 | + | — | — |
E. coli BE263 | ++ | / | / | |
E. coli BE311 | +++ | — | — | |
E. coli BE314 | ++ | / | / | |
E. coli BE327 | ++ | + | / |
Primer | Primer Sequences (5’-3’) | Product Size (bp) | GenBank Accession No. |
---|---|---|---|
LTa-F | ATGATTGACATCATGTTGCATATAG | 451 | V00275.1 |
LTa-R | TATGGGTGAGGGCTGTAT | ||
LTb-F | CGCGGATCCCCAGACTATTACAGAACTA | 504 | M17873.1 |
LTb-R | ATAAGAATGCGGCCGCAAGCTTGCCCCTCCAGCCTAGC | ||
STa-F | ATGAAAAAGCTAATGTTGGCAATTT | 219 | M25607.1 |
STa-R | TTAATAACATGGAGCACAGGCAGGA | ||
STb-F | CATCTACACAATCAAATAA | 155 | AY028790.1 |
STb-R | TTAGCATCCTTTTGCTGCAA | ||
K88-F | CGGGATCCATGAAAAAGACTCTGATT | 852 | AJ616236.1 |
K88-R | CCGGTACCTTAGTAATAAGTAATTGC | ||
K99-F | CGCGGATCCAATACAGGTACTATTAAC | 480 | M35282.1 |
K99-R | CGCAAGCTTTTACATATAAGTGACT | ||
987P-F | CGCGGATCCAAATTTAGAAAAGTGCAT | 989 | M35257.1 |
987P-R | CGCAAGCTTATATAAACAAAAACACAA | ||
F41-F | CGCGGATCCTGAATCCGCAGGGGATGG | 954 | M21788.1 |
F41-R | CGCAAGCTTCTCACTGCCCCCAACTAC | ||
16S rRNA-27F | AGAGTTTGATCCTGGCTCAG | 1453 | |
16S rRNA-1492R | TACGGCTACCTTGTTACGACTT | ||
GFP-F | GCGGGATCCATGAGTAAAGGAGAAGAAC | 717 | X83959.1 |
GFP-R | GCGAAGCTTCTATTTGTATAGTTCATCC |
Primers | 5′-3′ Sequence |
---|---|
yheO-genomic-F | GTAGAAGCCGGTAAAGGCGA |
yheO-genomic-R | AGAAACGCTGCTATCCGCTC |
yheO-gRNA | ATATAATTAGTGCTGGAAAGCGG |
P1 | ATATAATTAGTGCTGGAAAGGTTTTAGAGCTAGAAATAGCA |
P2 | AGTCCTAGGTATAATACTAGTATATAATTAGTGCTGGAAAG |
P3 | CTTATGGAGCTGCACATGAACTCGAGTAGGGATAACAGGGT |
Left-HA-F | GGTACC GTAGAAGCCGGTAAAGGCGAAGC |
Left-HA-R | AGCAAATAAATTTTTTATGATTATATCCGGCCTGTAATAA |
mCherry-F | TTATTACAGGCCGGATATAATCATAAAAAATTTATTTGCT |
mCherry-R | TAATACAGCGGAGGTTCCGCCTTGTACAGCTCGTCCATGC |
Right-HA-F | GCATGGACGAGCTGTACAAGGCGGAACCTCCGCTGTATTA |
Right-HA-R | AGGACTGAGCTAGCTGTCAAATCTTCCGGCCTGTATGTTCACC |
SSG-F | GGTGAACATACAGGCCGGAAGATTTGACAGCTAGCTCAGTCCT |
SSG-R | GCATGC GCACCGACTCGGTGCCACTTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, S.; Tao, T.; Su, Y.; Hu, J.; Zhang, L.; Wang, G.; Li, X.; Guo, X. Whole Genome Sequencing and CRISPR/Cas9 Gene Editing of Enterotoxigenic Escherichia coli BE311 for Fluorescence Labeling and Enterotoxin Analyses. Int. J. Mol. Sci. 2022, 23, 7502. https://doi.org/10.3390/ijms23147502
Lu S, Tao T, Su Y, Hu J, Zhang L, Wang G, Li X, Guo X. Whole Genome Sequencing and CRISPR/Cas9 Gene Editing of Enterotoxigenic Escherichia coli BE311 for Fluorescence Labeling and Enterotoxin Analyses. International Journal of Molecular Sciences. 2022; 23(14):7502. https://doi.org/10.3390/ijms23147502
Chicago/Turabian StyleLu, Shuang, Ting Tao, Yating Su, Jia Hu, Li Zhang, Guoliang Wang, Xiangyu Li, and Xiaohua Guo. 2022. "Whole Genome Sequencing and CRISPR/Cas9 Gene Editing of Enterotoxigenic Escherichia coli BE311 for Fluorescence Labeling and Enterotoxin Analyses" International Journal of Molecular Sciences 23, no. 14: 7502. https://doi.org/10.3390/ijms23147502