A Maize CBM Domain Containing the Protein ZmCBM48-1 Positively Regulates Starch Synthesis in the Rice Endosperm
Abstract
1. Introduction
2. Results
2.1. Isolation and Sequence Analysis of ZmCBM48-1
2.2. Expression Patterns Analysis of ZmCBM48-1 in Different Maize Tissues
2.3. ZmCBM48-1 Localizes in Plastids
2.4. Ectopic Expression of ZmCBM48-1 Alters Grain Morphology
2.5. Overexpression of ZmCBM48-1 Influences the Starch Content and Starch Structure in Rice
2.6. Enhanced the Expression of Starch Synthesis-Related Genes in ZmCBM48-1 Transgenic Plant
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Multiple Sequence Alignment and Phylogenetic Analysis
4.3. Total RNA Extraction and qRT-PCR
4.4. Production of ZmCBM48-1-Overexpressing Transgenic Rice Lines
4.5. Subcellular Localization of ZmCBM48-1
4.6. Determination of Agronomic Characters of Transgenic Rice
4.7. Measurement of Starch Properties
4.8. Histological Analysis of Transgenic Rice
4.9. Scanning Electron Mmicroscopy (SEM)
4.10. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Flint-Garcia, S.A.; Bodnar, A.L.; Scott, M.P. Wide variability in kernel composition, seed characteristics, and zein profiles among diverse maize inbreds, landraces, and teosinte. Theor. Appl. Genet. 2009, 119, 1129–1142. [Google Scholar] [CrossRef]
- Martin, C.; Smith, A.M. Starch biosynthesis. Plant Cell 1995, 7, 971–985. [Google Scholar] [PubMed]
- Whitt, S.R.; Wilson, L.M.; Tenaillon, M.I.; Gaut, B.S.; Buckler, E.S., IV. Genetic diversity and selection in the maize starch pathway. Proc. Natl. Acad. Sci. USA 2002, 99, 12959–12962. [Google Scholar] [CrossRef] [PubMed]
- Jeon, J.-S.; Ryoo, N.; Hahn, T.-R.; Walia, H.; Nakamura, Y. Starch biosynthesis in cereal endosperm. Plant Physiol. Biochem. 2010, 48, 383–392. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.; Dey, N.; Kim, C.-S.; Bharti, A.K.; Rudd, S.; Mayer, K.F.; Larkins, B.A.; Becraft, P.; Messing, J. Characterization of the Maize Endosperm Transcriptome and Its Comparison to the Rice Genome. Genome Res. 2004, 14, 1932–1937. [Google Scholar] [CrossRef] [PubMed]
- Saripalli, G.; Gupta, P.K. AGPase: Its role in crop productivity with emphasis on heat tolerance in cereals. Theor. Appl. Genet. 2015, 128, 1893–1916. [Google Scholar] [CrossRef] [PubMed]
- Tian, Z.; Qian, Q.; Liu, Q.; Yan, M.; Liu, X.; Yan, C.; Liu, G.; Gao, Z.; Tang, S.; Zeng, D.; et al. Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc. Natl. Acad. Sci. USA 2009, 106, 21760–21765. [Google Scholar] [CrossRef]
- Goren, A.; Ashlock, D.; Tetlow, I.J. Starch formation inside plastids of higher plants. Protoplasma 2018, 255, 1855–1876. [Google Scholar] [CrossRef]
- Hennen-Bierwagen, T.; Liu, F.; Marsh, R.S.; Kim, S.; Gan, Q.; Tetlow, I.J.; Emes, M.J.; James, M.G.; Myers, A.M. Starch Biosynthetic Enzymes from Developing Maize Endosperm Associate in Multisubunit Complexes. Plant Physiol. 2008, 146, 1892–1908. [Google Scholar] [CrossRef]
- Pfister, B.; Zeeman, S.C. Formation of starch in plant cells. Cell. Mol. Life Sci. 2016, 73, 2781–2807. [Google Scholar] [CrossRef]
- Tetlow, I.J.; Emes, M.J. Starch Biosynthesis in the Developing Endosperms of Grasses and Cereals. Agronomy 2017, 7, 81. [Google Scholar] [CrossRef]
- Wang, J.-C.; Xu, H.; Zhu, Y.; Liu, Q.-Q.; Cai, X.-L. OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm. J. Exp. Bot. 2013, 64, 3453–3466. [Google Scholar] [CrossRef]
- Wu, J.; Chen, L.; Chen, M.; Zhou, W.; Dong, Q.; Jiang, H.; Cheng, B. The DOF-Domain Transcription Factor ZmDOF36 Positively Regulates Starch Synthesis in Transgenic Maize. Front. Plant Sci. 2019, 10, 465. [Google Scholar] [CrossRef]
- Dong, Q.; Xu, Q.; Kong, J.; Peng, X.; Zhou, W.; Chen, L.; Wu, J.; Xiang, Y.; Jiang, H.; Cheng, B. Overexpression of ZmbZIP22 gene alters endosperm starch content and composition in maize and rice. Plant Sci. 2019, 283, 407–415. [Google Scholar] [CrossRef]
- Feng, F.; Qi, W.; Lv, Y.; Yan, S.; Xu, L.; Yang, W.; Yuan, Y.; Chen, Y.; Zhao, H.; Song, R. OPAQUE11 Is a Central Hub of the Regulatory Network for Maize Endosperm Development and Nutrient Metabolism. Plant Cell 2018, 30, 375–396. [Google Scholar] [CrossRef]
- Chen, J.; Yi, Q.; Cao, Y.; Wei, B.; Zheng, L.; Xiao, Q.; Xie, Y.; Gu, Y.; Li, Y.; Huang, H.; et al. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters. J. Exp. Bot. 2016, 67, 1327–1338. [Google Scholar] [CrossRef]
- Guillén, D.; Sánchez, S.; Rodríguez-Sanoja, R. Carbohydrate-binding domains: Multiplicity of biological roles. Appl. Microbiol. Biotechnol. 2009, 85, 1241–1249. [Google Scholar] [CrossRef]
- Christiansen, C.; Hachem, M.A.; Glaring, M.A.; Viksø-Nielsen, A.; Sigurskjold, B.W.; Svensson, B.; Blennow, A. A CBM20 low-affinity starch-binding domain from glucan, water dikinase. FEBS Lett. 2009, 583, 1159–1163. [Google Scholar] [CrossRef]
- Janeček, Š.; Svensson, B.; MacGregor, E.A. Structural and evolutionary aspects of two families of non-catalytic domains present in starch and glycogen binding proteins from microbes, plants and animals. Enzym. Microb. Technol. 2011, 49, 429–440. [Google Scholar] [CrossRef]
- Seung, D.; Boudet, J.; Monroe, J.; Schreier, T.B.; David, L.C.; Abt, M.; Lu, K.-J.; Zanella, M.; Zeeman, S.C. Homologs of PROTEIN TARGETING TO STARCH Control Starch Granule Initiation in Arabidopsis Leaves. Plant Cell 2017, 29, 1657–1677. [Google Scholar] [CrossRef]
- Seung, D.; Soyk, S.; Coiro, M.; Maier, B.A.; Eicke, S.; Zeeman, S.C. PROTEIN TARGETING TO STARCH Is Required for Localising GRANULE-BOUND STARCH SYNTHASE to Starch Granules and for Normal Amylose Synthesis in Arabidopsis. PLoS Biol. 2015, 13, e1002080. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.; Wang, Y.; Liu, F.; Ren, Y.; Zhou, K.; Lv, J.; Zheng, M.; Zhao, S.; Zhang, L.; Wang, C.; et al. FLOURY ENDOSPERM6 encodes a CBM48 domain-containing protein involved in compound granule formation and starch synthesis in rice endosperm. Plant J. 2014, 77, 917–930. [Google Scholar] [CrossRef]
- Wang, W.; Wei, X.; Jiao, G.; Chen, W.; Wu, Y.; Sheng, Z.; Hu, S.; Xie, L.; Wang, J.; Tang, S.; et al. GBSS-BINDING PROTEIN, encoding a CBM48 domain-containing protein, affects rice quality and yield. J. Integr. Plant Biol. 2019, 62, 948–966. [Google Scholar] [CrossRef] [PubMed]
- Kashem, M.; Sultana, N.; Samanta, S.; Kamal, A. Starch, sugar, amylase and invertase activity in the germinating seeds of modern wheat varieties. J. Natl. Sci. Found. Sri Lanka 1995, 23, 55. [Google Scholar] [CrossRef]
- Takeda, Y.; Hizukuri, S.; Juliano, B.O. Purification and structure of amylose from rice starch. Carbohydr. Res. 1986, 148, 299–308. [Google Scholar] [CrossRef]
- McBride, A.; Ghilagaber, S.; Nikolaev, A.; Hardie, D.G. The Glycogen-Binding Domain on the AMPK β Subunit Allows the Kinase to Act as a Glycogen Sensor. Cell Metab. 2009, 9, 23–34. [Google Scholar] [CrossRef]
- Comparot-Moss, S.; Kötting, O.; Stettler, M.; Edner, C.; Graf, A.; Weise, S.E.; Streb, S.; Lue, W.-L.; MacLean, D.; Mahlow, S.; et al. A Putative Phosphatase, LSF1, Is Required for Normal Starch Turnover in Arabidopsis Leaves. Plant Physiol. 2010, 152, 685–697. [Google Scholar] [CrossRef]
- Kemp, B.E.; Oakhill, J.S.; Scott, J.W. AMPK Structure and Regulation from Three Angles. Structure 2007, 15, 1161–1163. [Google Scholar] [CrossRef]
- Shannon, J.C.; Pien, F.M.; Liu, K.C. Nucleotides and Nucleotide Sugars in Developing Maize Endosperms (Synthesis of ADP-Glucose in brittle-1). Plant Physiol. 1996, 110, 835–843. [Google Scholar] [CrossRef][Green Version]
- Jiang, Y.; Zheng, Q.; Chen, L.; Liang, Y.; Wu, J. Ectopic overexpression of maize heat shock transcription factor gene ZmHsf04 confers increased thermo and salt-stress tolerance in transgenic Arabidopsis. Acta Physiol. Plant. 2018, 40, 9. [Google Scholar] [CrossRef]
- Sheen, J. Signal Transduction in Maize and Arabidopsis Mesophyll Protoplasts. Plant Physiol. 2001, 127, 1466–1475. [Google Scholar] [CrossRef]
- Kang, H.-G.; Park, S.; Matsuoka, M.; An, G. White-core endosperm floury endosperm-4 in rice is generated by knockout mutations in the C4-type pyruvate orthophosphate dikinase gene (OsPPDKB). Plant J. 2005, 42, 901–911. [Google Scholar] [CrossRef]
- Fu, F.-F.; Xue, H.-W. Coexpression Analysis Identifies Rice Starch Regulator1, a Rice AP2/EREBP Family Transcription Factor, as a Novel Rice Starch Biosynthesis Regulator. Plant Physiol. 2010, 154, 927–938. [Google Scholar] [CrossRef]
- Wang, X.; Zhou, W.; Lu, Z.; Ouyang, Y.; Chol, S.O.; Yao, J. A lipid transfer protein, OsLTPL36, is essential for seed development and seed quality in rice. Plant Sci. 2015, 239, 200–208. [Google Scholar] [CrossRef]
Assay | Primer Name | Sequence (5′-3′) |
---|---|---|
qRT-PCR analysis | ZmActin-F | CTGACGGAGCGTGGTTACTCAT |
ZmActin-R | TGGTCTTGGCAGTCTCCATTTC | |
ZmCBM48-1-F | AGTTTATCGTTGACGGTGTTTG | |
ZmCBM48-1-R | AACTTCAAGTCAAGTGACAAGC | |
OsTublin-F | TACCGTGCCCTTACTGTTCC | |
OsTublin-F | CGGTGGAATGTCACAGACAC | |
OsAGPL1-F | GGAAGACGGATGATCGAGAAAG | |
OsAGPL1-R | CACATGAGATGCACCAACGA | |
OsAGPL2-F | AGTTCGATTCAAGACGGATAGC | |
OsAGPL2-R | CGACTTCCACAGGCAGCTTATT | |
OsAGPS1-F | GTGCCACTTAAAGGCACCATT | |
OsAGPS1-R | CCCACATTTCAGACACGGTTT | |
OsAGPS2a-F | AACAATCGAAGCGCGAGAAA | |
OsAGPS2a-R | GCCTGTAGTTGGCACCCAGA | |
OsBEIIa-F | GCCAATGCCAGGAAGATGA | |
OsBEIIa-R | GCGCAACATAGGATGGGTTT | |
OsGBSSI-F | AACGTGGCTGCTCCTTGAA | |
OsGBSSI-R | TTGGCAATAAGCCACACACA | |
OsSSI-F | GGGCCTTCATGGATCAACC | |
OsSSI-R | CCGCTTCAAGCATCCTCATC | |
OsSSIIa-F | GCTTCCGGTTTGTGTGTTCA | |
OsSSIIa-R | CTTAATACTCCCTCAACTCCACCAT | |
OsIAS1-F | TGCTCAGCTACTCCTCCATCATC | |
OsIAS1-R | AGGACCGCACAACTTCAACATA | |
Subcellular localization | ||
ZmCBM48-1-GFP-F | GG ACTAGT ATGCCACCGCGTCCCGCGCT | |
ZmCBM48-1-GFP-R | CGGGATCCAGTGACAAGCAGAAGGTTGTTTTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, X.; Yu, W.; Chen, Y.; Jiang, Y.; Ji, Y.; Chen, L.; Cheng, B.; Wu, J. A Maize CBM Domain Containing the Protein ZmCBM48-1 Positively Regulates Starch Synthesis in the Rice Endosperm. Int. J. Mol. Sci. 2022, 23, 6598. https://doi.org/10.3390/ijms23126598
Peng X, Yu W, Chen Y, Jiang Y, Ji Y, Chen L, Cheng B, Wu J. A Maize CBM Domain Containing the Protein ZmCBM48-1 Positively Regulates Starch Synthesis in the Rice Endosperm. International Journal of Molecular Sciences. 2022; 23(12):6598. https://doi.org/10.3390/ijms23126598
Chicago/Turabian StylePeng, Xiaojian, Wei Yu, Yirong Chen, Yingli Jiang, Yaru Ji, Long Chen, Beijiu Cheng, and Jiandong Wu. 2022. "A Maize CBM Domain Containing the Protein ZmCBM48-1 Positively Regulates Starch Synthesis in the Rice Endosperm" International Journal of Molecular Sciences 23, no. 12: 6598. https://doi.org/10.3390/ijms23126598
APA StylePeng, X., Yu, W., Chen, Y., Jiang, Y., Ji, Y., Chen, L., Cheng, B., & Wu, J. (2022). A Maize CBM Domain Containing the Protein ZmCBM48-1 Positively Regulates Starch Synthesis in the Rice Endosperm. International Journal of Molecular Sciences, 23(12), 6598. https://doi.org/10.3390/ijms23126598