The Endophytic Fungus Piriformospora indica Reprograms Banana to Cold Resistance
Abstract
1. Introduction
2. Results
2.1. P. indica Colonization Detection Result
2.2. The Injury and Influence on Chlorophyll Fluorescence Parameters Caused by Low Temperature in Banana Leaves Could Be Alleviated by P. indica Colonization
2.3. Effects of P. indica on SOD, POD, CAT, and PPO Activities in Banana Leaves under Cold Stress
2.4. Effects of P. indica on APX and GR Activities in Banana Leaves under Cold Stress
2.5. Effects of P. indica on MDA, SS, Proline, and H2O2 Contents of Banana Leaves under Cold Stress
2.6. Effects of P. indica on the Expression of Cold-Responsive Genes in Banana Leaves under Cold Stress
3. Discussion
4. Materials and Methods
4.1. Plant Material and Fungal Inoculation
4.2. P. indica Colonization Detection and Cold Treatment
4.3. Relative Electrolyte Leakage Measurement
4.4. Chlorophyll Fluorescence Measurement and Leaf Sample Harvesting
4.5. Assay of Antioxidant Enzyme Activity
4.6. Measurement of MDA, H2O2, Proline, and Soluble Sugar Contents
4.7. Analysis of Gene Expression by qRT-PCR
4.8. Statistics Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| SOD | superoxide dismutase | 
| POD | peroxidase | 
| CAT | catalase | 
| PPO | polyphenol oxidase | 
| MDA | malondialdehyde | 
| SS | soluble sugar | 
| H2O2 | hydrogen peroxide | 
| APX | ascorbate peroxidase | 
| GR | glutathione reductase | 
| AsA | ascorbic acid | 
| NADPH | nicotinamide adenine dinucleotide phosphate | 
| GSSG | glutathione oxidized | 
| GSH | reduced glutathione | 
| PS | photosynthetic system | 
| Fv/Fm | ratio of variable to maximal fluorescence- maximum photochemistry efficiency of PS II | 
| Fv/Fo | potential photosynthetic efficiency of PS II | 
| qP | photochemical quenching coefficient | 
| qN | non-photochemical quenching coefficient | 
| Y(II) | efficient quantum yield | 
| ETR | photosynthetic electron transport rate | 
| CSD1C | copper/zinc superoxide dismutase 1C | 
| ChiⅠ 1 | chitinase anti-freeze protein Ⅰ 1 | 
| Why 1 | transcription factor WHIRLY 1 | 
| ADA1 | adaptor 1 | 
| HOS1 | high expression of osmotically responsive gene 1 | 
| ICE1 | inducer of CBF expression 1 | 
| KIN10 | SNF1-related protein kinase catalytic subunit alpha 10 | 
| CBF7-1 | CRT (C-repeat/dehydration response element)/DRE (dehydration responsive element)-binding factor 7-1 | 
References
- Waller, F.; Achatz, B.; Baltruschat, H.; Fodor, J.; Becker, K.; Fischer, M.; Heier, T.; Huckelhoven, R.; Neumann, C.; von Wettstein, D.; et al. The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proc. Natl. Acad. Sci. USA 2005, 102, 13386–13391. [Google Scholar] [CrossRef]
- Kumar, M.; Yadav, V.; Tuteja, N.; Johri, A.K. Antioxidant enzyme activities in maize plants colonized with Piriformospora indica. Microbiology 2009, 155, 780–790. [Google Scholar] [CrossRef]
- Varma, A.; Verma, S.; Sudha; Sahay, N.; Bütehorn, B.; Franken, P. Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Appl. Environ. Microbiol. 1999, 65, 2741–2744. [Google Scholar] [CrossRef]
- Sherameti, I.; Shahollari, B.; Venus, Y.; Altschmied, L.; Varma, A.; Oelmüller, R. The endophytic fungus Piriformospora indica stimulates the expression of nitrate reductase and the starch-degrading enzyme glucan-water dikinase in tobacco and Arabidopsis roots through a homeodomain transcription factor that binds to a conserved motif in their promoters. J. Biol. Chem. 2005. [Google Scholar] [CrossRef]
- Bagheri, A.A.; Saadatmand, S.; Niknam, V.; Nejadsatari, T.; Babaeizad, V. Effects of Piriformospora indica on biochemical parameters of Oryza sativa under salt stress. Int. J. Biosci. 2014, 4, 24–32. [Google Scholar] [CrossRef]
- Baltruschat, H.; Fodor, J.; Harrach, B.D.; Niemczyk, E.; Barna, B.; Gullner, G.; Janeczko, A.; Kogel, K.H.; Schäfer, P.; Schwarczinger, I.; et al. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol. 2008, 180, 501–510. [Google Scholar] [CrossRef] [PubMed]
- Peškan-Berghöfer, T.; Shahollari, B.; Giong, P.H.; Hehl, S.; Markert, C.; Blanke, V.; Kost, G.; Varma, A.; Oelmüller, R. Association of Piriformospora indica with Arabidopsis thaliana roots represents a novel system to study beneficial plant-microbe interactions and involves early plant protein modifications in the endoplasmic reticulum and at the plasma membrane. Physiol. Plant. 2004, 122, 465–477. [Google Scholar] [CrossRef]
- Kumari, R.; Kishan, H.; Bhoon, Y.K.; Varma, A. Colonization of cruciferous plants by Piriformospora indica. Curr. Sci. 2003, 85, 1672–1674. [Google Scholar]
- Qiang, X.; Weiss, M.; Kogel, K.H.; Schäfer, P. Piriformospora indica—A mutualistic basidiomycete with an exceptionally large plant host range. Mol. Plant Pathol. 2012, 13, 508–518. [Google Scholar] [CrossRef]
- Elbehri, A.; Calberto, G.; Staver, C.; Hospido, A.; Skully, D.; Siles, P.; Arguello, J.; Sotomayaor, I.; Bustamante, A. Ecuador’s Banana Sector under Climate Change: An Economic and Biophysical Assessment to Promote a Sustainable and Climate-Compatible Strategy; Elbehri, A., Ed.; FAO: Rome, Italy, 2016; ISBN 978-92-5-109249-1. [Google Scholar]
- Zhang, H. Development report and situation forecast of banana industry in 2015. World Trop. Agric. Inf. 2016, 8, 31–37. (In Chinese) [Google Scholar]
- Wang, F.; Guo, J.; Ke, Y.; Li, C. China banana industry development report 2016 and development trend 2017. China Trop. Agric. 2017, 3, 25–29. (In Chinese) [Google Scholar]
- Charest, C.; Dalpé, Y.; Brown, A. The effect of vesicular-arbuscular mycorrhizae and chilling on two hybrids of Zea mays L. Mycorrhiza 1993, 4, 89–92. [Google Scholar] [CrossRef]
- Liu, Z.L.; Li, Y.J.; Hou, H.Y.; Zhu, X.C.; Rai, V.; He, X.Y.; Tian, C.J. Differences in the arbuscular mycorrhizal fungi-improved rice resistance to low temperature at two N levels: Aspects of N and C metabolism on the plant side. Plant Physiol. Biochem. 2013, 71, 87–95. [Google Scholar] [CrossRef]
- Chen, S.; Jin, W.; Liu, A.; Zhang, S.; Liu, D.; Wang, F.; Lin, X.; He, C. Arbuscular mycorrhizal fungi (AMF) increase growth and secondary metabolism in cucumber subjected to low temperature stress. Sci. Hortic. 2013, 160, 222–229. [Google Scholar] [CrossRef]
- Chu, X.T.; Fu, J.J.; Sun, Y.F.; Xu, Y.M.; Miao, Y.J.; Xu, Y.F.; Hu, T.M. Effect of arbuscular mycorrhizal fungi inoculation on cold stress-induced oxidative damage in leaves of Elymus nutans Griseb. S. Afr. J. Bot. 2016, 104, 21–29. [Google Scholar] [CrossRef]
- Camehl, I.; Sherameti, I.; Venus, Y.; Bethke, G.; Varma, A.; Lee, J.; Oelmüller, R. Ethylene signalling and ethylene-targeted transcription factors are required to balance beneficial and nonbeneficial traits in the symbiosis between the endophytic fungus Piriformospora indica and Arabidopsis thaliana. New Phytol. 2010, 185, 1062–1073. [Google Scholar] [CrossRef] [PubMed]
- Nanda, R.; Agrawal, V. Piriformospora indica, an excellent system for heavy metal sequestration and amelioration of oxidative stress and DNA damage in Cassia angustifolia Vahl under copper stress. Ecotoxicol. Environ. Saf. 2018, 156, 409–419. [Google Scholar] [CrossRef] [PubMed]
- Khatabi, B.; Molitor, A.; Lindermayr, C.; Pfiffi, S.; Durner, J.; von Wettstein, D.; Kogel, K.-H.; Schäfer, P. Ethylene supports colonization of plant roots by the mutualistic fungus Piriformospora indica. PLoS ONE 2012, 7, e35502. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Shao, Y.; Vahabi, K.; Lu, J.; Bhattacharya, S.; Dong, S.; Yeh, K.W.; Sherameti, I.; Lou, B.; Baldwin, I.T.; et al. The beneficial fungus Piriformospora indica protects Arabidopsis from Verticillium dahliae infection by downregulation plant defense responses. BMC Plant Biol. 2014, 14, 268. [Google Scholar] [CrossRef]
- Sun, C.; Shao, Y.; Vahabi, K. Piriformospora indica is an efficient biocontrol agent against Verticillium dahliae wilt: Role of phytohormone signaling in the three partite interaction. J. Endocytobiosis Cell Res. 2014, 25, 9–19. [Google Scholar]
- Varma, A.; Bakshi, M.; Lou, B.; Hartmann, A.; Oelmueller, R. Piriformospora indica: A novel plant growth-promoting mycorrhizal fungus. Agric. Res. 2012, 1, 117–131. [Google Scholar] [CrossRef]
- Varma, A.; Sowjanya Sree, K.; Arora, M.; Bajaj, R.; Prasad, R.; Kharkwal, A.C. Functions of novel symbiotic fungus—Piriformospora indica. Proc. Indian Natl. Sci. Acad. 2014, 80, 429–441. [Google Scholar] [CrossRef]
- Murphy, B.R.; Doohan, F.M.; Hodkinson, T.R. Yield increase induced by the fungal root endophyte Piriformospora indica in barley grown at low temperature is nutrient limited. Symbiosis 2014, 62, 29–39. [Google Scholar] [CrossRef]
- Alizadeh, F.M.; Pirdashti, H.; Yaghoubian, Y.; Babaeizad, V. Effect of paclobutrazol and Piriformospora indica inoculation on antioxidant enzymes activity and morphological characteristics of green beans (Phaseoluse vulgaris L.) in chilling stress (In Persian). J. Plant Process Funct. 2016, 5, 133–146. [Google Scholar]
- Jiang, W.; Pan, R.; Wu, C.; Xu, L.; Abdelaziz, M.E.; Oelmüller, R.; Zhang, W. Piriformospora indica enhances freezing tolerance and post-thaw recovery in Arabidopsis by stimulating the expression of CBF genes. Plant Signal. Behav. 2020, 15, e1745472. [Google Scholar] [CrossRef] [PubMed]
- David, B.M.; Sun, X.; Mensah, R.A.; Li, D.; Liu, F.; Tian, N.; Lai, Z.; Cheng, C. Physiological and biochemical mechanism of Piriformospora indica induced high temperature resistance in banana. Chinese J. Appl. Environ. Biol. 2020, 26, 1466–1472. [Google Scholar] [CrossRef]
- Madaan, G.; Gosal, S.K.; Gosal, S.S.; Saroa, G.S.; Gill, M.I.S. Effect of microbial inoculants on the growth and yield of micropropagated banana (Musa indica) cv. Grand Naine. J. Hortic. Sci. Biotechnol. 2013, 88, 643–649. [Google Scholar] [CrossRef]
- Li, D.; Mensah, R.A.; Liu, F.; Tian, N.; Qi, Q.; Yeh, K.W.; Xuhan, X.; Cheng, C.; Lai, Z. Effects of Piriformospora indica on rooting and growth of tissue-cultured banana (Musa acuminata cv. Tianbaojiao) seedlings. Sci. Hortic. 2019, 257, 108649. [Google Scholar] [CrossRef]
- Cheng, C.; Li, D.; Qi, Q.; Sun, X.; Mensah, R.A.; David, B.M.; Zhang, Y.; Hao, X.; Zhang, Z.; Lai, Z. The root endophytic fungus Serendipita indica improves resistance of banana to Fusarium oxysporum f. sp. cubense tropical race 4. Eur. J. Plant Pathol. 2020, 156, 87–100. [Google Scholar] [CrossRef]
- Hui, F.; Peng, B.; Lou, B.; Lin, F.; Nie, C.; Liu, J. Piriformospora indica improves salt tolerance in Nicotiana tobacum by promoting the synthesis of osmolyte and inducing the expression of stress resistance genes. J. Agric. Biotechnol. 2014, 22, 168–176. [Google Scholar] [CrossRef]
- Sun, C.; Johnson, J.M.; Cai, D.; Sherameti, I.; Oelmüller, R.; Lou, B. Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimulating antioxidant enzymes, the expression of drought-related genes and the plastid-localized CAS protein. J. Plant Physiol. 2010, 167, 1009–1017. [Google Scholar] [CrossRef]
- Xu, L.; Wang, A.; Wang, J.; Wei, Q.; Zhang, W. Piriformospora indica confers drought tolerance on Zea mays L. through enhancement of antioxidant activity and expression of drought-related genes. Crop J. 2017, 5, 251–258. [Google Scholar] [CrossRef]
- Tsai, H.J.; Shao, K.H.; Chan, M.T.; Cheng, C.P.; Yeh, K.W.; Oelmüller, R.; Wang, S.J. Piriformospora indica symbiosis improves water stress tolerance of rice through regulating stomata behavior and ROS scavenging systems. Plant Signal. Behav. 2020, 15, 1722447. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Lai, Z.; Lin, Y.; Lai, G.; Lian, C. Genome-wide identification and characterization of the superoxide dismutase gene family in Musa acuminata cv. Tianbaojiao (AAA group). BMC Genom. 2015, 16, 823. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M. Cloning and Expression Analysis of Cold Resistance Relative Genes of the Wild Banana (Musa spp., AB Group). Ph.D. Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2010. [Google Scholar]
- Yang, Y. Cloning and Expression of WHIRLY in the Wild Banana from Sanming City and Musa spp. cv. Tianbaojiao. Master’s Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2014. [Google Scholar]
- Liu, W. Studies on the Responsive Mechanism of Wild Banana (Musa itinerans) to Low-Temperature Stress Based on the Transcription of RNA-seq Technology. Ph.D. Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2018. [Google Scholar]
- Liu, W.; Cheng, C.; Chen, F.; Ni, S.; Lin, Y.; Lai, Z. High-throughput sequencing of small RNAs revealed the diversified cold-responsive pathways during cold stress in the wild banana (Musa itinerans). BMC Plant Biol. 2018, 18, 308. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Cheng, C.; Lai, G.; Lin, Y.; Lai, Z. Molecular cloning and expression analysis of KIN10 and cold-acclimation related genes in wild banana ‘Huanxi’ (Musa itinerans). Springerplus 2015, 4, 829. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Lin, Y.; Lai, Z. Cloning and expression profle of the cDNA and promoter of CBF7 in wild banana (Musa itinerans) from Huanxi of Fuzhou City. Chin. J. Appl. Environ. Biol. 2017, 23, 0200–0208. (In Chinese) [Google Scholar] [CrossRef]
- Wu, J.; Zhang, Y.; Yin, L.; Qu, J.; Lu, J. Linkage of cold acclimation and disease resistance through plant–pathogen interaction pathway in Vitis amurensis grapevine. Funct. Integr. Genom. 2014, 14, 741–755. [Google Scholar] [CrossRef]
- Chen, F. Cloning and Cold Resistance Analysis of β-1,3 Glucanase Gene (Mugsps) from Wild Banana. Master’s Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2016. [Google Scholar]
- Ehlert, B.; Hincha, D.K. Chlorophyll fluorescence imaging accurately quantifies freezing damage and cold acclimation responses in Arabidopsis leaves. Plant Methods 2008, 4, 1–7. [Google Scholar] [CrossRef]
- Chen, X.; Song, F.; Zhu, X.; Sun, L.; Ma, F.; Liu, S. Effect of arbuscular mycorrhizal fungus on morphology, growth and photosynthetic characteristics in maize seedlings under low temperature stress. Acta Agric. Boreali Sin. 2014, 29, 155–161. (In Chinese) [Google Scholar] [CrossRef]
- Cao, Y.; Dai, P.; Dai, S. Effects of arbuscular mycorrhiza fungi on seedlings growth and chlorophyll fluorescence parameters in cucumber under low temperature stress. J. Hebei Agric. Sci. 2016, 20, 34–37. (In Chinese) [Google Scholar] [CrossRef]
- Johnson, J.M.; Alex, T.; Oelmüller, R. Piriformospora indica: The versatile and multifunctional root endophytic fungus for enhanced yield and tolerance to biotic and abiotic stress in crop plants. J. Trop. Agric. 2014, 52, 103–122. [Google Scholar]
- Johnson, J.M. The Role of Cytosolic Calcium Signaling in Beneficial and Pathogenic Interactions in Arabidopsis thaliana. Ph.D. Thesis, Friedrich-Schiller-Universität Jena, Jena, Germany, 2014. [Google Scholar]
- Liu, Z.; Cheng, R.; Xiao, W.; Guo, Q.; Wang, N. Effect of off-season flooding on growth, photosynthesis, carbohydrate partitioning, and nutrient uptake in Distylium chinense. PLoS ONE 2014, 9, e107636. [Google Scholar] [CrossRef]
- Nath, M.; Bhatt, D.; Prasad, R.; Gill, S.S.; Anjum, N.A.; Tuteja, N. Reactive oxygen species generation-scavenging and signaling during plant-arbuscular mycorrhizal and Piriformospora indica interaction under stress condition. Front. Plant Sci. 2016, 7, 1574. [Google Scholar] [CrossRef] [PubMed]
- Garg, N.; Aggarwal, N. Effect of mycorrhizal inoculations on heavy metal uptake and stress alleviation of Cajanus cajan (L.) Millsp. genotypes grown in cadmium and lead contaminated soils. Plant Growth Regul. 2012, 66, 9–26. [Google Scholar] [CrossRef]
- Khazaei, M.; Maali-Amiri, R.; Talei, A.R.; Ramezanpour, S. Differential transcript accumulation of dhydrin and beta-glucosidase genes to cold-induced oxidative stress in chickpea. J. Agric. Sci. Technol. 2015, 17, 725–734. [Google Scholar]
- Han, B.; He, C.; Yan, Y.; Guo, S.; Yu, X. Effects of arbuscular mycorrhiza fungi on seedlings growth and antioxidant systems of leaves in cucumber under low temperature stress. Sci. Agric. Sin. 2011, 44, 1646–1653. [Google Scholar] [CrossRef]
- Liu, X.M.; Xu, Q.L.; Li, Q.Q.; Zhang, H.; Xiao, J.X. Physiological responses of the two blueberry cultivars to inoculation with an arbuscular mycorrhizal fungus under low-temperature stress. J. Plant Nutr. 2017, 40, 2562–2570. [Google Scholar] [CrossRef]
- May, M.J.; Vernoux, T.; Leaver, C.; Montagu, M.V.; Inze, D. Glutathione homeostasis in plants: Implications for environmental sensing and plant development. J. Exp. Bot. 1998, 49, 649–667. [Google Scholar] [CrossRef]
- Sharma, P.; Kharkwal, A.C.; Abdin, M.Z.; Varma, A. Piriformospora indica -mediated salinity tolerance in Aloe vera plantlets. Symbiosis 2017, 72, 103–115. [Google Scholar] [CrossRef]
- Alscher, R.G. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 2002, 53, 1331–1341. [Google Scholar] [CrossRef]
- Kumar, M.; Sharma, R.; Jogawat, A.; Singh, P.; Dua, M.; Gill, S.S.; Trivedi, D.K.; Tuteja, N.; Verma, A.K.; Oelmüller, R.; et al. Piriformospora indica, a root endophytic fungus, enhances abiotic stress tolerance of the host plant. In Improving Crop Resistance to Abiotic Stress; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2012; pp. 543–558. [Google Scholar]
- Gill, S.S.; Gill, R.; Trivedi, D.K.; Anjum, N.A.; Sharma, K.K.; Ansari, M.W.; Ansari, A.A.; Johri, A.K.; Prasad, R.; Pereira, E.; et al. Piriformospora indica: Potential and significance in plant stress tolerance. Front. Microbiol. 2016, 7, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Rai, M.; Acharya, D.; Singh, A.; Varma, A. Positive growth responses of the medicinal plants Spilanthes calva and Withania somnifera to inoculation by Piriformospora indica in a field trial. Mycorrhiza 2001, 11, 123–128. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.S.; Gao, J.; He, W.D.; Dou, T.X.; Ding, L.J.; Wu, J.H.; Li, C.Y.; Peng, X.X.; Zhang, S.; Yi, G.J. Comparative transcriptomics analysis reveals difference of key gene expression between banana and plantain in response to cold stress. BMC Genom. 2015, 16, 446. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Li, M.; Mitra, S.; Muhammad, R.H.; Debnath, B.; Lu, X.; Jian, H.; Qiu, D. Comparative phytochemical profiles and antioxidant enzyme activity analyses of the southern highbush blueberry (Vaccinium corymbosum) at different developmental stages. Molecules 2018, 23, 2209. [Google Scholar] [CrossRef]
- Lin, Y.L.; Lai, Z.X. Superoxide dismutase multigene family in longan somatic embryos: A comparison of CuZn-SOD, Fe-SOD, and Mn-SOD gene structure, splicing, phylogeny, and expression. Mol. Breed. 2013, 32, 595–615. [Google Scholar] [CrossRef]
- Chen, L.; Zhong, H.Y.; Kuang, J.F.; Li, J.G.; Lu, W.J.; Chen, J. Validation of reference genes for RT-qPCR studies of gene expression in banana fruit under different experimental conditions. Planta 2011, 234, 377–390. [Google Scholar] [CrossRef] [PubMed]






| Gene | Accession No. | Primer Sequences (5′→3′) | Tm (°C) | Reference | 
|---|---|---|---|---|
| CSD1C | KM017514 | F: GCCGATCCAGATGATCTTG | 57 | [35] | 
| R: ACCTCACCATCCAACCAATAG | ||||
| ChiI 1 | FJ858155 | F: CCTTGTTGTTGGTCATCTTTACC | 58 | [36] | 
| R: ATTGGCTCTGGCATCCTTGG | ||||
| Why1 | KJ637331 | F: GCTTCCTCTCATGCAGCTCT | 60 | [37] | 
| R: TGGTGACACTGACAAGGCAG | ||||
| ADA1 | MG451820 | F: CTGTGGAAGATGGGGAAGAG | 59 | [38,39] | 
| R: CTCGTATCTGGCAGTTGAGAAG | ||||
| HOS1 | JX678611 | F: GATCGGCATTGGAAGAGAC | 56 | [40] | 
| R: GAGAACTTGAGCTATCTTCGG | ||||
| KIN10 | KC127685 | F: GAGATTCGAGAACATCCATGG | 58 | [40] | 
| R: ACTCATAGCACGGAACCTATTG | ||||
| CBF7-1 | KC157575.1 | F: GAGTAAGCATCCGGTGTACC | 57 | [41] | 
| R: CAGATCCGCGACTTCTTG | ||||
| ICE1 | KC157569 | F: GAACTCCGCAAGCCAATTC | 58 | [40] | 
| R: CTTCCTCCAATGCAGCCA | ||||
| CAC | HQ853240 | F: AACTCCTATGTTGCTCGCTTATG | 57 | [64] | 
| R: GGCTACTACTTCGGTTCTTTCAC | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; Bodjrenou, D.M.; Zhang, S.; Wang, B.; Pan, H.; Yeh, K.-W.; Lai, Z.; Cheng, C. The Endophytic Fungus Piriformospora indica Reprograms Banana to Cold Resistance. Int. J. Mol. Sci. 2021, 22, 4973. https://doi.org/10.3390/ijms22094973
Li D, Bodjrenou DM, Zhang S, Wang B, Pan H, Yeh K-W, Lai Z, Cheng C. The Endophytic Fungus Piriformospora indica Reprograms Banana to Cold Resistance. International Journal of Molecular Sciences. 2021; 22(9):4973. https://doi.org/10.3390/ijms22094973
Chicago/Turabian StyleLi, Dan, David Mahoudjro Bodjrenou, Shuting Zhang, Bin Wang, Hong Pan, Kai-Wun Yeh, Zhongxiong Lai, and Chunzhen Cheng. 2021. "The Endophytic Fungus Piriformospora indica Reprograms Banana to Cold Resistance" International Journal of Molecular Sciences 22, no. 9: 4973. https://doi.org/10.3390/ijms22094973
APA StyleLi, D., Bodjrenou, D. M., Zhang, S., Wang, B., Pan, H., Yeh, K.-W., Lai, Z., & Cheng, C. (2021). The Endophytic Fungus Piriformospora indica Reprograms Banana to Cold Resistance. International Journal of Molecular Sciences, 22(9), 4973. https://doi.org/10.3390/ijms22094973
 
         
                                                


 
       