Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells
Abstract
1. Introduction
2. Results and Discussion
2.1. Chemistry
2.2. Thermal Decomposition
2.3. Biological Assays
Cytotoxicity Analyses
3. Materials and Methods
3.1. Chemistry
3.1.1. General Procedure for the Synthesis of Thiosemicarbazone Derivatives (T1–T19)
3.1.2. T1. 2-[(3,4-Dimethoxyphenyl)methylidene-N-phenyl- hydrazine-1-carbothioamide
3.1.3. T2. 2-[(4-Bromophenyl)methylidene-N-methyl- hydrazine-1-carbothioamide
3.1.4. T3. 2-[(3,4-Dimethoxyphenyl)methylidene-N-methyl- hydrazine-1-carbothioamide
3.1.5. T4. 2-[1-(4-Aminophenyl)ethylidene]-N-methyl-hydrazine-1-carbothioamide
3.1.6. T5. 2-[(3,4-Dichlorophenyl)methylidene]-N-methyl- hydrazine-1-carbothioamide
3.1.7. T6. 2-[(4-Bromophenyl)methylidene]-N-(2-methylphenyl)hydrazine-1-carbothioamide
3.1.8. T7. 2-[(3,4-Dimethoxyphenyl)methylidene]-N-(2-methylphenyl)hydrazine-1-carbothioamide
3.1.9. T8. 2-[(3,4-Dichlorophenyl)methylidene]-N-(2-methylphenyl)hydrazine-1-carbothioamide
3.1.10. T9. 2-[(4-Bromophenyl)methylidene]-N-(2-chlorophenyl)hydrazine-1-carbothioamide
3.1.11. T10. 2-[(3,4-Dimethoxyphenyl)methylidene-N-(2-chlorophenyl)hydrazine-1-carbothioamide
3.1.12. T11. N-(2-Chlorophenyl)-2-(1-phenylethylidene)hydrazine-1-carbothioamide
3.1.13. T12. 2-[(3,4-Dichlorophenyl)methylidene]-N-(2-chlorophenyl)hydrazine-1-carbothioamide
3.1.14. T13. 2-[(4-Bromophenyl)methylidene]-N-(3-chlorophenyl)hydrazine-1-carbothioamide
3.1.15. T14. 2-[(4,5-Dimethoxyphenyl)methylidene-N-(3-chlorophenyl)hydrazine-1-carbothioamide
3.1.16. T15. N-(3-Chlorophenyl)-2-[(3,4-dichlorophenyl)methylidene]hydrazine-1-carbothioamide
3.1.17. T16. 2-[(4,5-Dimethoxyphenyl)methylidene-N-(4-chlorophenyl)hydrazine-1-carbothioamide
3.1.18. T17. N-(4-Chlorophenyl)-2-[(3,4-dichlorophenyl)methylidene]hydrazine-1-carbothioamide
3.1.19. T18. 2-[(4-Bromophenyl)methylidene]-N-(4-chlorophenyl)hydrazine-1-carbothioamide
3.1.20. T19. N-(3-Chlorophenyl)-2-(1-phenylethylidene) hydrazine-1-carbothioamide
3.2. X-ray Structure Determination
3.3. Theoretical Calculations
3.4. General Procedure for the Synthesis of Cu (II) Complex of Thiosemicarbazone Derivatives
3.5. Biological Assays
3.5.1. Cell Culturing
3.5.2. Cell Viability Assay
3.5.3. Cell Cycle Assay
3.5.4. Cell Apoptosis Assay
3.5.5. DNA Damage Evaluation
3.5.6. Gene Expression Evaluation
3.5.7. X-ray Radiation
3.5.8. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| MDPI | Multidisciplinary Digital Publishing Institute |
| DOAJ | Directory of open access journals |
| TLA | Three letter acronym |
| LD | linear dichroism |
References
- Soraires, S.M.; Fabiani, M.; Castro, E.; Cavallaro, L.; Finkielsztein, L. Synthesis, antiviral evaluation and molecular docking studies of N4-arylsubstituted/unsubstituted thiosemicarbazones derived from1-indanones as potent anti-bovine viral diarrhea virus agents. Bioorg. Med. Chem. 2017, 25, 4055–4063. [Google Scholar] [CrossRef]
- Shehzas, M.T.; Imran, A.; Njateng, G.S.S.; Hameed, A.; Islam, M.; Al-Rashida, M.; Uroos, M.; Asari, A.; Shafig, Z.; Igbal, J. Benzoxazinone-thiosemicarbazones as antidiabetic Leeds via aldose reductase inhibition: Synthesis, biological screening and molecular docking study. Bioorg. Chem. 2019, 87, 857–866. [Google Scholar] [CrossRef] [PubMed]
- Santos, F.; Andrade, J.; Sousa, C.; Fernandes, J.; Carmo, L.; Araujo, M.; Ferreira, J.; Villar, J. Synthesis and Evaluation of the in vitro Antimicrobial Activity of Triazoles, Morpholines and Thiosemicarbazones. Med. Chem. 2019, 15, 38–50. [Google Scholar] [CrossRef] [PubMed]
- Shao, J.; Zhou, B.; Chu, B.; Yen, Y. Ribonucleotide Reductase Inhibitors and Future Drug Design. Curr. Cancer Drug Targets 2006, 6, 409–431. [Google Scholar] [CrossRef]
- Shao, J.; Zhou, B.; Di Bilio, A.; Zhu, L.; Wang, T.; Qi, C.; Shih, J.; Yen, Y. A Ferrous-Triapine complex mediates formation of reactive oxygen species that inactivate human ribonucleotide reductase. Mol. Cancer Ther. 2006, 5, 586–592. [Google Scholar] [CrossRef]
- Mrozek-Wilczkiewicz, A.; Malarz, K.; Rejmund, M.; Polanski, J.; Musiol, R. Anticancer activity of the thiosemicarbazones that are based on di-2-pyridine ketone and quinoline moiety. Eur. J. Med. Chem. 2019, 171, 180–194. [Google Scholar] [CrossRef] [PubMed]
- Finch, R.; Liu, M.; Grill, S.; Rose, W.; Loomis, R.; Vasquez, K.; Cheng, Y.; Sartorelli, A. A Triapine (3-aminopyridine-2-carboxaldehydethiosemicarbazone): A potent inhibitor of ribonucleotide reductase activity with broad spectrum antitumor activity. Biochem. Pharmacol. 2000, 59, 983–991. [Google Scholar] [CrossRef]
- Whitnall, M.; Howard, J.; Ponka, P.; Richardson, D. A class of iron chelators with a wide spectrum of potent antitumor activity that overcomes resistance to chemotherapeutics. Proc. Natl. Acad. Sci. USA 2006, 103, 14901–14906. [Google Scholar] [CrossRef]
- Li, P.; Zheng, X.; Shou, K.; Niu, Y.; Jian, C.; Zhao, Y.; Yi, W.; Hu, X.; Yu, A. The iron chelator Dp44mT suppresses osteosarcoma’s proliferation, invasion and migration: In vitro and in vivo. Am. J. Transl. Res. 2016, 8, 5370–5385. [Google Scholar]
- Kovacevic, Z.; Chikhani, S.; Lovejoy, D.; Richardson, D. Novel thiosemicarbazone iron chelators induce up-regulation and phosphorylation of the metastasis suppressor N-myc down-stream regulated gene 1: A new strategy for the treatment of pancreatic cancer. Mol. Pharmacol. 2011, 80, 598–609. [Google Scholar] [CrossRef]
- Guo, Z.L.; Richardson, D.R.; Kalinowski, D.S.; Kovacevic, Z.; Tan-Un, K.C.; Chan, G. The novel thiosemicarbazone, di-2-pyridylketone 4-cyclohexyl-4-methyl-3-thiosemicarbazone (DpC), inhibits neuroblastoma growth in vitro and in vivo via multiple mechanisms. J. Hematol. Oncol. 2016, 9, 98. [Google Scholar] [CrossRef] [PubMed]
- Carcelli, M.; Tegoni, M.; Bartoli, J.; Marzano, C.; Pelosi, G.; Salvalaio, M.; Rogolino, D.; Gandin, V. In vitro and in vivo anticancer activity of tridentate thiosemicarbazone copper complexes: Unravelling an unexplored pharmacological target. Eur. J. Med. Chem. 2020, 194, 112266. [Google Scholar] [CrossRef] [PubMed]
- Vishal, K.; Manjunatha, K.; Sanna, K.N.; Sasidhar, B.S.; Siddappa, A.P. DNA as a bioligand supported on magnetite for grafting palladium nanoparticles for cross—Coupling reaction. Appl. Organometal. Chem. 2020, 34, e5357. [Google Scholar]
- Balakrishnan, N.; Haribabu, J.; Dhanabalan, A.K.; Swaminathan, S.; Sun, S.; Dibwe, D.F.; Bhuvanesh, N.; Awale, S.; Karvembu, R. Thiosemicarbazone(s)-anchored water soluble mono- and bimetallic Cu(II) complexes: Enzyme-like activities, biomolecular interactions, anticancer property and real-time live cytotoxicity. Dalton Trans. 2020, 49, 9411–9424. [Google Scholar] [CrossRef]
- Qi, J.; Wang, X.; Liu, T.; Kandawa-Schulz, M.; Wang, Y.; Zheng, X. Synthesis, antiproliferative activity and mechanism of copper(II)-thiosemicarbazone complexes as potential anticancer and antimicrobial agents. J. Coord. Chem. 2020, 73, 1208–1221. [Google Scholar] [CrossRef]
- Lincy, J.; Mathew, G.; Mathews, P. 2-Acetylpiryidine thiosemicarbazones.1. A new class of potential antimalarial. Synthesis and characterization of novel 1, 3, 4-thiadiazole derivatives and screening for certain biological activities. Int. J. Pharm. Chem. Biol. Sci. 2015, 5, 928–937. [Google Scholar]
- Barghash, A.M.; Omar A-Mohsen, M.E.; Farghaly, A.M.; Raabg, M.S. Behavior of some thioacid hydrazone and thiosemicarbazone derivatives with amyl alcohol/hydrogen chloride and with sodium hydroxide. Pharmazie 1973, 28, 482–483. [Google Scholar]
- Serda, M.; Mrozek-Wilczkiewicz, A.; Jampilek, J.; Pesko, M.; Kralova, K.; Vejsova, M.; Musiol, R.; Ratuszna, A.; Polanski, J. Investigation of the Biological Properties of (Hetero)Aromatic Thiosemicarbazones. Molecules 2012, 17, 13483–13502. [Google Scholar] [CrossRef]
- Singh, P.; Jain, J.; Sinha, R.; Samad, A.; Kumar, R.; Malhotra, M. Synthesis and screening of substituted thiosemicarbazone derivatives: An approach towards novel anticonvulsant search. Cent. Nerv. Syst. Agents Med. Chem. 2011, 11, 60–65. [Google Scholar] [CrossRef]
- Klayman, D.L.; Bartosevich, J.F.; Griffin, T.S.; Mason, C.J.; Scovill, J.P. 2-Acetylpyridine thiosemicarbazones. 1. A new class of potential antimalarial agents. J. Med. Chem. 1979, 22, 855–862. [Google Scholar] [CrossRef]
- Ferraz, K.S.O.; Silva, N.F.; Da Silva, J.G.; Speziali, N.L.; Mendes, I.C.; Beraldo, H. Structural studies on acetophenone- and benzophenone-derived thiosemicarbazones and their zinc(II) complexes. J. Mol. Str. 2012, 1008, 102–107. [Google Scholar] [CrossRef]
- Argibay-Otero, S.; Vázquez-López, E.M. Crystal structure of N-(4-hydroxybenzyl)acetone thiosemicarbazone. Acta Cryst. E 2017, 73, 1382–1384. [Google Scholar] [CrossRef] [PubMed]
- Buu, D.T.; Ba, V.D.; Hoang, M.K.N.; Quoc, T.V.; Khanh, L.D.; Thid, Y.O.D.; Van Meervelte, L. Synthesis and redetermination of the crystal structure of salicylaldehyde N(4)-morpholinothiosemicarbazone. Acta Cryst. E 2019, 75, 1389–1393. [Google Scholar]
- Allen, F.H. The Cambridge Structural Database: A quarter of a million crystal structures and rising. Acta Cryst. B 2002, 58, 380–388. [Google Scholar] [CrossRef]
- Bruno, I.J.; Cole, J.C.; Edgington, P.R.; Kessler, M.; Macrae, C.F.; McCare, P.; Pearson, J.; Taylor, R. New software for searching the Cambridge Structural Database and visualizing crystal structures. Acta Cryst. B 2002, 58, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Uwaisulqarni, M.; Osman, U.M.; Silvarajoo, S.; Kamarudin, K.H.; Tahir, M.I.M.; Kwong, H.C. Ni(II) complex containing a thiosemicarbazone ligand: Synthesis, spectroscopy, single-crystal X-ray crystallographic and conductivity studies. J. Mol. Struct. 2021, 1223, 128994. [Google Scholar]
- Mumit, M.A.; Islam Md Al-Amin-Al-Azadul Sheikh Md, C.; Miyatake, R.; Omar Ali Mondal Md, O.A.; Alam Md, A. Synthesis, characterization and antimicrobial activity of a bidentate NS Schiff base containing S-allyl dithiocarbazate and its complexes. J. Mol. Struct. 2019, 1178, 583–589. [Google Scholar] [CrossRef]
- Casas, J.; Garda-Tasende, M.; Sordo, J. Main group metal complexes of semicarbazones and thiosemicarbazones. A structural review. Coord. Chem. Rev. 2000, 209, 197–261. [Google Scholar] [CrossRef]
- Kalinowski, D.; Yu, Y.; Sharpe, P.; Islam, M.; Liao, Y.; Lovejoy, D.; Kumar, N.; Bernhardt, P.; Richardson, D. Synthesis and characterization of noveliron chelators: Structure−activity relationships of the 2-benzoylpyridine thiose-micarbazone series and their 3-nitrobenzoyl analogues as potent antitumor agents. J. Med. Chem. 2007, 50, 3716–3729. [Google Scholar] [CrossRef]
- Abidand, M.; Azam, A. Synthesis and antiamoebic activities of 1-N-substituted cyclised pyrazoline analogues of thiosemicarbazones. Bioorg. Med. Chem. 2005, 13, 2213–2220. [Google Scholar] [CrossRef]
- Hamre, D.; Brownlee, K.; Donovick, R. Studies on the chemotherapy of vacciniavirus: II. The activity of some thiosemicarbazones. J. Immunol. 1951, 67, 305–312. [Google Scholar]
- Hameed, A.; Yagub, M.; Hussain, M.; Hameed, A.; Ashraf, M.; Asghar, H.; Naseer, M.; Mahmood, K.; Muddassar, M.; Tahir, M. Coumarin-based thiosemicarbazones aspotent urease inhibitors: Synthesis, solid state self-assembly and molecular docking. RSC Ad. 2016, 6, 63886–63894. [Google Scholar] [CrossRef]
- Kozlowski, J.M.; Hart, I.R.; Fidler, I.J.; Hanna, N. A human melanoma line heterogeneous with respect to metastatic capacity in athymic nude mice. J. Natl. Cancer Inst. 1984, 72, 913–917. [Google Scholar] [PubMed]
- Rosner, K.; Adsule, S.; Haynes, B.; Kirou, E.; Kato, I.; Mehregan, D.R.; Shekhar, M.P. Rad6 is a Potential Early Marker of Melanoma Development. Transl. Oncol. 2014, 12, 384–392. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.Y.; Lee, H.; Kim, S.H.; Jin, H.; Bae, J.; Choi, H.K. Discovery of potential biomarkers in human melanoma cells with different metastatic potential by metabolic and lipidomic profiling. Sci. Rep. 2017, 7, 8864. [Google Scholar] [CrossRef]
- Cabello, C.M.; Bair WB 3rd Bause, A.S.; Wondrak, G.T. Antimelanoma activity of the redox dye DCPIP (2,6-dichlorophenolindophenol) is antagonized by NQO1. Biochem. Pharmacol. 2009, 78, 344–354. [Google Scholar] [CrossRef] [PubMed]
- Sauvaigo, S.; Benkhiat, M.; Braisaz, F.; Girard, J.; Libert, S.; Mouret, S.; de Fraipont, F.; Aspord, C.; Bouquet, F.; Leccia, M.-T. DNA repair-based classification of melanoma cell lines reveals an effect of mutations in BRAF and NRAS driver genes on DNA repair capacity. bioRxiv 2020. [Google Scholar] [CrossRef]
- Hall, E.J.; Giaccia, A.J. Radiobiology for the Radiologist, 6th ed.; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2006. [Google Scholar]
- Shackelford, R.E.; Kaufmann, W.K.; Paules, R.S. Oxidative stress and cell cycle checkpoint function. Free Radic. Biol. Med. 2000, 28, 1387–1404. [Google Scholar] [CrossRef]
- Shackelford, R.E.; Innes, C.I.; Sieber, S.O.; Leado, S.A.; Paules, R.S. The ataxia telangiectasia gene product is required for oxidative stress-induced G1 and G2 checkpoint function in human fibroblasts. J. Biol. Chem. 2001, 276, 21951–21959. [Google Scholar] [CrossRef] [PubMed]
- Kow, Y.W.; Dare, A. Detection of abasic sites and oxidative DNA base damage using an ELISA-like assay. Methods 2000, 22, 164–169. [Google Scholar] [CrossRef]
- Kim, N.; Jinks-Robertson, S. Abasic sites in the transcribed strand of yeast DNA are removed by transcription-coupled nucleotide excision repair. Mol. Cell Biol. 2010, 30, 3206–3215. [Google Scholar] [CrossRef] [PubMed]
- Rotman, G.; Shiloh, Y. Ataxia-telangiectasia: Is ATM a sensor of oxidative damage and stress? Bioessays 1997, 19, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Hill, J.W.; Hazra, T.K.; Izumi, T.; Mitra, S. Stimulation of human 8-oxoguanine-DNA glycosylase by AP-endonuclease: Potential coordination of the initial steps in base excision repair. Nucleic Acids Res. 2001, 29, 430–438. [Google Scholar] [CrossRef] [PubMed]
- Marzano, C.; Pellei, M.; Tisato, F.; Santini, C. Copper complexes as anticancer agents. Anticancer Agents Med. Chem. 2009, 9, 185–211. [Google Scholar] [CrossRef]
- Jaafar, A.; Fix-Tailler, A.; Mansour, N.; Allain, M.; Shebaby, W.N.; Faour, W.H.; Tokajian, S.; El-Ghayoury, A.; Naoufal, D.; Bouchara, J.P.; et al. Synthesis, characterization, antifungal and antibacterial activities evaluation of copper (II), zinc (II) and cadmium (II) chloride and bromide complexes with New (E)-1-(3,4-dimethoxybenzylidene)-4-methylthiosemicarbazone ligand. Appl. Organomet. Chem. 2020, 34, e5988. [Google Scholar] [CrossRef]
- CrysAlisPro (CrysAlisPro, Agilent Technologies, Version 1.171.37.35h.) Release 09-02-2015 CrysAlis171.NET.
- Sheldrick, G.M. A short history of SHELX. Acta Cryst. 2008, 64, 112–122. [Google Scholar] [CrossRef] [PubMed]
- Farrugia, L.J. WinGX and ORTEP for Windows: An update. J. Appl. Cryst. 2012, 45, 849–854. [Google Scholar] [CrossRef]
- Frisch, M.J.; Trucks, G.W.; Schlegel, H.B.; Scuseria, G.E.; Robb, M.A.; Cheesema, J.R.; Montgomer, J.A.; Vreven, T.; Kudin, K.N.; Burant, J.C. Gaussian 03, Revision E.01; Gaussian Inc.: Wallingford, CT, USA, 2004. [Google Scholar]
- Quest Graph™ EC50 Calculator AAT Bioquest, Inc., 9 February 2020. Available online: https://www.aatbio.com/tools/ec50-calculator (accessed on 15 August 2020).










| Compound | D–H…A | D–H | H…A | D…A | D–H…A |
|---|---|---|---|---|---|
| T2 | |||||
| N1–H1…N5 | 0.78(5) | 2.26(6) | 2.646(5) | 111(5) | |
| N4–H4…S3 i | 0.80(4) | 2.63(4) | 3.416(3) | 167(4) | |
| i = 1 − x, −y, 1 − z; | |||||
| T3 | |||||
| N1–H1…N5 | 0.812(18) | 2.316(19) | 2.6743(17) | 107.5(16) | |
| N1–H1…O27 i | 0.812(18) | 2.521(18) | 3.1757(17) | 138.7(14) | |
| N4–H4…S3 ii | 0.855(18) | 2.569(18) | 3.4098(12) | 168.0(15) | |
| i = 1 − x, −1/2 + y, 1/2 − z; ii = 2 − x, −y, −z; | |||||
| T5 | |||||
| N1–H1…N5 | 0.76(4) | 2.34(4) | 2.649(3) | 106(3) | |
| N1–H1…S3 i | 0.76(4) | 2.86(4) | 3.522(2) | 146(3) | |
| N4–H4…S3 ii | 0.78(4) | 2.70(4) | 3.447(2) | 160(4) | |
| i = 1/2−x, −1/2 + y, 3/2−z; ii = −x, y, 2 − z; | |||||
| Compound | Range of Decomposition (℃) | Mass Loss (%) | Intermediate Solid Product or Residue | ||
|---|---|---|---|---|---|
| Found | Calc. | ||||
| Cu(T1)Cl2 | ![]() | 120–350 | 34.0 | 33.45 | ![]() |
| 350–680 | 43.0 | 42.83 | CuO | ||
| Cu(T10)2Cl2 | ![]() | 120–360 | 45.0 | 44.51 | ![]() |
| 360–720 | 43.0 | 42.67 | CuO | ||
| Cu(T12)2Cl2 | ![]() | 150–260 | 37.5 | 37.33 | ![]() |
| 260–720 | 56.0 | 55.20 | CuO | ||
| Cu(T13)Cl2 | ![]() | 120–520 | 33.5 | 33.59 | ![]() |
| 520–800 | 61.5 | 50.60 | CuO + volatile copper halide derivatives | ||
| Cu(T16)Cl2 | ![]() | 120–360 | 32.0 | 31.01 | ![]() |
| 360–780 | 47.5 | 46.90 | CuO | ||
| IC50 [µM] | ||||
|---|---|---|---|---|
| BJ | G361 | A375 | SK-MEL-28 | |
| T1 | 357.64 ± 7.85 | 488.07 ± 1.66 | 320.99 ± 2.85 | >500 |
| CuT1 | 257.12 ± 4.45 | 135.64 ± 7.01 | 69.92 ± 1.87 | 129.51 ± 3.98 |
| T10 | 402.17 ± 12.98 | 370.17 ± 9.34 | 201.77 ± 4.87 | <500 |
| CuT10 | 202.88 ± 8.67 | 251.19 ± 11.08 | 26.05 ± 1.75 | 132.98 ± 8.34 |
| T12 | 128.87 ± 7.09 | 177.35 ± 4.09 | 111.76 ± 12.75 | 99.64 ± 5.76 |
| CuT12 | 42.87 ± 1.17 | 157.17 ± 2.75 | 40.49 ± 0.98 | 46.13 ± 2.74 |
| T13 | 412.75 ± 3.23 | 395.75 ± 6.74 | 388.64 ± 7.06 | 398.86 ± 4.64 |
| CuT13 | 130.18 ± 3.45 | 148.07 ± 9.77 | 109.78 ± 2.95 | 118.60 ± 9.75 |
| T16 | >500 | >500 | >500 | >500 |
| CuT16 | 450.09 ± 11.74 | >500 | 144.60 ± 19.85 | 478.31 ± 11.02 |
| DTIC | >500 | 425.98 ± 4.74 | 412.77 ± 7.08 | 370.12 ± 9.46 |
| Gene symbol | Control | CuT1 | CuT10 | CuT16 | Scale (RQ) | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Mean RQ | SD | Mean RQ | SD | Mean RQ | SD | Mean RQ | SD | |||
| DNA damage response genes | ||||||||||
| ERCC | 1.001 | 0.066 | 0.401 | 0.010 | 1.215 | 0.155 | 0.267 | 0.036 | >2.00 | |
| MGMT | 1.007 | 0.147 | 0.715 | 0.088 | 0.448 | 0.024 | 0.361 | 0.053 | 1.51–1.99 | |
| OGG1 | 1.011 | 0.185 | 0.902 | 0.022 | 0.264 | 0.071 | 0.952 | 0.160 | 1.11–1.50 | |
| MLH1 | 1.002 | 0.078 | 1.001 | 0.163 | 0.337 | 0.057 | 0.929 | 0.068 | 0.91–1.10 | |
| PARP1 | 1.011 | 0.193 | 0.908 | 0.056 | 0.342 | 0.108 | 0.640 | 0.069 | 0.51–0.90 | |
| ATM | 1.005 | 0.127 | 1.452 | 0.102 | 2.038 | 0.166 | 2.724 | 0.295 | 0.31–0.5 | |
| XPC | 0.951 | 0.044 | 1.038 | 0.087 | 1.456 | 0.112 | 1.438 | 0.244 | <0.31 | |
| MSH2 | 1.003 | 0.094 | 0.973 | 0.100 | 1.337 | 0.436 | 0.936 | 0.093 | ||
| oxidative stress response genes | ||||||||||
| CAT | 1.003 | 0.101 | 0.773 | 0.044 | 0.801 | 0.065 | 0.387 | 0.056 | ||
| GPX2 | 1.010 | 0.184 | 0.000 | 0.000 | 0.022 | 0.000 | 0.022 | 0.002 | ||
| SOD2 | 1.009 | 0.173 | 1.510 | 0.114 | 1.430 | 0.082 | 1.393 | 0.151 | ||
| Gene Symbol | Protein Name | Forward Sequence (5′→3′) | Reverse Sequence (5′→3′) |
|---|---|---|---|
| ERCC | ERCC Excision Repair 1 | CTCGGAGTTTTGTGGGGGAC | CACTGGCGTCTACGTTCTCA |
| MGMT | O-6-methylguanine-DNA methyltransferase | ACCGTTTGCGACTTGGTACT | TGCTCACAACCAGACAGCTC |
| OGG1 | 8-oxoguanine DNA glycosylase | CCTGTGGGGACCTTATGCTG | TGTGAATCCCCTCTCCCGAT |
| MLH1 | mutL homolog 1 | GCACCGGGATCAGGAAAGAA | GCCTCACCTCGAAAGCCATA |
| PARP1 | poly(ADP-ribose) polymerase 1 | CCCCACGACTTTGGGATGAA | AGACTGTAGGCCACCTCGAT |
| ATM | ataxia telangiectasia mutated protein kinase | GCCGCGGTTGATACTACTTTG | GCAGCAGGGTGACAATAAACA |
| XPC | xeroderma pigmentosum group C-complementing protein | GCGAAGTGGAATTTGCCCAG | TTGGCCTTGGATTTCTGGCT |
| MSH2 | MutS homolog 2 | CAGGAGGTGAGGAGGTTTCG | CCGTGCGCCGTATAGAAGTC |
| SOD2 | superoxide dismutase 2 | CTTCAGGGTGGTATGGCTGT | TGGCCAGACCTTAATGTTCC |
| GPX1 | glutathione peroxidase 1 | TTGACATCGAGCCTGACATC | ACTGGGATCAACAGGACCAG |
| CAT | catalase | AGCTTAGCGTTCATCCGTGT | TCCAATCATCCGTCAAAACA |
| RNA18SN5 | 18S ribosomal N5 | GAAACTGCGAATGGCTCATTAAA | CACAGTTATCCAAGTGGGAGAGG |
| ACTB | beta-actin | AGAGCTACGAGCTGCCTGAC | AGCACTGTGTTGGCGTACAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pitucha, M.; Korga-Plewko, A.; Czylkowska, A.; Rogalewicz, B.; Drozd, M.; Iwan, M.; Kubik, J.; Humeniuk, E.; Adamczuk, G.; Karczmarzyk, Z.; et al. Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells. Int. J. Mol. Sci. 2021, 22, 3104. https://doi.org/10.3390/ijms22063104
Pitucha M, Korga-Plewko A, Czylkowska A, Rogalewicz B, Drozd M, Iwan M, Kubik J, Humeniuk E, Adamczuk G, Karczmarzyk Z, et al. Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells. International Journal of Molecular Sciences. 2021; 22(6):3104. https://doi.org/10.3390/ijms22063104
Chicago/Turabian StylePitucha, Monika, Agnieszka Korga-Plewko, Agnieszka Czylkowska, Bartłomiej Rogalewicz, Monika Drozd, Magdalena Iwan, Joanna Kubik, Ewelina Humeniuk, Grzegorz Adamczuk, Zbigniew Karczmarzyk, and et al. 2021. "Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells" International Journal of Molecular Sciences 22, no. 6: 3104. https://doi.org/10.3390/ijms22063104
APA StylePitucha, M., Korga-Plewko, A., Czylkowska, A., Rogalewicz, B., Drozd, M., Iwan, M., Kubik, J., Humeniuk, E., Adamczuk, G., Karczmarzyk, Z., Fornal, E., Wysocki, W., & Bartnik, P. (2021). Influence of Complexation of Thiosemicarbazone Derivatives with Cu (II) Ions on Their Antitumor Activity against Melanoma Cells. International Journal of Molecular Sciences, 22(6), 3104. https://doi.org/10.3390/ijms22063104











