Central Apolipoprotein A-IV Stimulates Thermogenesis in Brown Adipose Tissue
Abstract
1. Introduction
2. Results
2.1. Effect of Central ApoA-IV on BAT Thermogenesis
2.2. Innervation of BAT Is Required for Central ApoA-IV-Induced Thermogenesis
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Mouse Recombinant ApoA-IV Protein
4.3. Animal Surgery
4.4. Experimental Designs
4.5. Determination of UCP1, TH, and Calcitonin Gene Related (CGR) Proteins
4.6. Determination of BAT Gene Expression
4.7. Measurement of Plasma Parameters
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
Abbreviations
| HFD | High-fat diet |
| BAT | Brown adipose tissue |
| UCP1 | Uncoupling protein 1 |
| ApoA-IV | Apolipoprotein A-IV |
| POMC | Proopiomelanocortin |
| NE | Norepinephrine |
| NPY | Neuropeptide Y |
| ARC | Arcuate nucleus |
| KO | Knockout |
| TH | Tyrosine hydroxylase |
| CGRP | Calcitonin gene-related peptide |
| ICV | Intracerebroventricular |
| CPT1 | Carnitine palmitoyltransferase I |
| AMPK | Adenosine monophosphate-activated protein kinase |
| ATGL | Adipose triglyceride lipase |
| HSL | Hormone-sensitive lipase |
| TG | Triglyceride |
| NEFA | Non-esterified FA |
| ANOVA | Appropriate one-way analysis of variance |
| qPCR | Quantitative real-time PCR |
| EWAT | Epididymal white adipose tissue |
| IWAT | Inguinal white adipose tissue |
| BSA | Bovine serum albumin |
References
- Hales, C.M.; Carroll, M.D.; Fryar, C.D.; Ogden, C.L. Prevalence of Obesity Among Adults and Youth: United States, 2015–2016. NCHS Data Brief 2017, 10, 1–8. [Google Scholar]
- Health Risks of Being Overweight|NIDDK. Available online: https://www.niddk.nih.gov/health-information/weight-management/health-risks-overweight (accessed on 29 January 2018).
- Cypess, A.M.; Weiner, L.S.; Roberts-Toler, C.; Elía, E.F.; Kessler, S.H.; Kahn, P.A.; English, J.; Chatman, K.; Trauger, S.A.; Doria, A.; et al. Activation of Human Brown Adipose Tissue by a Β3-Adrenergic Receptor Agonist. Cell Metab. 2015, 21, 33–38. [Google Scholar] [CrossRef] [Scilit]
- Marlatt, K.L.; Ravussin, E. Brown Adipose Tissue: An Update on Recent Findings. Curr. Obes. Rep. 2017, 6, 389–396. [Google Scholar] [CrossRef] [Scilit]
- Trayhurn, P. Brown Adipose Tissue-A Therapeutic Target in Obesity? Front. Physiol. 2018, 9, 1672. [Google Scholar] [CrossRef] [Scilit]
- Blouet, C.; Schwartz, G.J. Brainstem Nutrient Sensing in the Nucleus of the Solitary Tract Inhibits Feeding. Cell Metab. 2012, 16, 579–587. [Google Scholar] [CrossRef] [Scilit]
- Vijgen, G.H.E.J.; Bouvy, N.D.; Leenen, L.; Rijkers, K.; Cornips, E.; Majoie, M.; Brans, B.; van Marken Lichtenbelt, W.D. Vagus Nerve Stimulation Increases Energy Expenditure: Relation to Brown Adipose Tissue Activity. PLoS ONE 2013, 8, e77221. [Google Scholar] [CrossRef] [Scilit]
- Yasuda, T.; Masaki, T.; Kakuma, T.; Yoshimatsu, H. Hypothalamic Melanocortin System Regulates Sympathetic Nerve Activity in Brown Adipose Tissue. Exp. Biol. Med. (Maywood) 2004, 229, 235–239. [Google Scholar] [CrossRef] [Scilit]
- Schwartz, M.W.; Woods, S.C.; Porte, D.; Seeley, R.J.; Baskin, D.G. Central Nervous System Control of Food Intake. Nature 2000, 404, 661–671. [Google Scholar] [CrossRef] [Scilit]
- Yan, C.; He, Y.; Xu, Y.; Shu, G.; Wang, C.; Yang, Y.; Saito, K.; Xu, P.; Hinton, A.O.; Yan, X.; et al. Apolipoprotein A-IV Inhibits AgRP/NPY Neurons and Activates POMC Neurons in the Arcuate Nucleus. Neuroendocrinology 2016, 103, 476–488. [Google Scholar] [CrossRef] [Scilit]
- Millington, G.W. The Role of Proopiomelanocortin (POMC) Neurones in Feeding Behaviour. Nutr. Metab. (Lond.) 2007, 4, 18. [Google Scholar] [CrossRef] [Scilit]
- Morrison, S.F.; Madden, C.J. Central Nervous System Regulation of Brown Adipose Tissue. In Comprehensive Physiology; American Cancer Society: Atlanta, GA, USA, 2014; pp. 1677–1713. ISBN 978-0-470-65071-4. [Google Scholar]
- Tupone, D.; Madden, C.J.; Morrison, S.F. Autonomic Regulation of Brown Adipose Tissue Thermogenesis in Health and Disease: Potential Clinical Applications for Altering BAT Thermogenesis. Front. Neurosci. 2014, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Bi, S. Hypothalamic Regulation of Brown Adipose Tissue Thermogenesis and Energy Homeostasis. Front. Endocrinol. (Lausanne) 2015, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langin, D. Adipose Tissue Lipolysis as a Metabolic Pathway to Define Pharmacological Strategies against Obesity and the Metabolic Syndrome. Pharmacol. Res. 2006, 53, 482–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rothwell, N.J.; Stock, M.J.; Warwick, B.P. Energy Balance and Brown Fat Activity in Rats Fed Cafeteria Diets or High-Fat, Semisynthetic Diets at Several Levels of Intake. Metab. Clin. Exp. 1985, 34, 474–480. [Google Scholar] [CrossRef] [Scilit]
- Levin, B.E.; Triscari, J.; Sullivan, A.C. Altered Sympathetic Activity during Development of Diet-Induced Obesity in Rat. Am. J. Physiol. 1983, 244, R347–R355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mickelsen, O.; Takahashi, S.; Craig, C. Experimental Obesity. I. Production of Obesity in Rats by Feeding High-Fat Diets. J. Nutr. 1955, 57, 541–554. [Google Scholar] [CrossRef] [Scilit]
- Vijgen, G.H.E.J.; Bouvy, N.D.; Teule, G.J.J.; Brans, B.; Schrauwen, P.; van Marken Lichtenbelt, W.D. Brown Adipose Tissue in Morbidly Obese Subjects. PLoS ONE 2011, 6, e17247. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Pearson, K.J.; Xiong, Y.; Lo, C.-M.; Tso, P.; Woods, S.C.; Davidson, W.S.; Liu, M. Characterization of Apolipoprotein A-IV in Brain Areas Involved in Energy Homeostasis. Physiol. Behav. 2008, 95, 161–167. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Doi, T.; Shen, L.; Woods, S.C.; Seeley, R.J.; Zheng, S.; Jackman, A.; Tso, P. Intestinal Satiety Protein Apolipoprotein AIV Is Synthesized and Regulated in Rat Hypothalamus. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2001, 280, R1382–R1387. [Google Scholar] [CrossRef] [Scilit]
- Liu, M. Obesity Induced by a High-Fat Diet Downregulates Apolipoprotein A-IV Gene Expression in Rat Hypothalamus. AJP Endocrinol. Metab. 2004, 287, E366–E370. [Google Scholar] [CrossRef] [Scilit]
- Fujimoto, K.; Fukagawa, K.; Sakata, T.; Tso, P. Suppression of Food Intake by Apolipoprotein A-IV Is Mediated through the Central Nervous System in Rats. J. Clin. Investig. 1993, 91, 1830–1833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalogeris, T.J.; Fukagawa, K.; Tso, P. Synthesis and Lymphatic Transport of Intestinal Apolipoprotein A-IV in Response to Graded Doses of Triglyceride. J. Lipid Res. 1994, 35, 1141–1151. [Google Scholar] [CrossRef] [Scilit]
- Ghiselli, G.; Krishnan, S.; Beigel, Y.; Gotto, A.M. Plasma Metabolism of Apolipoprotein A-IV in Humans. J. Lipid Res. 1986, 27, 813–827. [Google Scholar] [CrossRef] [Scilit]
- Ohta, T.; Fidge, N.H.; Nestel, P.J. Studies on the in Vivo and in Vitro Distribution of Apolipoprotein A-IV in Human Plasma and Lymph. J. Clin. Investig. 1985, 76, 1252–1260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldberg, I.J.; Scheraldi, C.A.; Yacoub, L.K.; Saxena, U.; Bisgaier, C.L. Lipoprotein ApoC-II Activation of Lipoprotein Lipase. Modulation by Apolipoprotein A-IV. J. Biol. Chem. 1990, 265, 4266–4272. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Q.; Weng, J.; Shen, M.; Fish, J.; Shen, Z.; Coschigano, K.T.; Davidson, W.S.; Tso, P.; Shi, H.; Lo, C.C. Apolipoprotein A-IV Enhances Fatty Acid Uptake by Adipose Tissues of Male Mice via Sympathetic Activation. Endocrinology 2020, 161. [Google Scholar] [CrossRef] [Scilit]
- Steinmetz, A.; Utermann, G. Activation of Lecithin: Cholesterol Acyltransferase by Human Apolipoprotein A-IV. J. Biol. Chem. 1985, 260, 2258–2264. [Google Scholar] [CrossRef] [Scilit]
- Cohen, R.D.; Castellani, L.W.; Qiao, J.-H.; Van Lenten, B.J.; Lusis, A.J.; Reue, K. Reduced Aortic Lesions and Elevated High Density Lipoprotein Levels in Transgenic Mice Overexpressing Mouse Apolipoprotein A-IV. J. Clin. Investig. 1997, 99, 1906. [Google Scholar] [CrossRef] [Scilit]
- Pence, S.; Zhu, Q.; Binne, E.; Liu, M.; Shi, H.; Lo, C.C. Reduced Diet-Induced Thermogenesis in Apolipoprotein A-IV Deficient Mice. Int. J. Mol. Sci. 2019, 20. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.B.; Zhou, G.; Li, C. AMPK: An Emerging Drug Target for Diabetes and the Metabolic Syndrome. Cell Metab. 2009, 9, 407–416. [Google Scholar] [CrossRef] [Scilit]
- Cantó, C.; Auwerx, J. AMP-Activated Protein Kinase and Its Downstream Transcriptional Pathways. Cell. Mol. Life Sci. 2010, 67, 3407–3423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calderon-Dominguez, M.; Sebastián, D.; Fucho, R.; Weber, M.; Mir, J.F.; García-Casarrubios, E.; Obregón, M.J.; Zorzano, A.; Valverde, Á.M.; Serra, D.; et al. Carnitine Palmitoyltransferase 1 Increases Lipolysis, UCP1 Protein Expression and Mitochondrial Activity in Brown Adipocytes. PLoS ONE 2016, 11, e0159399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouillaud, F.; Alves-Guerra, M.-C.; Ricquier, D. UCPs, at the Interface between Bioenergetics and Metabolism. Biochim. Biophys. Acta 2016, 1863, 2443–2456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zimmermann, R.; Strauss, J.G.; Haemmerle, G.; Schoiswohl, G.; Birner-Gruenberger, R.; Riederer, M.; Lass, A.; Neuberger, G.; Eisenhaber, F.; Hermetter, A.; et al. Fat Mobilization in Adipose Tissue Is Promoted by Adipose Triglyceride Lipase. Science 2004, 306, 1383–1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeaman, S.J. Hormone-Sensitive Lipase—New Roles for an Old Enzyme. Biochem. J. 2004, 379, 11–22. [Google Scholar] [CrossRef] [Scilit]
- Ryu, V.; Garretson, J.T.; Liu, Y.; Vaughan, C.H.; Bartness, T.J. Brown Adipose Tissue Has Sympathetic-Sensory Feedback Circuits. J. Neurosci. 2015, 35, 2181–2190. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Q.; Glazier, B.J.; Hinkel, B.C.; Cao, J.; Liu, L.; Liang, C.; Shi, H. Neuroendocrine Regulation of Energy Metabolism Involving Different Types of Adipose Tissues. Int. J. Mol. Sci. 2019, 20. [Google Scholar] [CrossRef] [Scilit]
- Molinoff, P.B.; Axelrod, J. Biochemistry of Catecholamines. Annu. Rev. Biochem. 1971, 40, 465–500. [Google Scholar] [CrossRef] [Scilit]
- Vaughan, C.H.; Zarebidaki, E.; Ehlen, J.C.; Bartness, T.J. Analysis and Measurement of the Sympathetic and Sensory Innervation of White and Brown Adipose Tissue. Methods Enzymol. 2014, 537, 199–225. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.; Spicer, E.G.; Gavini, C.K.; Goudjo-Ako, A.J.; Novak, C.M.; Shi, H. Enhanced Sympathetic Activity in Mice with Brown Adipose Tissue Transplantation (TransBATation). Physiol. Behav. 2014, 125, 21–29. [Google Scholar] [CrossRef] [Scilit]
- Cannon, B.; Nedergaard, J. Brown Adipose Tissue: Function and Physiological Significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nedergaard, J.; Cannon, B. The “Novel” “uncoupling” Proteins UCP2 and UCP3: What Do They Really Do? Pros and Cons for Suggested Functions. Exp. Physiol. 2003, 88, 65–84. [Google Scholar] [CrossRef] [Scilit]
- Mailloux, R.J.; Harper, M.-E. Uncoupling Proteins and the Control of Mitochondrial Reactive Oxygen Species Production. Free Radic. Biol. Med. 2011, 51, 1106–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toime, L.J.; Brand, M.D. Uncoupling Protein-3 Lowers Reactive Oxygen Species Production in Isolated Mitochondria. Free Radic. Biol. Med. 2010, 49, 606–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chouchani, E.T.; Kazak, L.; Spiegelman, B.M. New Advances in Adaptive Thermogenesis: UCP1 and Beyond. Cell Metab. 2019, 29, 27–37. [Google Scholar] [CrossRef] [Scilit]
- Vidal-Puig, A.; Solanes, G.; Grujic, D.; Flier, J.S.; Lowell, B.B. UCP3: An Uncoupling Protein Homologue Expressed Preferentially and Abundantly in Skeletal Muscle and Brown Adipose Tissue. Biochem. Biophys. Res. Commun. 1997, 235, 79–82. [Google Scholar] [CrossRef] [Scilit]
- Puigserver, P.; Herron, D.; Gianotti, M.; Palou, A.; Cannon, B.; Nedergaard, J. Induction and Degradation of the Uncoupling Protein Thermogenin in Brown Adipocytes in Vitro and in Vivo. Evidence for a Rapidly Degradable Pool. Biochem. J. 1992, 284 Pt 2, 393–398. [Google Scholar] [CrossRef] [Scilit]
- Hilse, K.E.; Kalinovich, A.V.; Rupprecht, A.; Smorodchenko, A.; Zeitz, U.; Staniek, K.; Erben, R.G.; Pohl, E.E. The Expression of UCP3 Directly Correlates to UCP1 Abundance in Brown Adipose Tissue. Biochim. Biophys. Acta 2016, 1857, 72–78. [Google Scholar] [CrossRef] [Scilit]
- Razzoli, M.; Emmett, M.J.; Lazar, M.A.; Bartolomucci, A. β-Adrenergic Receptors Control Brown Adipose UCP-1 Tone and Cold Response without Affecting Its Circadian Rhythmicity. FASEB J. 2018, 32, 5640–5646. [Google Scholar] [CrossRef] [Scilit]
- Gong, D.W.; He, Y.; Karas, M.; Reitman, M. Uncoupling Protein-3 Is a Mediator of Thermogenesis Regulated by Thyroid Hormone, Beta3-Adrenergic Agonists, and Leptin. J. Biol. Chem. 1997, 272, 24129–24132. [Google Scholar] [CrossRef] [Scilit]
- Koh, H.-J.; Hirshman, M.F.; He, H.; Li, Y.; Manabe, Y.; Balschi, J.A.; Goodyear, L.J. Adrenaline Is a Critical Mediator of Acute Exercise-Induced AMP-Activated Protein Kinase Activation in Adipocytes. Biochem. J. 2007, 403, 473–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moule, S.K.; Denton, R.M. The Activation of P38 MAPK by the Beta-Adrenergic Agonist Isoproterenol in Rat Epididymal Fat Cells. FEBS Lett. 1998, 439, 287–290. [Google Scholar] [CrossRef] [Scilit]
- Ruderman, N.B.; Saha, A.K. Metabolic Syndrome: Adenosine Monophosphate-Activated Protein Kinase and Malonyl Coenzyme A. Obesity (Silver Spring) 2006, 14 (Suppl. 1), 25S–33S. [Google Scholar] [CrossRef] [Scilit]
- Pulinilkunnil, T.; He, H.; Kong, D.; Asakura, K.; Peroni, O.D.; Lee, A.; Kahn, B.B. Adrenergic Regulation of AMP-Activated Protein Kinase in Brown Adipose Tissue in Vivo. J. Biol. Chem. 2011, 286, 8798–8809. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.-J.; Tang, T.; Abbott, M.; Viscarra, J.A.; Wang, Y.; Sul, H.S. AMPK Phosphorylates Desnutrin/ATGL and Hormone-Sensitive Lipase To Regulate Lipolysis and Fatty Acid Oxidation within Adipose Tissue. Mol. Cell. Biol. 2016, 36, 1961–1976. [Google Scholar] [CrossRef] [Scilit]
- Holm, C.; Osterlund, T. Hormone-Sensitive Lipase and Neutral Cholesteryl Ester Lipase. Methods Mol. Biol. 1999, 109, 109–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kraemer, F.B.; Shen, W.-J. Hormone-Sensitive Lipase: Control of Intracellular Tri-(Di-)Acylglycerol and Cholesteryl Ester Hydrolysis. J. Lipid Res. 2002, 43, 1585–1594. [Google Scholar] [CrossRef] [Scilit]
- McGarry, J.D.; Woeltje, K.F.; Kuwajima, M.; Foster, D.W. Regulation of Ketogenesis and the Renaissance of Carnitine Palmitoyltransferase. Diabetes Metab. Rev. 1989, 5, 271–284. [Google Scholar] [CrossRef] [Scilit]
- Hardie, D.G.; Carling, D. The AMP-Activated Protein Kinase--Fuel Gauge of the Mammalian Cell? Eur. J. Biochem. 1997, 246, 259–273. [Google Scholar] [CrossRef] [Scilit]
- Yu, X.X.; Lewin, D.A.; Forrest, W.; Adams, S.H. Cold Elicits the Simultaneous Induction of Fatty Acid Synthesis and Beta-Oxidation in Murine Brown Adipose Tissue: Prediction from Differential Gene Expression and Confirmation in Vivo. FASEB J. 2002, 16, 155–168. [Google Scholar] [CrossRef] [Scilit]
- Mottillo, E.P.; Balasubramanian, P.; Lee, Y.-H.; Weng, C.; Kershaw, E.E.; Granneman, J.G. Coupling of Lipolysis and de Novo Lipogenesis in Brown, Beige, and White Adipose Tissues during Chronic Β3-Adrenergic Receptor Activation. J. Lipid Res. 2014, 55, 2276–2286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blondin, D.P.; Labbé, S.M.; Tingelstad, H.C.; Noll, C.; Kunach, M.; Phoenix, S.; Guérin, B.; Turcotte, É.E.; Carpentier, A.C.; Richard, D.; et al. Increased Brown Adipose Tissue Oxidative Capacity in Cold-Acclimated Humans. J. Clin. Endocrinol. Metab. 2014, 99, E438–E446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Din, M.U.; Raiko, J.; Saari, T.; Kudomi, N.; Tolvanen, T.; Oikonen, V.; Teuho, J.; Sipilä, H.T.; Savisto, N.; Parkkola, R.; et al. Human Brown Adipose Tissue [(15)O]O2 PET Imaging in the Presence and Absence of Cold Stimulus. Eur. J. Nucl. Med. Mol. Imaging 2016, 43, 1878–1886. [Google Scholar] [CrossRef] [Scilit]
- Blondin, D.P.; Nielsen, S.; Kuipers, E.N.; Severinsen, M.C.; Jensen, V.H.; Miard, S.; Jespersen, N.Z.; Kooijman, S.; Boon, M.R.; Fortin, M.; et al. Human Brown Adipocyte Thermogenesis Is Driven by Β2-AR Stimulation. Cell Metab. 2020, 32, 287–300.e7. [Google Scholar] [CrossRef] [Scilit]
- Virtanen, K.A.; Lidell, M.E.; Orava, J.; Heglind, M.; Westergren, R.; Niemi, T.; Taittonen, M.; Laine, J.; Savisto, N.-J.; Enerbäck, S.; et al. Functional Brown Adipose Tissue in Healthy Adults. N. Engl. J. Med. 2009, 360, 1518–1525. [Google Scholar] [CrossRef] [Scilit]
- Blondin, D.P.; Tingelstad, H.C.; Noll, C.; Frisch, F.; Phoenix, S.; Guérin, B.; Turcotte, É.E.; Richard, D.; Haman, F.; Carpentier, A.C. Dietary Fatty Acid Metabolism of Brown Adipose Tissue in Cold-Acclimated Men. Nat. Commun. 2017, 8, 14146. [Google Scholar] [CrossRef] [Scilit]
- Jia, R.; Luo, X.-Q.; Wang, G.; Lin, C.-X.; Qiao, H.; Wang, N.; Yao, T.; Barclay, J.L.; Whitehead, J.P.; Luo, X.; et al. Characterization of Cold-Induced Remodelling Reveals Depot-Specific Differences across and within Brown and White Adipose Tissues in Mice. Acta Physiol. (Oxf.) 2016, 217, 311–324. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.; Song, C.K.; Giordano, A.; Cinti, S.; Bartness, T.J. Sensory or Sympathetic White Adipose Tissue Denervation Differentially Affects Depot Growth and Cellularity. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2005, 288, R1028–R1037. [Google Scholar] [CrossRef] [Scilit]
- Bartness, T.; Vaughan, C.; Song, C. Sympathetic and Sensory Innervation of Brown Adipose Tissue. Int. J. Obes. (Lond.) 2010, 34, S36–S42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geerling, J.J.; Boon, M.R.; Kooijman, S.; Parlevliet, E.T.; Havekes, L.M.; Romijn, J.A.; Meurs, I.M.; Rensen, P.C.N. Sympathetic Nervous System Control of Triglyceride Metabolism: Novel Concepts Derived from Recent Studies. J. Lipid Res. 2014, 55, 180–189. [Google Scholar] [CrossRef] [Scilit]
- Carneheim, C.; Nedergaard, J.; Cannon, B. Beta-Adrenergic Stimulation of Lipoprotein Lipase in Rat Brown Adipose Tissue during Acclimation to Cold. Am. J. Physiol. 1984, 246, E327–E333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, M.; Maiorano, N.; Shen, L.; Pearson, K.; Tajima, D.; Zhang, D.M.; Woods, S.C.; Seeley, R.J.; Davidson, W.S.; Tso, P. Expression of Biologically Active Rat Apolipoprotein AIV in Escherichia Coli. Physiol. Behav. 2003, 78, 149–155. [Google Scholar] [CrossRef] [Scilit]
- Contreras, C.; Nogueiras, R.; Diéguez, C.; Medina-Gómez, G.; López, M. Hypothalamus and Thermogenesis: Heating the BAT, Browning the WAT. Mol. Cell. Endocrinol. 2016, 438, 107–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Pearson, K.J.; Davidson, W.S.; Tso, P. Specific Sequences in N Termini of Apolipoprotein A-IV Modulate Its Anorectic Effect. Physiol. Behav. 2013, 120, 136–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Granneman, J.G.; Burnazi, M.; Zhu, Z.; Schwamb, L.A. White Adipose Tissue Contributes to UCP1-Independent Thermogenesis. Am. J. Physiol. Endocrinol. Metab. 2003, 285, E1230–E1236. [Google Scholar] [CrossRef] [Scilit]
- Bartness, T.J.; Liu, Y.; Shrestha, Y.B.; Ryu, V. Neural Innervation of White Adipose Tissue and the Control of Lipolysis. Front. Neuroendocrinol. 2014, 35, 473–493. [Google Scholar] [CrossRef] [Scilit]
- Yoshimichi, G.; Lo, C.C.; Tamashiro, K.L.K.; Ma, L.; Lee, D.M.; Begg, D.P.; Liu, M.; Sakai, R.R.; Woods, S.C.; Yoshimatsu, H.; et al. Effect of Peripheral Administration of Cholecystokinin on Food Intake in Apolipoprotein AIV Knockout Mice. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G1336–G1342. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.-Y.; Orci, L.; Ravazzola, M.; Unger, R.H. Fat Storage in Adipocytes Requires Inactivation of Leptin’s Paracrine Activity: Implications for Treatment of Human Obesity. Proc. Natl. Acad. Sci. USA 2005, 102, 18011–18016. [Google Scholar] [CrossRef] [Scilit]






| Treatments | CSF | ApoA-IV |
|---|---|---|
| BW (g) | 26.4 ± 0.6 | 24.8 ± 0.6 |
| BAT (g) | 0.26 ± 0.17 | 0.15 ± 0.06 |
| EWAT (g) | 0.23 ± 0.04 | 0.29 ± 0.01 |
| IWAT (g) | 0.15 ± 0.04 | 0.15 ± 0.05 |
| Insulin (ng/mL) | 0.26 ± 0.02 | 0.28 ± 0.05 |
| Leptin (ng/mL) | 0.45 ± 0.08 | 0.62 ± 0.08 |
| Triglyceride (ng/mL) | 53.7 ± 10.20 | 51.03 ± 4.26 |
| Cholesterol (ng/mL) | 76.97 ± 8.80 | 80.22 ± 7.85 |
| Treatments | CSF | ApoA-IV |
|---|---|---|
| BW (g) prior to denervation | 25.6 ± 1.0 | 26.9 ± 0.9 |
| BW (g) after denervation | 26.3 ± 0.3 | 27.4 ± 1.0 |
| BAT (g) | 0.07 ± 0.07 | 0.08 ± 0.01 |
| EWAT (g) | 0.13 ± 0.01 | 0.17 ± 0.01 |
| IWAT (g) | 0.16 ± 0.06 | 0.10 ± 0.01 |
| Insulin (ng/mL) | 0.24 ± 0.02 | 0.24 ± 0.03 |
| Leptin (ng/mL) | 0.59 ± 0.20 | 0.55 ± 0.14 |
| Triglyceride (ng/mL) | 46.00 ± 8.00 | 38.50 ± 6.70 |
| Cholesterol (ng/mL) | 71.00 ± 7.60 | 61.60 ± 12.10 |
| NEFA (mmol/L) | 0.46 ± 0.06 | 0.48 ± 0.05 |
| Primers | Forward 5′→3′ | Reverse 5′→3′ |
|---|---|---|
| Ucp1 | ACTGGAGGTGTGGCAGTGTTC | ACGACCTCTGTAGGCTGCCCAA |
| Ucp3 | GAGCGGACCACTCCAGCGTC | TGAGACTCCAGCAACTTCTC |
| Cpt1 | ACCACTGGCCGAATGTCAAG | AGCGAGTAGCGCATGGTCAT |
| Ampkα1 | CAGTAGGTACACACAGCGTAACACA | ACCTGTTACAGCAAATTCAAATGG |
| Ampkα2 | TCCAGCACAGCTGAGAACCA | GGGATGCCGAGGACAAAGT |
| Atgl | GGTACCGTTCCCGAGGGAGACCAAGTGGA | CCTCGAGCGCAAGGCGGGAGGCCAGGT |
| Hsl | GCTTGGTTCAACTGGAGAGC | GGTAGAAGAGGGTCCATGAGG |
| 36B4 | ATCCCTGACGCACCGCCGTG | GCGCATCATGGTGTTCTTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pence, S.; LaRussa, Z.; Shen, Z.; Liu, M.; Coschigano, K.T.; Shi, H.; Lo, C.C. Central Apolipoprotein A-IV Stimulates Thermogenesis in Brown Adipose Tissue. Int. J. Mol. Sci. 2021, 22, 1221. https://doi.org/10.3390/ijms22031221
Pence S, LaRussa Z, Shen Z, Liu M, Coschigano KT, Shi H, Lo CC. Central Apolipoprotein A-IV Stimulates Thermogenesis in Brown Adipose Tissue. International Journal of Molecular Sciences. 2021; 22(3):1221. https://doi.org/10.3390/ijms22031221
Chicago/Turabian StylePence, Sydney, Zachary LaRussa, Zhijun Shen, Min Liu, Karen T. Coschigano, Haifei Shi, and Chunmin C. Lo. 2021. "Central Apolipoprotein A-IV Stimulates Thermogenesis in Brown Adipose Tissue" International Journal of Molecular Sciences 22, no. 3: 1221. https://doi.org/10.3390/ijms22031221
APA StylePence, S., LaRussa, Z., Shen, Z., Liu, M., Coschigano, K. T., Shi, H., & Lo, C. C. (2021). Central Apolipoprotein A-IV Stimulates Thermogenesis in Brown Adipose Tissue. International Journal of Molecular Sciences, 22(3), 1221. https://doi.org/10.3390/ijms22031221

