Fibroblast Differentiation and Matrix Remodeling Impaired under Simulated Microgravity in 3D Cell Culture Model
Abstract
:1. Introduction
2. Results and Discussion
2.1. SµG Impaired Fibroblast Differentiation
2.2. Nucleus Translocation of Smad2/3 Was Reduced in sµG Conditions
2.3. ECM Remodelling and Production Are Reduced in sµG Conditions
2.4. RNA-Seq Revealed Minimal Change in Transcriptomic of Fibroblast under 1g and sµG Conditions
3. Conclusions
4. Materials and Methods
4.1. Reconstruction of 3D Collagen Matrices
4.2. Cell Culture of Fibroblasts and Myofibroblast Differentiation
4.3. Setting up of Random Positioning Machine
4.4. Cell Staining and Qualitative Image Analysis
4.5. Quantitative Analysis of Matrix Remodeling
4.6. RNA Isolation and Gene Expression Analysis
4.7. RNA Sequencing and Analysis
4.8. Data and Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- ElGindi, M.; Sapudom, J.; Ibrahim, I.H.; Al-Sayegh, M.; Chen, W.; Garcia-Sabaté, A.; Teo, J.C.M. May the Force Be with You (Or Not): The Immune System under Microgravity. Cells 2021, 10, 1941. [Google Scholar] [CrossRef] [PubMed]
- Roy-O’Reilly, M.; Mulavara, A.; Williams, T. A review of alterations to the brain during spaceflight and the potential relevance to crew in long-duration space exploration. NPJ Microgravity 2021, 7, 5. [Google Scholar] [CrossRef]
- Stavnichuk, M.; Mikolajewicz, N.; Corlett, T.; Morris, M.; Komarova, S.V. A systematic review and meta-analysis of bone loss in space travelers. NPJ Microgravity 2020, 6, 13. [Google Scholar] [CrossRef]
- Radek, K.A.; Baer, L.A.; Eckhardt, J.; DiPietro, L.A.; Wade, C.E. Mechanical unloading impairs keratinocyte migration and angiogenesis during cutaneous wound healing. J. Appl. Physiol. 2008, 104, 1295–1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monici, M.; Cialdai, F.; Romano, G.; Fusi, F.; Egli, M.; Pezzatini, S.; Morbidelli, L. An in Vitro Study on Tissue Repair: Impact of Unloading on Cells Involved in the Remodelling Phase. Microgravity Sci. Technol. 2011, 23, 391–401. [Google Scholar] [CrossRef]
- Crucian, B.; Babiak-Vazquez, A.; Johnston, S.; Pierson, D.; Ott, C.M.; Sams, C. Incidence of clinical symptoms during long-duration orbital spaceflight. Int. J. Gen. Med. 2016, 9, 383–391. [Google Scholar] [CrossRef] [Green Version]
- Choi, D.H.; Jeon, B.; Lim, M.H.; Lee, D.H.; Ye, S.-K.; Jeong, S.-Y.; Kim, S. 3D cell culture using a clinostat reproduces microgravity-induced skin changes. NPJ Microgravity 2021, 7, 20. [Google Scholar] [CrossRef] [PubMed]
- Riwaldt, S.; Corydon, T.J.; Pantalone, D.; Sahana, J.; Wise, P.; Wehland, M.; Krüger, M.; Melnik, D.; Kopp, S.; Infanger, M.; et al. Role of Apoptosis in Wound Healing and Apoptosis Alterations in Microgravity. Front. Bioeng. Biotechnol. 2021, 9, 498. [Google Scholar] [CrossRef] [PubMed]
- Prasad, B.; Grimm, D.; Strauch, S.M.; Erzinger, G.S.; Corydon, T.J.; Lebert, M.; Magnusson, N.E.; Infanger, M.; Richter, P.; Krüger, M. Influence of microgravity on apoptosis in cells, tissues, and other systems in vivo and in vitro. Int. J. Mol. Sci. 2020, 21, 1–32. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, M.; Kosaric, N.; Bonham, C.A.; Gurtner, G.C. Wound Healing: A Cellular Perspective. Physiol. Rev. 2019, 99, 665–706. [Google Scholar] [CrossRef]
- Avishai, E.; Yeghiazaryan, K.; Golubnitschaja, O. Impaired wound healing: Facts and hypotheses for multi-professional considerations in predictive, preventive and personalised medicine. EPMA J. 2017, 8, 23–33. [Google Scholar] [CrossRef] [Green Version]
- Desmouliere, A.; Darby, I.A.; Laverdet, B.; Bonté, F. Fibroblasts and myofibroblasts in wound healing. Clin. Cosmet. Investig. Dermatol. 2014, 7, 301. [Google Scholar] [CrossRef] [Green Version]
- desJardins-Park, H.E.; Foster, D.S.; Longaker, M.T. Fibroblasts and wound healing: An update. Regen. Med. 2018, 13, 491–495. [Google Scholar] [CrossRef] [Green Version]
- Pakyari, M.; Farrokhi, A.; Maharlooei, M.K.; Ghahary, A. Critical Role of Transforming Growth Factor Beta in Different Phases of Wound Healing. Adv. Wound Care 2013, 2, 215–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tai, Y.; Woods, E.L.; Dally, J.; Kong, D.; Steadman, R.; Moseley, R.; Midgley, A.C. Myofibroblasts: Function, Formation, and Scope of Molecular Therapies for Skin Fibrosis. Biomolecules 2021, 11, 1095. [Google Scholar] [CrossRef]
- Khanam, A.; Saleeb, P.G.; Kottilil, S. Pathophysiology and Treatment Options for Hepatic Fibrosis: Can It Be Completely Cured? Cells 2021, 10, 1097. [Google Scholar] [CrossRef] [PubMed]
- Ansorge, M.; Sapudom, J.; Chkolnikov, M.; Wilde, M.; Anderegg, U.; Möller, S.; Schnabelrauch, M.; Pompe, T. Mimicking Paracrine TGFβ1 Signals during Myofibroblast Differentiation in 3D Collagen Networks. Sci. Rep. 2017, 7, 5664. [Google Scholar] [CrossRef] [PubMed]
- Shinde, A.V.; Humeres, C.; Frangogiannis, N.G. The role of α-smooth muscle actin in fibroblast-mediated matrix contraction and remodeling. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 298–309. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Rubner, S.; Martin, S.; Thoenes, S.; Anderegg, U.; Pompe, T. The interplay of fibronectin functionalization and TGF-β1 presence on fibroblast proliferation, differentiation and migration in 3D matrices. Biomater. Sci. 2015, 3, 1291–1301. [Google Scholar] [CrossRef] [Green Version]
- Klingberg, F.; Hinz, B.; White, E.S. The myofibroblast matrix: Implications for tissue repair and fibrosis. J. Pathol. 2013, 229, 298–309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sapudom, J.; Müller, C.D.; Nguyen, K.-T.; Martin, S.; Anderegg, U.; Pompe, T. Matrix Remodeling and Hyaluronan Production by Myofibroblasts and Cancer-Associated Fibroblasts in 3D Collagen Matrices. Gels 2020, 6, 33. [Google Scholar] [CrossRef] [PubMed]
- Seitzer, U.; Bodo, M.; Müller, P.K.; Açil, Y.; Bätge, B. Microgravity and hypergravity effects on collagen biosynthesis of human dermal fibroblasts. Cell Tissue Res. 1995, 282, 513–517. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wang, E. Transcriptional Analysis of Normal Human Fibroblast Responses to Microgravity Stress. Genomics. Proteom. Bioinform. 2008, 6, 29–41. [Google Scholar] [CrossRef] [Green Version]
- Mavrogonatou, E.; Pratsinis, H.; Papadopoulou, A.; Karamanos, N.K.; Kletsas, D. Extracellular matrix alterations in senescent cells and their significance in tissue homeostasis. Matrix Biol. 2019, 75–76, 27–42. [Google Scholar] [CrossRef]
- Klaus, D.M. Clinostats and bioreactors. Gravit. Space Biol. Bull. 2001, 14, 55–64. [Google Scholar] [PubMed]
- Schwarz, R.P.; Goodwin, T.J.; Wolf, D.A. Cell culture for three-dimensional modeling in rotating-wall vessels: An application of simulated microgravity. J. Tissue Cult. Methods 1992, 14, 51–57. [Google Scholar] [CrossRef]
- van Loon, J.J.W.A. Some history and use of the random positioning machine, RPM, in gravity related research. Adv. Sp. Res. 2007, 39, 1161–1165. [Google Scholar] [CrossRef]
- Herranz, R.; Anken, R.; Boonstra, J.; Braun, M.; Christianen, P.C.M.; de Geest, M.; Hauslage, J.; Hilbig, R.; Hill, R.J.A.; Lebert, M.; et al. Ground-Based Facilities for Simulation of Microgravity: Organism-Specific Recommendations for Their Use, and Recommended Terminology. Astrobiology 2013, 13, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Buken, C.; Sahana, J.; Corydon, T.J.; Melnik, D.; Bauer, J.; Wehland, M.; Krüger, M.; Balk, S.; Abuagela, N.; Infanger, M.; et al. Morphological and Molecular Changes in Juvenile Normal Human Fibroblasts Exposed to Simulated Microgravity. Sci. Rep. 2019, 9, 11882. [Google Scholar] [CrossRef] [PubMed]
- Cialdai, F.; Vignali, L.; Morbidelli, L.; Colciago, A.; Celotti, F.; Santi, A.; Caselli, A.; Cirri, P.; Monici, M. Modeled Microgravity Affects Fibroblast Functions Related to Wound Healing. Microgravity Sci. Technol. 2017, 29, 121–132. [Google Scholar] [CrossRef]
- Loesberg, W.A.; Walboomers, X.F.; Bronkhorst, E.M.; van Loon, J.J.W.A.; Jansen, J.A. The effect of combined simulated microgravity and microgrooved surface topography on fibroblasts. Cell Motil. Cytoskelet. 2007, 64, 174–185. [Google Scholar] [CrossRef]
- Arase, Y. Effects of 3-D Clino-Rotation on Gene Expression in Human Fibroblast Cells. Cell Biol. Int. 2002, 26, 225–233. [Google Scholar] [CrossRef] [PubMed]
- Ikeda, H.; Muratani, M.; Hidema, J.; Hada, M.; Fujiwara, K.; Souda, H.; Yoshida, Y.; Takahashi, A. Expression Profile of Cell Cycle-Related Genes in Human Fibroblasts Exposed Simultaneously to Radiation and Simulated Microgravity. Int. J. Mol. Sci. 2019, 20, 4791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beck, M.; Tabury, K.; Moreels, M.; Jacquet, P.; Van Oostveldt, P.; De Vos, W.H.; Baatout, S. Simulated microgravity decreases apoptosis in fetal fibroblasts. Int. J. Mol. Med. 2012, 30, 309–313. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Pompe, T. Biomimetic tumor microenvironments based on collagen matrices. Biomater. Sci. 2018, 6, 2009–2024. [Google Scholar] [CrossRef] [PubMed]
- Wolf, K.; Alexander, S.; Schacht, V.; Coussens, L.M.; von Andrian, U.H.; van Rheenen, J.; Deryugina, E.; Friedl, P. Collagen-based cell migration models in vitro and in vivo. Semin. Cell Dev. Biol. 2009, 20, 931–941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- ElGindi, M.; Ibrahim, I.H.; Sapudom, J.; Garcia-Sabate, A.; Teo, J.C.M. Engineered Microvessel for Cell Culture in Simulated Microgravity. Int. J. Mol. Sci. 2021, 22, 6331. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Wu, X.; Chkolnikov, M.; Ansorge, M.; Anderegg, U.; Pompe, T. Fibroblast fate regulation by time dependent TGF-β1 and IL-10 stimulation in biomimetic 3D matrices. Biomater. Sci. 2017, 5, 1858–1867. [Google Scholar] [CrossRef]
- Horigome, T.; Takumi, S.; Shirai, K.; Kido, T.; Hagiwara-Chatani, N.; Nakashima, A.; Adachi, N.; Yano, H.; Hirai, Y. Sulfated glycosaminoglycans and non-classically secreted proteins, basic FGF and epimorphin, coordinately regulate TGF-β-induced cell behaviors of human scar dermal fibroblasts. J. Dermatol. Sci. 2017, 86, 132–141. [Google Scholar] [CrossRef] [Green Version]
- Evans, R.A.; Tian, Y.C.; Steadman, R.; Phillips, A.O. TGF-β1-mediated fibroblast–myofibroblast terminal differentiation—the role of smad proteins. Exp. Cell Res. 2003, 282, 90–100. [Google Scholar] [CrossRef]
- Seo, B.R.; Chen, X.; Ling, L.; Song, Y.H.; Shimpi, A.A.; Choi, S.; Gonzalez, J.; Sapudom, J.; Wang, K.; Andresen Eguiluz, R.C.; et al. Collagen microarchitecture mechanically controls myofibroblast differentiation. Proc. Natl. Acad. Sci. USA 2020, 117, 11387–11398. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Mohamed, W.K.E.; Garcia-Sabaté, A.; Alatoom, A.; Karaman, S.; Mahtani, N.; Teo, J.C.M. Collagen Fibril Density Modulates Macrophage Activation and Cellular Functions during Tissue Repair. Bioengineering 2020, 7, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Lu, T.; Wong, M.; Wang, X.; Stodieck, L.; Karouia, F.; Story, M.; Wu, H. Transient gene and microRNA expression profile changes of confluent human fibroblast cells in spaceflight. FASEB J. 2016, 30, 2211–2224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mi, H.; Thomas, P. Panther Pathway: An Ontology-Based Pathway Database Coupled with Data Analysis Tools. In Protein Networks and Pathway Analysis; Humana Press: Totowa, NJ, USA, 2009; pp. 123–140. [Google Scholar]
- Shook, B.A.; Wasko, R.R.; Rivera-Gonzalez, G.C.; Salazar-Gatzimas, E.; López-Giráldez, F.; Dash, B.C.; Muñoz-Rojas, A.R.; Aultman, K.D.; Zwick, R.K.; Lei, V.; et al. Myofibroblast proliferation and heterogeneity are supported by macrophages during skin repair. Science 2018, 362, eaar2971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horowitz, J.C.; Rogers, D.S.; Simon, R.H.; Sisson, T.H.; Thannickal, V.J. Plasminogen Activation–Induced Pericellular Fibronectin Proteolysis Promotes Fibroblast Apoptosis. Am. J. Respir. Cell Mol. Biol. 2008, 38, 78–87. [Google Scholar] [CrossRef]
- Song, K.; Cornelius, S.C.; Reiss, M.; Danielpour, D. Insulin-like Growth Factor-I Inhibits Transcriptional Responses of Transforming Growth Factor-β by Phosphatidylinositol 3-Kinase/Akt-dependent Suppression of the Activation of Smad3 but Not Smad2. J. Biol. Chem. 2003, 278, 38342–38351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, X.; Xiong, X.; Chen, Y.-G. Feedback regulation of TGF-β signaling. Acta Biochim. Biophys. Sin. 2018, 50, 37–50. [Google Scholar] [CrossRef] [Green Version]
- Boon, R.A.; Fledderus, J.O.; Volger, O.L.; van Wanrooij, E.J.A.; Pardali, E.; Weesie, F.; Kuiper, J.; Pannekoek, H.; ten Dijke, P.; Horrevoets, A.J.G. KLF2 Suppresses TGF-β Signaling in Endothelium Through Induction of Smad7 and Inhibition of AP-1. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 532–539. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Tu, S.; Zeng, Y.; Zhang, C.; Deng, T.; Luo, W.; Lian, L.; Chen, L.; Xiong, X.; Yan, X. KLF2 inhibits TGF-β-mediated cancer cell motility in hepatocellular carcinoma. Acta Biochim. Biophys. Sin 2020, 52, 485–494. [Google Scholar] [CrossRef] [PubMed]
- Zeng, X.; Huang, C.; Senavirathna, L.; Wang, P.; Liu, L. miR-27b inhibits fibroblast activation via targeting TGFβ signaling pathway. BMC Cell Biol. 2017, 18, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yagi-Utsumi, M.; Yanaka, S.; Song, C.; Satoh, T.; Yamazaki, C.; Kasahara, H.; Shimazu, T.; Murata, K.; Kato, K. Characterization of amyloid β fibril formation under microgravity conditions. NPJ Microgravity 2020, 6, 17. [Google Scholar] [CrossRef]
- Matsushita, H.; Isoguchi, A.; Okada, M.; Masuda, T.; Misumi, Y.; Ichiki, Y.; Ueda, M.; Ando, Y. Amyloid fibril formation is suppressed in microgravity. Biochem. Biophys. Rep. 2021, 25, 100875. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Rubner, S.; Martin, S.; Kurth, T.; Riedel, S.; Mierke, C.T.; Pompe, T. The phenotype of cancer cell invasion controlled by fibril diameter and pore size of 3D collagen networks. Biomaterials 2015, 52, 367–375. [Google Scholar] [CrossRef] [Green Version]
- Franke, K.; Sapudom, J.; Kalbitzer, L.; Anderegg, U.; Pompe, T. Topologically defined composites of collagen types I and V as in vitro cell culture scaffolds. Acta Biomater. 2014, 10, 2693–2702. [Google Scholar] [CrossRef] [PubMed]
- Sapudom, J.; Waschke, J.; Franke, K.; Hlawitschka, M.; Pompe, T. Quantitative label-free single cell tracking in 3D biomimetic matrices. Sci. Rep. 2017, 7, 14135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sapudom, J.; Nguyen, K.-T.; Martin, S.; Wippold, T.; Möller, S.; Schnabelrauch, M.; Anderegg, U.; Pompe, T. Biomimetic tissue models reveal the role of hyaluronan in melanoma proliferation and invasion. Biomater. Sci. 2020, 8, 1405–1417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data, 2010.
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- García-Alcalde, F.; Okonechnikov, K.; Carbonell, J.; Cruz, L.M.; Götz, S.; Tarazona, S.; Dopazo, J.; Meyer, T.F.; Conesa, A. Qualimap: Evaluating next-generation sequencing alignment data. Bioinformatics 2012, 28, 2678–2679. [Google Scholar] [CrossRef]
- Yousif, A.; Drou, N.; Rowe, J.; Khalfan, M.; Gunsalus, K.C. NASQAR: A web-based platform for high-throughput sequencing data analysis and visualization. BMC Bioinform. 2020, 21, 267. [Google Scholar] [CrossRef] [PubMed]
- Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
Genes | Forward Primer Sequence (5′ → 3′) | Reverse Primer Sequence (5′ → 3′) | Accession Number |
---|---|---|---|
RPS26 | CAATGGTCGTGCCAAAAAG | TTCACATACAGCTTGGGAAGC | NM_001029 |
αSMA (ACTA2) | AGACCCTGTTCCAGCCATC | TGCTAGGGCCGTGATCTC | NM_001141945.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sapudom, J.; ElGindi, M.; Arnoux, M.; Drou, N.; Garcia-Sabaté, A.; Teo, J.C.M. Fibroblast Differentiation and Matrix Remodeling Impaired under Simulated Microgravity in 3D Cell Culture Model. Int. J. Mol. Sci. 2021, 22, 11911. https://doi.org/10.3390/ijms222111911
Sapudom J, ElGindi M, Arnoux M, Drou N, Garcia-Sabaté A, Teo JCM. Fibroblast Differentiation and Matrix Remodeling Impaired under Simulated Microgravity in 3D Cell Culture Model. International Journal of Molecular Sciences. 2021; 22(21):11911. https://doi.org/10.3390/ijms222111911
Chicago/Turabian StyleSapudom, Jiranuwat, Mei ElGindi, Marc Arnoux, Nizar Drou, Anna Garcia-Sabaté, and Jeremy C. M. Teo. 2021. "Fibroblast Differentiation and Matrix Remodeling Impaired under Simulated Microgravity in 3D Cell Culture Model" International Journal of Molecular Sciences 22, no. 21: 11911. https://doi.org/10.3390/ijms222111911
APA StyleSapudom, J., ElGindi, M., Arnoux, M., Drou, N., Garcia-Sabaté, A., & Teo, J. C. M. (2021). Fibroblast Differentiation and Matrix Remodeling Impaired under Simulated Microgravity in 3D Cell Culture Model. International Journal of Molecular Sciences, 22(21), 11911. https://doi.org/10.3390/ijms222111911