Possible Roles of Calreticulin in Uterine Decidualization and Receptivity in Rats and Humans
Abstract
:1. Introduction
2. Results
2.1. CALR Is Spatiotemporally Expressed in the Peri-Implantation Uterus in Rats
2.2. CALR Expression in an Artificial Implantation and Decidualization Rat Model
2.3. Knocking down CALR Reduces the Expression of Decidual Markers in Cultured Rat Stromal Cells
2.4. The Effect of Endometrial Polypectomy on Implantation-Related Factors in Infertile Patients
3. Discussion
4. Materials and Methods
4.1. Chemicals and Antibodies
4.2. Rat Implantation Model
4.3. Immunohistochemistry
4.4. Immunoblotting
4.5. Preparation of Rat ESCs and Treatment with siRNAs
4.6. Preparation of Endometrial Samples from Infertile Patients and Ovarian Steroid Assay
4.7. RNA Isolation and Quantitative Real-Time RT-PCR
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Gellersen, B.; Brosens, J.J. Cyclic Decidualization of the Human Endometrium in Reproductive Health and Failure. Endocr. Rev. 2014, 35, 851–905. [Google Scholar] [CrossRef]
- Ochoa-Bernal, M.A.; Fazleabas, A.T. Physiologic events of embryo implantation and decidualization in human and non-human primates. Int. J. Mol. Sci. 2020, 21, 1973. [Google Scholar] [CrossRef] [Green Version]
- Gellersen, B.; Brosens, J.; Salfen, B.; Carroll, J.; Keisler, D. Cyclic AMP and progesterone receptor cross-talk in human endometrium: A decidualizing affair. J. Endocrinol. 2003, 178, 357–372. [Google Scholar] [CrossRef] [Green Version]
- Kusama, K.; Yoshie, M.; Tamura, K.; Kodaka, Y.; Hirata, A.; Sakurai, T.; Bai, H.; Imakawa, K.; Nishi, H.; Isaka, K.; et al. Regulation of decidualization in human endometrial stromal cells through exchange protein directly activated by cyclic AMP (Epac). Placenta 2013, 34, 212–221. [Google Scholar] [CrossRef]
- Kusama, K.; Yoshie, M.; Tamura, K.; Nakayama, T.; Nishi, H.; Isaka, K.; Tachikawa, E. The Role of Exchange Protein Directly Activated by Cyclic AMP 2-mediated Calreticulin Expression in the Decidualization of Human Endometrial Stromal Cells. Endocrinology 2014, 155, 240–248. [Google Scholar] [CrossRef] [Green Version]
- Michalak, M.; Groenendyk, J.; Szabo, E.; Gold, L.I.; Opas, M. Calreticulin, a multi-process calcium-buffering chaperone of the endoplasmic reticulum. Biochem. J. 2009, 417, 651–666. [Google Scholar] [CrossRef]
- Ihara, Y.; Inai, Y.; Ikezaki, M. Alteration of integrin-dependent adhesion and signaling in EMT-like MDCK cells established through overexpression of calreticulin. J. Cell. Biochem. 2011, 112, 2518–2528. [Google Scholar] [CrossRef] [PubMed]
- Gold, L.I.; Eggleton, P.; Sweetwyne, M.T.; Van Duyn, L.B.; Greives, M.R.; Naylor, S.M.; Michalak, M.; Murphy-Ullrich, J.E. Calreticulin: Non-endoplasmic reticulum functions in physiology and disease. FASEB J. 2010, 24, 665–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Varricchio, L.; Falchi, M.; Dall’Ora, M.; Benedittis, C.D.; Ruggeri, A.; Uversky, V.N.; Migliaccio, A.R. Calreticulin: Challenges posed by the intrinsically disorderd nature of calreticulin to the study of its function. Front. Cell Dev. Biol. 2017, 5, 96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tokuhiro, K.; Satouh, Y.; Nozawa, K.; Isotani, A.; Fujihara, Y.; Hirashima, Y.; Matsumura, H.; Takumi, K.; Miyano, T.; Okabe, M.; et al. Calreticulin is required for development of the cumulus oocyte complex and female fertility. Sci. Rep. 2015, 5, 14254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parmar, T.; Nimbkar-Joshi, S.; Katkam, R.R.; Gadkar-Sable, S.; Chaudhari, U.; Manjramkar, D.D.; Savardekar, L.; Jacob, S.; Puri, C.P.; Sachdeva, G. Differential expression of calreticulin, a reticuloplasmin in primate endometrium. Hum. Reprod. 2009, 24, 2205–2216. [Google Scholar] [CrossRef] [Green Version]
- Cheng, S.Q.; He, J.L.; Dong, Y.L.; Liu, X.Q.; Ding, Y.B.; Gao, R.F.; Tan, Y.; Ye, Q.; Tian, Z.L.; Wang, Y.X. Characterization of calreticulin expression in mouse endometrium during embryo implantation. Biol. Res. 2009, 42, 505–516. [Google Scholar] [CrossRef] [Green Version]
- Kusama, K.; Yoshie, M.; Tamura, K.; Imakawa, K.; Tachikawa, E. EPAC2-mediated calreticulin regulates LIF and COX2 expression in human endometrial glandular cells. J. Mol. Endocrinol. 2015, 54, 17–24. [Google Scholar] [CrossRef] [Green Version]
- Fatemi, H.M.; Kasius, J.C.; Timmermans, A.; van Diseldorp, J.; Fauser, B.C.; Devroey, P.; Broekmans, F.J. Prevalence of unsuspected uterine cavity abnormalities diagnosed by office hysteroscopy prior to in vitro fertilization. Hum. Reprod. 2010, 25, 1959–1965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perez-Medina, T.; Bajo-Arenas, J.; Salazar, F.; Redondo, T.; Sanfrutos, L.; Alvarez, P.; Engels, V. Endometrial polyps and their implication in the pregnancy rates of patients undergoing intrauterine insemination: A prospective, randomized study. Hum. Reprod. 2005, 20, 1632–1635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laws, M.J.; Taylor, R.N.; Sidell, N.; DeMayo, F.J.; Lydon, J.P.; Gutstein, D.E.; Bagchi, M.K.; Bagchi, I.C. Gap junction communication between uterine stromal cells plays a critical role in pregnancy-associated neovascularization and embryo survival. Development 2008, 135, 2659–2668. [Google Scholar] [CrossRef] [Green Version]
- Afifi, K.; Anand, S.; Nallapeta, S.; Gelbaya, T.A. Management of endometrial polyps in subfertile women: A systematic review. Eur. J. Obstet. Gynecol. Reprod. Biol. 2010, 151, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Jee, B.C.; Jeong, H.G. Management of endometrial polyps in infertile women: A mini-review. Clin. Exp. Reprod. Med. 2021, 48, 198–202. [Google Scholar] [CrossRef]
- Salker, M.S.; Teklenburg, G.; Molokhia, M.; Lavery, S.; Trew, G.; Aojanepong, T.; Mardon, H.J.; Lokugamage, A.U.; Rai, R.; Landles, C.; et al. Natural selection of human embryos: Impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS ONE 2010, 5, e10287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lash, G.E.; Ernerudh, J. Decidual cytokines and pregnancy complicatios: Focus on spontaneous miscarriage. J. Reprod. Immunol. 2015, 108, 83–89. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Yan, H.; Li, X.; Liu, J.; Cao, S.; Huang, B.; Huang, D.; Wu, L. Inhibition of connexin 43 and phosphorylated NR2B in spinal astrocytes attenuates bone cancer pain in mice. Front. Cell. Neurosci. 2018, 12, 129. [Google Scholar] [CrossRef] [PubMed]
- Guzel, E.; Arlier, S.; Guzeloglu-Kayisli, O.; Tabak, M.S.; Ekiz, T.; Semerci, N.; Larsen, K.; Schatz, F.; Lockwood, C.J.; Kayisli, U.A. Endoplasmic reticulum stress and homeostasis in reproductive physiology and pathology. Int. J. Mol. Sci. 2017, 18, 792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sohn, J.O.; Seong, S.Y.; Kim, H.J.; Jo, Y.M.; Lee, K.H.; Chung, M.K.; Song, H.J.; Park, K.S.; Lim, J.M. Alterations in intracellular Ca2+ levels in human endometrial stromal cells after decidualization. Biochem. Biophys. Res. Commun. 2019, 515, 318–324. [Google Scholar] [CrossRef] [PubMed]
- Kusama, K.; Yoshie, M.; Tamura, K.; Imakawa, K.; Isaka, K.; Tachikawa, E. Regulatory action of calcium ion on cyclic AMP-enhanced expression of implantation-related factors in human endometrial cells. PLoS ONE 2015, 10, e0132017. [Google Scholar] [CrossRef] [Green Version]
- Benson, G.V.; Lim, H.; Paria, B.C.; Satokata, I.; Dey, S.K.; Maas, R.L. Mechanisms of reduced fertility in Hoxa-10 mutant mice: Uterine homeosis and loss of maternal Hoxa-10 expression. Development 1996, 122, 2687–2696. [Google Scholar] [CrossRef]
- Daikoku, T.; Tranguch, S.; Friedman, D.B.; Das, S.K.; Smith, D.F.; Dey, S.K. Proteomic analysis identifies immunophilin FK506 binding protein 4 (FKBP52) as a downstream target of Hoxa10 in the periimplantation mouse uterus. Mol. Endocrinol. 2005, 19, 683–697. [Google Scholar] [CrossRef] [Green Version]
- Iwahashi, N.; Ikezaki, M.; Nishitsuji, K.; Yamamoto, M.; Matsuzaki, I.; Kato, N.; Takaoka, N.; Taniguchi, M.; Murata, S.; Ino, K.; et al. Extracelluarly released calreticulin induced by endoplasmic reticulum stress impairs syncytialization of cytotrophoblast model BeWo cells. Cells 2021, 10, 1305. [Google Scholar] [CrossRef]
- Domínguez, F.; Avila, S.; Cervero, A.; Martín, J.; Pellicer, A.; Castrillo, J.L.; Simón, C. A combined approach for gene discovery identifies insulin-like growth factor-binding protein-related protein 1 as a new gene implicated in human endometrial receptivity. J. Clin. Endocrinol. Metab. 2003, 88, 1849–1857. [Google Scholar] [CrossRef]
- Tamura, K.; Hara, T.; Kutsukake, M.; Iwatsuki, K.; Yanagida, M.; Yoshie, M.; Kogo, H. Expression and the biological activities of insulin-like growth factor-binding protein related protein 1 in rat uterus during the periimplantation period. Endocrinology 2004, 145, 5243–5251. [Google Scholar] [CrossRef]
- Kutsukake, M.; Ishihara, R.; Yoshie, M.; Kogo, H.; Tamura, K. Involvement of insulin-like growth factor-binding protein-related protein 1 in decidualization of human endometrial stromal cells. Mol. Hum. Reprod. 2007, 13, 737–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kusama, K.; Yoshie, M.; Tamura, K.; Daikoku, T.; Takarada, T.; Tachikawa, E. Possible roles of the cAMP-mediators EPAC and RAP1 in decidualization of rat uterus. Reproduction 2014, 147, 897–906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name. (Accession No.) | Sequence (5′–3′) | Product Length (bp) |
---|---|---|
Rat Prl | CATGCTTCTCACTACATCCAT | 133 |
(NM_012629.1) | CTTCAGGAGTAGCTAGGGAAGA | |
Rat Dtprp | ATCCAGCGAGCTGAAGTCAT | 114 |
(NM_022846.2) | ATGCCTATACATGCGTGCAA | |
Rat CALR | GACCTCTGGCAGGTCAAGTC | 71 |
(NM_022399.2) | TCAGCGTATGCCTCATCGT | |
Rat Cx43 | CGAAAACGTCTGCTATGACAAG | 112 |
(NM_012567.2) | ATAGAACACATGGGCCAAGTAC | |
Rat GAPDH | AAAGCTGTGGCGTGAGG | 96 |
(NM_017008.4) | TTCAGCTCTGGGATGACCTT | |
Human IGFBP-1 | AATGGATTTTATCACAGCAGACAG | 73 |
(NM_000596.4) | GGTAGACGCACCAGCAGAGT | |
Human IGFBP-7 | AAGTAACTGGCTGGGTGCTG | 86 |
(NM_001553.3) | CTGTCCTTGGGAATTGGATG | |
Human PTGS2 | CTTCACGCATCAGTTTTTCAAG | 96 |
(NM_000963.4) | TCACCGTAAATATGATTTAAGTCCAC | |
Human CALR | GACCTCTGGCAGGTCAAGTC | 71 |
(NM_004343.4) | TCAGCGTATGCCTCATCGT | |
Human GAPDH | AGCCACATCGCTCAGACA | 66 |
(NM_002046.7) | GCCCAATACGACCAAATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoshie, M.; Kusama, K.; Tanaka, R.; Okubo, T.; Kojima, J.; Takaesu, Y.; Isaka, K.; Nishi, H.; Tamura, K. Possible Roles of Calreticulin in Uterine Decidualization and Receptivity in Rats and Humans. Int. J. Mol. Sci. 2021, 22, 10505. https://doi.org/10.3390/ijms221910505
Yoshie M, Kusama K, Tanaka R, Okubo T, Kojima J, Takaesu Y, Isaka K, Nishi H, Tamura K. Possible Roles of Calreticulin in Uterine Decidualization and Receptivity in Rats and Humans. International Journal of Molecular Sciences. 2021; 22(19):10505. https://doi.org/10.3390/ijms221910505
Chicago/Turabian StyleYoshie, Mikihiro, Kazuya Kusama, Risaka Tanaka, Takanori Okubo, Junya Kojima, Yotaro Takaesu, Keiichi Isaka, Hirotaka Nishi, and Kazuhiro Tamura. 2021. "Possible Roles of Calreticulin in Uterine Decidualization and Receptivity in Rats and Humans" International Journal of Molecular Sciences 22, no. 19: 10505. https://doi.org/10.3390/ijms221910505