Kahweol Exerts Skin Moisturizing Activities by Upregulating STAT1 Activity
Abstract
1. Introduction
2. Results
2.1. Skin-Protective Effect of Kahweol
2.2. Effect of Kahweol on Transcription Factor Regulation
3. Discussion
4. Materials and Methods
4.1. Materials and Drug Preparation
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. DPPH Decolorimetric Assay
4.5. ABTS Assay
4.6. Luciferase Reporter Gene Assay
4.7. Evaluation of Messenger RNA Levels through Reverse Transcriptase PCR
4.8. Total Cell Lysate Preparation
4.9. Immunoblotting
4.10. Hyaluronan (HA) Quantification
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AP-1 | Activator protein 1 | 
| HA | hyaluronic acid | 
| TGM-1 | transglutaminase 1 | 
| HAS | HA synthase | 
| HYALs | hyaluronidases | 
| MTT | 3-4-5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide | 
| ABTS | 2,20-azino-bis (3ethylbenzothiazoline-6-sulphonic acid) diammonium salt | 
| DPPH | diphenyl-2-picryl-hydrazyl | 
| AA | ascorbic acid | 
References
- You, L.; Cho, J.Y. The regulatory role of Korean ginseng in skin cells. J. Ginseng Res. 2021, 45, 363–370. [Google Scholar] [CrossRef]
 - Jeong, D.; Qomaladewi, N.P.; Lee, J.; Park, S.H.; Cho, J.Y. The role of autophagy in skin fibroblasts, keratinocytes, melanocytes, and epidermal stem cells. J. Investig. Dermatol. 2020, 140, 1691–1697. [Google Scholar] [CrossRef] [PubMed]
 - Vigetti, D.; Viola, M.; Karousou, E.; De Luca, G.; Passi, A. Metabolic control of hyaluronan synthases. Matrix Biol. 2014, 35, 8–13. [Google Scholar] [CrossRef] [PubMed]
 - McCarthy, J.B.; El-Ashry, D.; Turley, E.A. Hyaluronan, cancer-associated fibroblasts and the tumor microenvironment in malignant progression. Front. Cell Dev. Biol. 2018, 6, 48. [Google Scholar] [CrossRef] [PubMed]
 - Tzellos, T.G.; Dionyssopoulos, A.; Klagas, I.; Karakiulakis, G.; Lazaridis, L.; Papakonstantinou, E. Differential glycosaminoglycan expression and hyaluronan homeostasis in juvenile hyaline fibromatosis. J. Am. Acad. Dermatol. 2009, 61, 629–638. [Google Scholar] [CrossRef] [PubMed]
 - Buhren, B.A.; Schrumpf, H.; Hoff, N.-P.; Bölke, E.; Hilton, S.; Gerber, P.A. Hyaluronidase: From clinical applications to molecular and cellular mechanisms. Eur. J. Med. Res. 2016, 21, 1–7. [Google Scholar] [CrossRef]
 - Buhren, B.A.; Schrumpf, H.; Gorges, K.; Reiners, O.; Bölke, E.; Fischer, J.W.; Homey, B.; Gerber, P.A. Dose-and time-dependent effects of hyaluronidase on structural cells and the extracellular matrix of the skin. Eur. J. Med. Res. 2020, 25, 1–12. [Google Scholar] [CrossRef]
 - Terrinoni, A.; Serra, V.; Codispoti, A.; Talamonti, E.; Bui, L.; Palombo, R.; Sette, M.; Campione, E.; Didona, B.; Annicchiarico-Petruzzelli, M. Novel transglutaminase 1 mutations in patients affected by lamellar ichthyosis. Cell Death Dis. 2012, 3, e416. [Google Scholar] [CrossRef]
 - Lorz, L.R.; Kim, D.; Kim, M.Y.; Cho, J.Y. Panax ginseng-derived fraction BIOGF1K reduces atopic dermatitis responses via suppression of mitogen-activated protein kinase signaling pathway. J. Ginseng Res. 2020, 44, 453–460. [Google Scholar] [CrossRef]
 - Ross, G.W.; Abbott, R.D.; Petrovitch, H.; Morens, D.M.; Grandinetti, A.; Tung, K.-H.; Tanner, C.M.; Masaki, K.H.; Blanchette, P.L.; Curb, J.D.; et al. Association of coffee and caffeine intake with the risk of Parkinson disease. JAMA 2000, 283, 2674–2679. [Google Scholar] [CrossRef]
 - Quintana, J.L.B.; Allam, M.F.; Del Castillo, A.S.; Navajas, R.F.-C. Alzheimer’s disease and coffee: A quantitative review. Neurol. Res. 2007, 29, 91–95. [Google Scholar] [CrossRef]
 - Cornelis, M.C.; El-Sohemy, A. Coffee, caffeine, and coronary heart disease. Curr. Opin. Lipidol. 2007, 18, 13–19. [Google Scholar] [CrossRef] [PubMed]
 - de Roos, B.; Caslake, M.J.; Stalenhoef, A.F.; Bedford, D.; Demacker, P.N.; Katan, M.B.; Packard, C.J. The coffee diterpene cafestol increases plasma triacylglycerol by increasing the production rate of large VLDL apolipoprotein B in healthy normolipidemic subjects. Am. J. Clin. Nutr. 2001, 73, 45–52. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Cárdenas, C.; Quesada, A.R.; Medina, M.A. Anti-angiogenic and anti-inflammatory properties of kahweol, a coffee diterpene. PLoS ONE 2011, 6, e23407. [Google Scholar] [CrossRef]
 - Fumimoto, R.; Sakai, E.; Yamaguchi, Y.; Sakamoto, H.; Fukuma, Y.; Nishishita, K.; Okamoto, K.; Tsukuba, T. The coffee diterpene kahweol prevents osteoclastogenesis via impairment of NFATc1 expression and blocking of Erk phosphorylation. J. Pharmacol. Sci. 2012, 118, 479–486. [Google Scholar] [CrossRef]
 - Seo, H.-Y.; Kim, M.-K.; Lee, S.-H.; Hwang, J.S.; Park, K.-G.; Jang, B.K. Kahweol ameliorates the liver inflammation through the inhibition of NF-κB and STAT3 activation in primary Kupffer cells and primary hepatocytes. Nutrients 2018, 10, 863. [Google Scholar] [CrossRef]
 - Shen, T.; Park, Y.C.; Kim, S.H.; Lee, J.; Cho, J.Y. Nuclear factor-kappaB/signal transducers and activators of transcription-1-mediated inflammatory responses in lipopolysaccharide-activated macrophages are a major inhibitory target of kahweol, a coffee diterpene. Biol. Pharm. Bull. 2010, 33, 1159–1164. [Google Scholar] [CrossRef]
 - Seo, H.Y.; Lee, S.H.; Lee, J.H.; Hwang, J.S.; Kim, M.K.; Jang, B.K. Kahweol activates the Nrf2/HO-1 pathway by decreasing Keap1 expression independently of p62 and autophagy pathways. PLoS ONE 2020, 15, e0240478. [Google Scholar] [CrossRef]
 - Kim, H.G.; Hwang, Y.P.; Jeong, H.G. Kahweol blocks STAT3 phosphorylation and induces apoptosis in human lung adenocarcinoma A549 cells. Toxicol. Lett. 2009, 187, 28–34. [Google Scholar] [CrossRef] [PubMed]
 - Boulebd, H. Comparative study of the radical scavenging behavior of ascorbic acid, BHT, BHA and Trolox: Experimental and theoretical study. J. Mol. Struct. 2020, 1201, 127210. [Google Scholar] [CrossRef]
 - Li, W.-H.; Wong, H.-K.; Serrano, J.; Randhawa, M.; Kaur, S.; Southall, M.D.; Parsa, R. Topical stabilized retinol treatment induces the expression of HAS genes and HA production in human skin in vitro and in vivo. Arch. Dermatol. Res. 2017, 309, 275–283. [Google Scholar] [CrossRef]
 - McKenzie, R.C.; Sabin, E. Aberrant signalling and transcription factor activation as an explanation for the defective growth control and differentiation of keratinocytes in psoriasis: A hypothesis. Exp. Dermatol. 2003, 12, 337–345. [Google Scholar] [CrossRef] [PubMed]
 - Frank, D.A.; Mahajan, S.; Ritz, J. Fludarabine-induced immunosuppression is associated with inhibition of STAT1 signaling. Nat. Med. 1999, 5, 444–447. [Google Scholar] [CrossRef] [PubMed]
 - Papakonstantinou, E.; Roth, M.; Karakiulakis, G. Hyaluronic acid: A key molecule in skin aging. Derm. Endocrinol. 2012, 4, 253–258. [Google Scholar] [CrossRef] [PubMed]
 - Gu, Y.; Han, J.; Jiang, C.; Zhang, Y. Biomarkers, oxidative stress and autophagy in skin aging. Ageing Res. Rev. 2020, 59, 101036. [Google Scholar] [CrossRef]
 - Toole, B.P. Hyaluronan: From extracellular glue to pericellular cue. Nat. Rev. Cancer 2004, 4, 528–539. [Google Scholar] [CrossRef]
 - Reed, R.K.; Laurent, U.; Fraser, J.; Laurent, T.C. Removal rate of [3H] hyaluronan injected subcutaneously in rabbits. Am. J. Physiol. Heart Circ. Physiol. 1990, 259, H532–H535. [Google Scholar] [CrossRef]
 - Rauhala, L.; Jokela, T.; Kärnä, R.; Bart, G.; Takabe, P.; Oikari, S.; Tammi, M.I.; Pasonen-Seppänen, S.; Tammi, R.H. Extracellular ATP activates hyaluronan synthase 2 (HAS2) in epidermal keratinocytes via P2Y2, Ca2+ signaling, and MAPK pathways. Biochem. J. 2018, 475, 1755–1772. [Google Scholar] [CrossRef]
 - Kawada, C.; Kimura, M.; Masuda, Y.; Nomura, Y. Oral administration of hyaluronan prevents skin dryness and epidermal thickening in ultraviolet irradiated hairless mice. J. Photochem. Photobiol. B Biol. 2015, 153, 215–221. [Google Scholar] [CrossRef]
 - Göllner, I.; Voss, W.; von Hehn, U.; Kammerer, S. Ingestion of an oral hyaluronan solution improves skin hydration, wrinkle reduction, elasticity, and skin roughness: Results of a clinical study. J. Evid. Based Complement. Altern. Med. 2017, 22, 816–823. [Google Scholar] [CrossRef]
 - Hsu, T.-F.; Su, Z.-R.; Hsieh, Y.-H.; Wang, M.-F.; Oe, M.; Matsuoka, R.; Masuda, Y. Oral hyaluronan relieves wrinkles and improves dry skin: A 12-week double-blinded, placebo-controlled study. Nutrients 2021, 13, 2220. [Google Scholar] [CrossRef]
 - Gold, M.H. Use of hyaluronic acid fillers for the treatment of the aging face. Clin. Interv. Aging 2007, 2, 369. [Google Scholar] [CrossRef]
 - Lee, J.-E.; Kim, Y.-A.; Yu, S.; Park, S.Y.; Kim, K.H.; Kang, N.J. 3,6-Anhydro-L-galactose increases hyaluronic acid production via the EGFR and AMPKα signaling pathway in HaCaT keratinocytes. J. Dermatol. Sci. 2019, 96, 90–98. [Google Scholar] [CrossRef] [PubMed]
 - Lee, J.-O.; Hwang, S.-H.; Shen, T.; Kim, J.H.; You, L.; Hu, W.; Cho, J.Y. Enhancement of skin barrier and hydration-related molecules by protopanaxatriol in human keratinocytes. J. Ginseng Res. 2021, 45, 354–360. [Google Scholar] [CrossRef] [PubMed]
 - Li, L.; Asteriou, T.; Bernert, B.; Heldin, C.-H.; Heldin, P. Growth factor regulation of hyaluronan synthesis and degradation in human dermal fibroblasts: Importance of hyaluronan for the mitogenic response of PDGF-BB. Biochem. J. 2007, 404, 327–336. [Google Scholar] [CrossRef] [PubMed]
 - Liu, C.; Sun, J. A porcine acellular dermal matrix induces human fibroblasts to secrete hyaluronic acid by activating JAK2/STAT3 signalling. RSC Adv. 2020, 10, 18959–18969. [Google Scholar] [CrossRef]
 - Saavalainen, K.; Pasonen-Seppanen, S.; Dunlop, T.W.; Tammi, R.; Tammi, M.I.; Carlberg, C. The human hyaluronan synthase 2 gene is a primary retinoic acid and epidermal growth factor responding gene. J. Biol. Chem. 2005, 280, 14636–14644. [Google Scholar] [CrossRef] [PubMed]
 - Monslow, J.; Williams, J.D.; Fraser, D.J.; Michael, D.R.; Foka, P.; Kift-Morgan, A.P.; Luo, D.D.; Fielding, C.A.; Craig, K.J.; Topley, N. Sp1 and Sp3 mediate constitutive transcription of the human hyaluronan synthase 2 gene. J. Biol. Chem. 2006, 281, 18043–18050. [Google Scholar] [CrossRef]
 - Kim, H.G.; Kim, J.Y.; Hwang, Y.P.; Lee, K.J.; Lee, K.Y.; Kim, D.H.; Kim, D.H.; Jeong, H.G. The coffee diterpene kahweol inhibits tumor necrosis factor-α-induced expression of cell adhesion molecules in human endothelial cells. Toxicol. Appl. Pharmacol. 2006, 217, 332–341. [Google Scholar] [CrossRef] [PubMed]
 - Khodarev, N.N.; Roizman, B.; Weichselbaum, R.R. Molecular pathways: Interferon/stat1 pathway: Role in the tumor resistance to genotoxic stress and aggressive growth. Clin. Cancer Res. 2012, 18, 3015–3021. [Google Scholar] [CrossRef]
 - Haan, C.; Kreis, S.; Margue, C.; Behrmann, I. Jaks and cytokine receptors—An intimate relationship. Biochem. Pharmacol. 2006, 72, 1538–1546. [Google Scholar] [CrossRef] [PubMed]
 - Chen, H.; Jang, J.; Kopalli, S.R.; Yum, J.; Yoon, K.; Cho, J.Y. Anti-photoaging activities of Sorbaria kirilowii ethanol extract in UVB-damaged cells. Cytotechnology 2021, 73, 127–138. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, T.; Zhong, S.; Hou, L.; Wang, Y.; Xing, X.; Guan, T.; Zhang, J.; Li, T. Computational and experimental characterization of estrogenic activities of 20(S,R)-protopanaxadiol and 20(S,R)-protopanaxatriol. J. Ginseng Res. 2020, 44, 690–696. [Google Scholar] [CrossRef] [PubMed]
 - Lee, J.O.; Kim, J.H.; Kim, S.; Kim, M.Y.; Hong, Y.H.; Kim, H.G.; Cho, J.Y. Gastroprotective effects of the nonsaponin fraction of Korean Red Ginseng through cyclooxygenase-1 upregulation. J. Ginseng Res. 2020, 44, 655–663. [Google Scholar] [CrossRef]
 - Hwang, S.-H.; Kim, J.H.; Choi, E.; Park, S.H.; Cho, J.Y. Antioxidative and Skin Protective Effects of Canarium subulatum Methanol Extract on Keratinocytes. Evid. Based Complement. Altern. Med. 2021, 2021, 6692838. [Google Scholar] [CrossRef] [PubMed]
 - Choi, E.; Kim, E.; Kim, J.H.; Yoon, K.; Kim, S.; Lee, J.; Cho, J.Y. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 2019, 43, 692–698. [Google Scholar] [CrossRef] [PubMed]
 







| Target | Direction | Sequences (5′ to 3′) | 
|---|---|---|
| HAS1 | Forward Reverse  | CCACCCAGTACAGCGTCAAC CATGGTGCTTCTGTCGCTCT  | 
| HAS2 | Forward Reverse  | TGACAGGCATCTCACGAACC TGGCGGGAAGTAAACTCGAC  | 
| TGM-1 | Forward Reverse  | GAAATGCGGCAGATGACGAC AACTCCCCAGCGTCTGATTG  | 
| Claudin | Forward Reverse  | TTGGGCTTCATTCTCGCCTT GAGGATGCCAACCACCATCA  | 
| Occludin | Forward Reverse  | GGAGTGAACCCAACTGCTCA CCTGGGGATCCACAACACAG  | 
| Involucrin | Forward Reverse  | TCCTCCTCCAGTCAATACCCA TGCTCAGGCAGTCCCTTTAC  | 
| HYAL-4 | Forward Reverse  | TGAGCTCTCTTGGCTCTGGA AGGCAGCACTTTCTCCTATGG  | 
| GAPDH | Forward Reverse  | GGTCACCAGGGCTGCTTTTA GATGGCATGGACTGTGGTCA  | 
| Name | Annealing Temperature (°C) | Running Cycle | 
|---|---|---|
| HAS1, TGM-1 | 56 | 38 | 
| HAS2 | 61 | 38 | 
| occludin, claudin, involucrin | 56 | 35 | 
| HYAL-4 | 58 | 34 | 
| GAPDH | 55 | 34 | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, H.; Hossain, M.A.; Kim, J.-H.; Cho, J.Y. Kahweol Exerts Skin Moisturizing Activities by Upregulating STAT1 Activity. Int. J. Mol. Sci. 2021, 22, 8864. https://doi.org/10.3390/ijms22168864
Chen H, Hossain MA, Kim J-H, Cho JY. Kahweol Exerts Skin Moisturizing Activities by Upregulating STAT1 Activity. International Journal of Molecular Sciences. 2021; 22(16):8864. https://doi.org/10.3390/ijms22168864
Chicago/Turabian StyleChen, Hongxi, Mohammad Amjad Hossain, Jong-Hoon Kim, and Jae Youl Cho. 2021. "Kahweol Exerts Skin Moisturizing Activities by Upregulating STAT1 Activity" International Journal of Molecular Sciences 22, no. 16: 8864. https://doi.org/10.3390/ijms22168864
APA StyleChen, H., Hossain, M. A., Kim, J.-H., & Cho, J. Y. (2021). Kahweol Exerts Skin Moisturizing Activities by Upregulating STAT1 Activity. International Journal of Molecular Sciences, 22(16), 8864. https://doi.org/10.3390/ijms22168864
        
                                                
