Identification of a Common Epitope in Nucleocapsid Proteins of Euro-America Orthotospoviruses and Its Application for Tagging Proteins
Abstract
:1. Introduction
2. Results
2.1. TNP MAb 20C4C8 Recognizes the TSWV Serogroup of Euro-America Type Orthotospoviruses, but Not Asia Type Orthotospoviruses
2.2. Identification of the Common Epitope Recognized by the TNP MAb 20C4C8
2.3. The Amino Acid Sequence of NP200-229 Containing the Core Sequence KGKEYA Recognized by TNP MAb
2.4. The Feasibility of the NP Sequence for Tagging Different Recombinant Proteins in the Bacterial Expression System
2.5. Co-Immunoprecipitation of NP-Tagged or NSs-Tagged ZYMV CP In Vitro
3. Discussion
4. Materials and Methods
4.1. Virus Sources
4.2. Purification of Bacteria-Expressed TSWV NP
4.3. Production of Mouse Antisera and Monoclonal Antibodies
4.4. Reactions of the Selected TSWV-NP MAb 20C4C8 with Different Orthotospoviruses
4.5. Search for the Highly Conserved Domains of NPs by Sequence Alignment
4.6. Epitope Mapping Using Full Length or Truncated TSWV NP Fused with NSs-Tagged GFP
4.7. Identification of the Minimal Length of the Epitope
4.8. Evaluation of the NP Sequence for Tagging GFP, ZYMV CP, and Mite Chimeric Allergen Dp 25 in the Bacteria-Expressed System
4.9. Protein Expression and Detection by Western Blotting
4.10. Co-Immunoprecipitation of NP-Tagged Proteins In Vitro
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fauquet, C.M.; Mayo, M.A.; Maniloff, J.; Desselberger, U.; Ball, L.A. Virus Taxonomy. In Eighth Report of the International Committee on Taxonomy of Viruses; Elsevier Academic Press: New York, NY, USA, 2005. [Google Scholar]
- Pappu, H.; Jones, R.; Jain, R. Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Res. 2009, 141, 219–236. [Google Scholar] [CrossRef]
- Abudurexiti, A.; Adkins, S.; Alioto, D.; Alkhovsky, S.V.; Avšič-Županc, T.; Ballinger, M.J.; Bente, D.A.; Beer, M.; Bergeron, É.; Blair, C.D.; et al. Taxonomy of the order Bunyavirales: Update 2019. Arch. Virol. 2019, 164, 1949–1965. [Google Scholar] [CrossRef] [Green Version]
- Takeda, A.; Sugiyama, K.; Nagano, H.; Mori, M.; Kaido, M.; Mise, K.; Tsuda, S.; Okuno, T. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted wilt virus. FEBS Lett. 2002, 532, 75–79. [Google Scholar] [CrossRef] [Green Version]
- Bucher, E.; Sijen, T.; de Haan, P.; Goldbach, R.; Prins, M. Negative-Strand Tospoviruses and Tenuiviruses Carry a Gene for a Suppressor of Gene Silencing at Ananlogous Genomic Positions. J. Virol. 2003, 77, 1329–1336. [Google Scholar] [CrossRef] [Green Version]
- Tsompana, M.; Moyer, J.W. Tospoviruses. In Encyclopedia of Virology, 3rd ed.; Mahy, B.W.J., van Regenmortel, M.H.V., Eds.; Elsevier Ltd.: Oxford, UK, 2008; Volume 5, pp. 157–162. [Google Scholar]
- Richmond, K.; Chenault, K.; Sherwood, J.; German, T. Characterization of the Nucleic Acid Binding Properties of Tomato Spotted Wilt Virus Nucleocapsid Protein. Virology 1998, 248, 6–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uhrig, J.F.; Soellick, T.-R.; Minke, C.J.; Philipp, C.; Kellmann, J.-W.; Schreier, P.H. Homotypic interaction and multimerization of nucleocapsid protein of tomato spotted wilt tospovirus: Identification and characterization of two interacting domains. Proc. Natl. Acad. Sci. USA 1999, 96, 55–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Snippe, M.; Borst, J.W.; Goldbach, R.; Kormelink, R. The use of fluorescence microscopy to visualise homotypic interactions of tomato spotted wilt virus nucleocapsid protein in living cells. J. Virol. Methods 2005, 125, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Komoda, K.; Narita, M.; Yamashita, K.; Tanaka, I.; Yao, M. Asymmetric Trimeric Ring Structure of the Nucleocapsid Protein of Tospovirus. J. Virol. 2017, 91, e01002-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Feng, Z.; Wu, J.; Huang, Y.; Lu, G.; Zhu, M.; Wang, B.; Mao, X.; Tao, X. Structure and Function Analysis of Nucleocapsid Protein of Tomato Spotted Wilt Virus Interacting with RNA Using Homology Modeling. J. Biol. Chem. 2015, 290, 3950–3961. [Google Scholar] [CrossRef] [Green Version]
- Snippe, M.; Borst, J.W.; Goldbach, R.; Kormelink, R. Tomato spotted wilt virus Gc and N proteins interact in vivo. Virology 2007, 357, 115–123. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro, D.; Borst, J.W.; Goldbach, R.; Kormelink, R. Tomato spotted wilt virus nucleocapsid protein interacts with both viral glycoproteins Gn and Gc in planta. Virology 2009, 383, 121–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goldbach, R.W.; Kuo, G. Introduction: Proceedings of the international symposium on tospovirus and thrips of floral and vegetable crops. Acta Hort. 1996, 431, 21–26. [Google Scholar] [CrossRef]
- Chen, T.C.; Lu, Y.Y.; Cheng, Y.H.; Li, J.T.; Yeh, Y.C.; Kang, Y.C.; Chang, C.P.; Huang, L.H.; Peng, J.C.; Yeh, S.D. Serological relationship between Melon yellow spot virus and Watermelon silver mottle virus and differential detection of the two viruses in cucurbits. Arch. Virol. 2010, 155, 1085–1095. [Google Scholar] [CrossRef] [PubMed]
- Zheng, K.; Chen, T.C.; Wu, K.; Kang, Y.C.; Yeh, S.D.; Zhang, Z.; Dong, J. Characterization of a New Orthotospovirus from Chilli Pepper in Yunnan Province, China. Plant Dis. 2020, 104, 1175–1182. [Google Scholar] [CrossRef]
- Jan, F.J.; Chen, T.C.; Yeh, S.D. Occurrence, importance, taxonomy, and control of thrips-borne tospoviruses. In Advances in Plant Disease Management; Huang, H.C., Acharya, S.N., Eds.; Research Signpost: Trivandrum, India, 2003; pp. 391–441. [Google Scholar]
- Lin, Y.H.; Chen, T.C.; Hsu, H.T.; Liu, F.L.; Chu, F.H.; Chen, C.C.; Yeh, S.D. Serological Comparison and Molecular Characterization for Verification of Calla lily chlorotic spot virus as a New Tospovirus Species Belonging to Watermelon silver mottle virus Serogroup. Phytopathology 2005, 95, 1482–1488. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.C.; Tsai, W.T.; Kang, Y.C.; Wang, Y.C.; Yeh, S.D. Using monoclonal antibodies against the common epitopes of NSs proteins for the prompt detection and differentiation of tospoviruses prevalent in Euro-America and Asia Regions. Eur. J. Plant Pathol. 2016, 144, 509–524. [Google Scholar] [CrossRef]
- Zerbs, S.; Frank, A.M.; Collart, F.R. Chapter 12 Bacterial Systems for Production of Heterologous Proteins. Methods Enzymol. 2009, 463, 149–168. [Google Scholar] [CrossRef] [PubMed]
- Cregg, J.M.; Tolstorukov, I.; Kusari, A.; Sunga, J.; Madden, K.; Chappell, T. Expression in the yeast Pichia pastoris. Methods Enzymol. 2009, 463, 169–189. [Google Scholar] [PubMed]
- Lico, C.; Chen, Q.; Santi, L. Viral vectors for production of recombinant proteins in plants. J. Cell. Physiol. 2008, 216, 366–377. [Google Scholar] [CrossRef]
- Jarvis, D.L. Baculovirus-insect cell expression systems. Methods Enzymol. 2009, 463, 191–222. [Google Scholar]
- De Jesus, M.; Wurm, F.M. Manufacturing recombinant proteins in kg-ton quantities using animal cells in bioreactors. Eur. J Pharm. Biopharm. 2011, 78, 184–188. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, J.; Larsson, M.; Ståhl, S.; Nygren, P.Å.; Uhlén, M. Multiple affinity domains for the detection, purification and immobilization of recombinant proteins. J. Mol. Recognit. 1996, 9, 585–594. [Google Scholar] [CrossRef]
- Pryor, K.D.; Leiting, B. WITHDRAWN: Reprint of: High-Level Expression of Soluble Protein in Escherichia coli Using a His6-Tag and Maltose-Binding-Protein Double-Affinity Fusion System. Protein Expr. Purif. 2011, 10, 309–319. [Google Scholar] [CrossRef] [PubMed]
- Routzahn, K.M.; Waugh, D.S. Differential effects of supplementary affinity tags on the solubility of MBP fusion proteins. J. Struct. Funct. Genom. 2002, 2, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Honey, S.; Schneider, B.L.; Schieltz, D.M.; Yates, J.R.; Futcher, B. A novel multiple affinity purification tag and its use in identification of proteins associated with a cyclin-CDK complex. Nucleic Acids Res. 2001, 29, E24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Porath, J.; Carlsson, J.; Olsson, I.; Belfrage, G. Metal chelate affinity chromatography, a new approach to protein fractionation. Nat. Cell Biol. 1975, 258, 598–599. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.; Derbyshire, R.; Cook, E.; Dunthorne, L.; Viney, J.; Brewer, S.; Sassenfeld, H.; Bell, L. Chemical synthesis and cloning of a poly(arginine)-coding gene fragment designed to aid polypeptide purification. Gene 1984, 32, 321–327. [Google Scholar] [CrossRef]
- Hopp, T.P.; Prickett, K.S.; Price, V.L.; Libby, R.T.; March, C.J.; Cerretti, D.P.; Urdal, D.L.; Conlon, P.J. A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. BiolTechnology 1988, 6, 1204–1210. [Google Scholar] [CrossRef]
- Schmidt, T.G.; Skerra, A. The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional Ig Fv fragment. Protein Eng. Des. Sel. 1993, 6, 109–122. [Google Scholar] [CrossRef]
- Kolodziej, P.A.; Young, R.A. [35] Epitope tagging and protein surveillance. Methods Enzymol. 1991, 194, 508–519. [Google Scholar] [CrossRef]
- Neill, J.D.; Sellers, J.C.; Musgrove, L.C.; Duck, L. Epitope-tagged gonadotropin-releasing hormone receptors heterologously-expressed in mammalian (COS-1) and insect (Sf9) cells. Mol. Cell. Endocrinol. 1997, 127, 143–154. [Google Scholar] [CrossRef]
- Bedouelle, H.; Duplay, P. Production in Escherichia coli and one-step purification of bifunctional hybrid proteins which bind maltose. Export of the Klenow polymerase into the periplasmic space. JBIC J. Biol. Inorg. Chem. 1988, 171, 541–549. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.B.; Johnson, K.S. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 1988, 67, 31–40. [Google Scholar] [CrossRef]
- Chen, T.-C.; Huang, C.-W.; Kuo, Y.-W.; Liu, F.-L.; Yuan, C.-H.H.; Hsu, H.-T.; Yeh, S.-D. Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup. Phytopathology 2006, 96, 1296–1304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.-W.; Chen, K.-C.; Raja, J.A.; Li, J.-X.; Yeh, S.-D. An efficient tag derived from the common epitope of tospoviral NSs proteins for monitoring recombinant proteins expressed in both bacterial and plant systems. J. Biotechnol. 2013, 164, 510–519. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.H.; Lin, S.S.; Liu, F.L.; Su, W.C.; Yeh, S.D. Oral administration of a mite allergen expressed by zucchini yellow mosaic virus in cucurbit species downregulates allergen-induced airway inflammation and IgE synthesis. J. Allergy Clin. Immunol. 2004, 113, 1079–1085. [Google Scholar] [CrossRef]
- Atreya, P.L.; Lopez-Moya, J.J.; Chu, M.; Atreya, C.D.; Pirone, T.P. Mutational analysis of the coat protein N-terminal amino acids involved in potyvirus transmission by aphids. J. Gen. Virol. 1995, 76, 265–270. [Google Scholar] [CrossRef]
- Granier, F.; Durand-Tardif, M.; Casse-Delbart, F.; Lecoq, H.; Robaglia, C. Mutations in zucchini yellow mosaic virus helper component protein associated with loss of aphid transmissibility. J. Gen. Virol. 1993, 74, 2737–2742. [Google Scholar] [CrossRef]
- Huet, H.; Gal-On, A.; Meir, E.; Lecoq, H.; Raccah, B. Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility. J. Gen. Virol. 1994, 75, 1407–1414. [Google Scholar] [CrossRef]
- Wu, H.W.; Lin, S.S.; Chen, K.C.; Yeh, S.-D.; Chua, N.-H. Discriminating Mutations of HC-Pro of Zucchini yellow mosaic virus with Differential Effects on Small RNA Pathways Involved in Viral Pathogenicity and Symptom Development. Mol. Plant-Microbe Interact. 2010, 23, 17–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terpe, K. Overview of tag protein fusions: From molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 2003, 60, 523–533. [Google Scholar] [CrossRef] [PubMed]
- Waugh, D.S. WITHDRAWN: Reprint of: Making the most of affinity tags. Protein Expr. Purif. 2011, 23, 316–320. [Google Scholar] [CrossRef]
- Peng, Y.H.; Wang, Y.; Gal-On, A.; Huet, H.; Kadoury, D.; Raccah, B. Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus: Effects on aphid transmission and binding to purified virions. J. Gen. Virol. 1998, 79, 897–904. [Google Scholar] [CrossRef] [PubMed]
- Blanc, S.; Lopez-Moya, J.J.; Wang, R.; Lampasona, S.G.; Thornbury, D.W.; Pirone, T.P. A Specific Interaction between Coat Protein and Helper Component Correlates with Aphid Transmission of a Potyvirus. Virology 1997, 231, 141–147. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.-C.; Hsu, H.-T.; Jain, R.K.; Huang, C.-W.; Lin, C.-H.; Liu, F.-L.; Yeh, S.-D. Purification and serological analyses of tospoviral nucleocapsid proteins expressed by Zucchini yellow mosaic virus vector in squash. J. Virol. Methods 2005, 129, 113–124. [Google Scholar] [CrossRef] [PubMed]
- De Ávila, A.C.; De Haan, P.; Smeets, M.L.L.; Resende, R.D.O.; Kormelink, R.; Kitajima, E.W.; Goldbach, R.W.; Peters, D. Distinct levels of relationships between tospovirus isolates. Arch. Virol. 1993, 128, 211–227. [Google Scholar] [CrossRef]
- Pang, S.Z.; Slightom, J.L.; Gonsalves, D. The biological properties of a distinct tospovirus and sequence analysis of its S RNA. Phytopathology 1993, 83, 728–733. [Google Scholar] [CrossRef]
- Law, M.D.; Moyer, J.W. A tomato spotted wilt-like virus with a serologically distinct N protein. J. Gen. Virol. 1990, 71, 933–938. [Google Scholar] [CrossRef]
- Hassani-Mehraban, A.; Botermans, M.; Verhoeven, K.; Meekes, E.; Saaijer, J.; Peters, D.; Goldbach, R.; Kormelink, R. A distinct tospovirus causing necrotic streak on Alstroemeria sp. in Colombia. Arch. Virol. 2010, 155, 423–428. [Google Scholar] [CrossRef] [Green Version]
- Wu, P.R.; Chien, W.C.; Okuda, M.; Takeshita, M.; Yeh, S.D.; Wang, Y.C.; Chen, T.C. Genetic and serological characterization of chrysanthemum stem necrosis virus, a member of the genus Tospovirus. Arch. Virol. 2014, 160, 529–536. [Google Scholar] [CrossRef]
- Takeshita, M.; Nagai, N.; Okuda, M.; Matsuura, S.; Okuda, S.; Furuya, N.; Tsuchiya, K. Molecular and biological characterization of Chrysanthemum stem necrosis virus isolates from distinct regions in Japan. Eur. J. Plant Pathol. 2011, 131, 9–14. [Google Scholar] [CrossRef]
- Yeh, S.D.; Lin, Y.C.; Cheng, Y.H.; Jih, C.L.; Chen, M.J.; Chen, C.C. Identification of Tomato Spotted Wilt-like Virus on Watermelon in Taiwan. Plant Dis. 1992, 76, 835–840. [Google Scholar] [CrossRef]
- Cortês, I.; Livieratos, I.C.; Derks, A.; Peters, D.; Kormelink, R. Molecular and Serological Characterization of Iris Yellow Spot Virus, a New and Distinct Tospovirus Species. Phytopatholgy 1998, 88, 1276–1282. [Google Scholar] [CrossRef] [Green Version]
- Kang, Y.C.; Yeh, S.D.; Liao, C.H.; Chou, W.C.; Liu, F.L.; Dong, J.H.; Chen, T.C. Verification of serological relationship between two phylogenetically related peanut-infecting Tospovirus species. Eur. J. Plant Pathol. 2014, 140, 815–828. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
Primer a | Sequence (5′-3′) | Position of a.a. b | Rz c |
---|---|---|---|
TSWV NP expression in bacteria | |||
P-TNP-BamHI | AAGGGATCCATGTCTAAGGTTAAGCTCA | 1 | BamHI |
M-TNP-XhoI | CACTCGAGAGCAAGTTCTGTGAGTT | 258 | XhoI |
Epitope mapping of TSWV NP | |||
P-T7-pro. | TAATACGACTCACTATAGG | V | NcoI |
P-TNP-199 | AAGGGATCCATTAAGCAAAGTGATTTTACT | 67 | BamHI |
P-TNP-397 | AAGGGATCCCCTCTTGATGATGCAAAGT | 133 | BamHI |
P-TNP-598 | AAGGGATCCAAAGCATTTGAAATGAATG | 200 | BamHI |
P-TNP-634 | AGGGATCCGGAAAAGAGTATGCTGCTAT | 212 | BamHI |
P-TNP-637 | AGGGATCCAAAGAGTATGCTGCTATACT | 211 | BamHI |
P-TNP-652 | GGGATCCATACTTAGCTCCAGCAATCC | 218 | BamHI |
M-TNP-KpnI | CAGGTACCAGCAAGTTCTGTGAGTT | 258 | KpnI |
M-TNP-732 | CAGGTACCTTCATAGAACTTGTTAAGAGTTTC | 244 | KpnI |
M-TNP-687 | CAGGTACCACTTCCTTTAGCATTAGGATTG | 229 | KpnI |
M-TNP-642 | CAGGTACCCTCTTTTCCTTTCTTCACCTG | 214 | KpnI |
M-TNP-654 | CAGGTACCTATAGCAGCATACTCTTTTCCT | 218 | KpnI |
M-TNP-660 | CAGGTACCGCTAAGTATAGCAGCATACTC | 220 | KpnI |
M-TNP-645 | CAGGTACCATACTCTTTTCCTTTCTTCACC | 215 | KpnI |
M-pET-PsiI | AAAATCCCTTATAAATCAAAAGAAT | V | PsiI |
np sequence taggingd | |||
P-tnp-KpnI | GATCCGGTACCAAAGGAAAAGAGTATGCTTGACTCGAGCACCACCACCA | 211-216 | KpnI |
M-pET-PsiI | AAAATCCCTTATAAATCAAAAGAAT | V | PsiI |
P-pET-MluI | CAGCCCACTGACGCGTTGCGCGA | V | MluI |
M-tnp-NcoI | ACGCATGCCATGGCATACTCTTTTCCTTTCATGGTATATCTCCTTCTTA | 211-216 | NcoI |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, H.-W.; Tsai, W.-T.; Hsieh, Y.-Y.; Chen, K.-C.; Yeh, S.-D. Identification of a Common Epitope in Nucleocapsid Proteins of Euro-America Orthotospoviruses and Its Application for Tagging Proteins. Int. J. Mol. Sci. 2021, 22, 8583. https://doi.org/10.3390/ijms22168583
Cheng H-W, Tsai W-T, Hsieh Y-Y, Chen K-C, Yeh S-D. Identification of a Common Epitope in Nucleocapsid Proteins of Euro-America Orthotospoviruses and Its Application for Tagging Proteins. International Journal of Molecular Sciences. 2021; 22(16):8583. https://doi.org/10.3390/ijms22168583
Chicago/Turabian StyleCheng, Hao-Wen, Wei-Ting Tsai, Yi-Ying Hsieh, Kuan-Chun Chen, and Shyi-Dong Yeh. 2021. "Identification of a Common Epitope in Nucleocapsid Proteins of Euro-America Orthotospoviruses and Its Application for Tagging Proteins" International Journal of Molecular Sciences 22, no. 16: 8583. https://doi.org/10.3390/ijms22168583
APA StyleCheng, H.-W., Tsai, W.-T., Hsieh, Y.-Y., Chen, K.-C., & Yeh, S.-D. (2021). Identification of a Common Epitope in Nucleocapsid Proteins of Euro-America Orthotospoviruses and Its Application for Tagging Proteins. International Journal of Molecular Sciences, 22(16), 8583. https://doi.org/10.3390/ijms22168583