MiR408-SmLAC3 Module Participates in Salvianolic Acid B Synthesis in Salvia miltiorrhiza
Abstract
:1. Introduction
2. Results
2.1. MiR408 Negatively Regulates the Synthesis of SalB and RA in S. miltiorrhiza
2.2. SmLAC3 Is the Target of Sm-miR408
2.3. Expression Profiles of SmLAC3 in S. miltiorrhiza
2.4. Overexpression of SmLAC3 Promotes the Biosynthesis of SalB and RA in S. miltiorrhiza
2.5. Overexpressing SmLAC3 Decreases the Lignin Content in the Roots
3. Discussion
3.1. MiR408 Has Multiple Functions in Plants
3.2. Function of Laccase in S. miltiorrhiza
3.3. SmLAC3 Is the Target of Sm-miR408
4. Materials and Methods
4.1. Experimental Materials
4.2. Construction of Transgenic Vectors and Plant Transformation
4.3. Molecular Detection of Transgenic Plantlets
4.4. RLM-RACE
4.5. Determination of Total Phenolic and Total Flavonoid
4.6. Detection of RA and SalB by HPLC
4.7. Lignin Detection by Histochemical Staining
4.8. Determination of Anthocyanin Concentration
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Rogers, K.; Chen, X. Biogenesis, turnover, and mode of action of plant microRNAs. Plant Cell 2013, 25, 2383–2399. [Google Scholar] [CrossRef] [Green Version]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Green Version]
- Chen, X. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 2004, 303, 2022–2025. [Google Scholar] [CrossRef] [Green Version]
- Guo, H.S.; Xie, Q.; Fei, J.F.; Chua, N.H. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [Green Version]
- Aukerman, M.J.; Sakai, H. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell 2003, 15, 2730–2741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.; Yang, C.; Wu, L.; Cai, H.; Li, H.; Xu, M. The peu-miR160a-PeARF17.1/PeARF17.2 module participates in the adventitious root development of poplar. Plant Biotechnol. J. 2020, 18, 457–469. [Google Scholar] [CrossRef] [Green Version]
- Xue, L.J.; Zhang, J.J.; Xue, H.W. Characterization and expression profiles of miRNAs in rice seeds. Nucleic Acids Res. 2009, 37, 916–930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, L.; Yu, X.; Shen, R.; He, Y. HYL1 gene maintains venation and polarity of leaves. Planta 2005, 221, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Palatnik, J.; Allen, E.; Wu, X.; Schommer, C.; Schwab, R.; Carrington, J.; Weigel, D. Control of leaf morphogenesis by microRNAs. Nature 2003, 425, 257–263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, L.; Kim, Y.; Dinh, T.T.; Chen, X. miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. Plant J. 2007, 51, 840–849. [Google Scholar] [CrossRef] [Green Version]
- Khan, G.A.; Declerck, M.; Sorin, C.; Hartmann, C.; Crespi, M.; Lelandais-Briere, C. MicroRNAs as regulators of root development and architecture. Plant Mol. Biol. 2011, 77, 47–58. [Google Scholar] [CrossRef] [PubMed]
- Couzigou, J.M.; Combier, J.P. Plant microRNAs: Key regulators of root architecture and biotic interactions. New Phytol. 2016, 212, 22–35. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Li, Z.; Xiong, L. A plant microRNA regulates the adaptation of roots to drought stress. FEBS Lett. 2012, 586, 1742–1747. [Google Scholar] [CrossRef]
- Sunkar, R.; Kapoor, A.; Zhu, J.-K. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 2006, 18, 2051–2065. [Google Scholar] [CrossRef] [Green Version]
- Abdel-Ghany, S.E.; Pilon, M. MicroRNA-mediated systemic down-regulation of copper protein expression in response to low copper availability in Arabidopsis. J. Biol. Chem. 2008, 283, 15932–15945. [Google Scholar] [CrossRef] [Green Version]
- Zhu, C.; Ding, Y.; Liu, H. MiR398 and plant stress responses. Physiol. Plant 2011, 143, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Ng, D.W.K.; Zhang, C.; Miller, M.; Palmer, G.; Whiteley, M.; Tholl, D.; Chen, Z.J. Cis- and trans-regulation of miR163 and target genes confers natural variation of secondary metabolites in two Arabidopsis species and their allopolyploids. Plant Cell 2011, 23, 1729–1740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gou, J.Y.; Felippes, F.F.; Liu, C.J.; Weigel, D.; Wang, J.W. Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell 2011, 23, 1512–1522. [Google Scholar] [CrossRef] [Green Version]
- Zhang, M.; Dong, Y.; Nie, L.; Lu, M.; Fu, C.; Yu, L. High-throughput sequencing reveals miRNA effects on the primary and secondary production properties in long-term subcultured Taxus cells. Front. Plant Sci. 2015, 6, 604. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.P.; Yu, Y.; Feng, Y.Z.; Zhou, Y.F.; Zhang, F.; Yang, Y.W.; Lei, M.Q.; Zhang, Y.C.; Chen, Y.Q. MiR408 regulates grain yield and photosynthesis via a phytocyanin protein. Plant Physiol. 2017, 175, 1175–1185. [Google Scholar] [CrossRef]
- Ma, C.; Burd, S.; Lers, A. miR408 is involved in abiotic stress responses in Arabidopsis. Plant J. 2015, 84, 169–187. [Google Scholar] [CrossRef]
- Trindade, I.; Capitão, C.; Dalmay, T.; Fevereiro, M.P.; Santos, D.M.d. miR398 and miR408 are up-regulated in response to water deficit in Medicago truncatula. Planta 2009, 231, 705–716. [Google Scholar] [CrossRef]
- Pan, J.; Huang, D.; Guo, Z.; Kuang, Z.; Zhang, H.; Xie, X.; Ma, Z.; Gao, S.; Lerdau, M.T.; Chu, C.; et al. Overexpression of microRNA408 enhances photosynthesis, growth, and seed yield in diverse plants. J. Integr. Plant Biol. 2018, 60, 323–340. [Google Scholar] [CrossRef]
- Hajyzadeh, M.; Turktas, M.; Khawar, K.M.; Unver, T. miR408 overexpression causes increased drought tolerance in chickpea. Gene 2015, 555, 186–193. [Google Scholar] [CrossRef]
- Zhang, H.; He, H.; Wang, X.; Wang, X.; Yang, X.; Li, L.; Deng, X.W. Genome-wide mapping of the HY5-mediated gene networks in Arabidopsis that involve both transcriptional and post-transcriptional regulation. Plant J. 2011, 65, 346–358. [Google Scholar] [CrossRef]
- Guo, X.; Niu, J.; Cao, X. Heterologous expression of Salvia miltiorrhiza microRNA408 enhances tolerance to salt stress in Nicotiana benthamiana. Int. J. Mol. Sci. 2018, 19, 3985. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turlapati, P.V.; Kim, K.-W.; Davin, L.B.; Lewis, N.G. The laccase multigene family in Arabidopsis thaliana: Towards addressing the mystery of their gene function(s). Planta 2010, 233, 439–470. [Google Scholar] [CrossRef]
- Cai, X.; Davis, E.J.; Ballif, J.; Liang, M.; Bushman, E.; Haroldsen, V.; Torabinejad, J.; Wu, Y. Mutant identification and characterization of the laccase gene family in Arabidopsis. J. Exp. Bot. 2006, 57, 2563–2569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pourcel, L.; Routaboul, J.; Cheynier, V.; Lepiniec, L.; Debeaujon, I. Flavonoid oxidation in plants: From biochemical properties to physiological functions. Trends Plant Sci. 2007, 12, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Nakashima, J.; Chen, F.; Yin, Y.; Fu, C.; Yun, J.; Shao, H.; Wang, X.; Wang, Z.-Y.; Dixon, R.A. LACCASE is necessary and nonredundant with PEROXIDASE for lignin polymerization during vascular development in Arabidopsis. Plant Cell 2013, 25, 3976–3987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pourcel, L.; Routaboul, J.M.; Kerhoas, L.; Caboche, M.; Lepiniec, L.; Debeaujon, I. TRANSPARENT TESTA10 encodes a laccase-like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat. Plant Cell 2005, 17, 2966–2980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, G.D.; Li, Q.J.; Luo, B.; Chen, X.Y. Explanta phytoremediation of trichlorophenol and phenolic allelochemicals via an engineered secretory laccase. Nat. Biotechnol. 2004, 22, 893–897. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Feng, J.; Chen, L.; Xu, Z.; Zhu, Y.; Wang, Y.; Xiao, Y.; Chen, J.; Zhou, Y.; Tan, H.; et al. Genome-wide identification and characterization of Salvia miltiorrhiza laccases reveal potential targets for salvianolic acid B biosynthesis. Front. Plant Sci. 2019, 10, 435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di, P.; Zhang, L.; Chen, J.; Tan, H.; Xiao, Y.; Dong, X.; Zhou, X.; Chen, W. ¹³C tracer reveals phenolic acids biosynthesis in hairy root cultures of Salvia miltiorrhiza. ACS Chem. Biol. 2013, 8, 1537–1548. [Google Scholar] [CrossRef]
- Zhao, M.; Meyers, B.C.; Cai, C.; Xu, W.; Ma, J. Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean. Plant Cell 2015, 27, 546–562. [Google Scholar] [CrossRef] [Green Version]
- Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 2009, 136, 669–687. [Google Scholar] [CrossRef] [Green Version]
- Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Li, L. SQUAMOSA promoter binding protein-like7 regulated microRNA408 is required for vegetative development in Arabidopsis. Plant J. 2013, 74, 98–109. [Google Scholar] [CrossRef] [PubMed]
- Ding, J.; Zhou, S.; Guan, J. Finding microRNA targets in plants: Current status and perspectives. Genom. Proteom. Bioinform. 2012, 10, 264–275. [Google Scholar] [CrossRef] [Green Version]
- Llave, C.; Xie, Z.; Kasschau, K.; Carrington, J. Cleavage of scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 2002, 297, 2053–2056. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Y.; Gao, S.; Di, P.; Chen, J.; Chen, W.; Zhang, L. Methyl jasmonate dramatically enhances the accumulation of phenolic acids in Salvia miltiorrhiza hairy root cultures. Physiol. Plant. 2009, 137, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Wang, D.; Zhou, L.; Yu, X.; Yan, X.; Zhang, Q.; Li, B.; Liu, Y.; Zhou, W.; Cao, X.; et al. JA-responsive transcription factor SmMYB97 promotes phenolic acid and tanshinone accumulation in Salvia miltiorrhiza. J. Agric. Food Chem. 2020, 68, 14850–14862. [Google Scholar] [CrossRef]
- Wang, J.; Feng, J.; Jia, W.; Chang, S.; Li, S.; Li, Y. Lignin engineering through laccase modification: A promising field for energy plant improvement. Biotechnol. Biofuels 2015, 8, 145. [Google Scholar] [CrossRef] [Green Version]
- Liang, M.; Davis, E.; Gardner, D.; Cai, X.; Wu, Y. Involvement of AtLAC15 in lignin synthesis in seeds and in root elongation of Arabidopsis. Planta 2006, 224, 1185–1196. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.; Abdullah, Y.; Benner, J.; Eberle, D.; Gehlen, K.; Hücherig, S.; Janiak, V.; Kim, K.; Sander, M.; Weitzel, C.; et al. Evolution of rosmarinic acid biosynthesis. Phytochemistry 2009, 70, 1663–1679. [Google Scholar] [CrossRef] [PubMed]
- Sunkar, R.; Zhu, J.K. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 2004, 16, 2001–2019. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Zhang, Y.C.; Zhang, J.P.; Yu, Y.; Zhou, Y.F.; Feng, Y.Z.; Yang, Y.W.; Lei, M.Q.; He, H.; Lian, J.P.; et al. Rice UCL8, a plantacyanin gene targeted by miR408, regulates fertility by controlling pollen tube germination and growth. Rice 2018, 11, 60. [Google Scholar] [CrossRef] [PubMed]
- Kuo, Y.W.; Lin, J.S.; Li, Y.C.; Jhu, M.Y.; King, Y.C.; Jeng, S.T. MicroR408 regulates defense response upon wounding in sweet potato. J. Exp. Bot. 2019, 70, 469–483. [Google Scholar] [CrossRef] [PubMed]
- Janusz, G.; Pawlik, A.; Świderska-Burek, U.; Polak, J.; Sulej, J.; Jarosz-Wilkołazka, A.; Paszczyński, A. Laccase properties, physiological functions, and evolution. Int. J. Mol. Sci. 2020, 21, 966. [Google Scholar] [CrossRef] [Green Version]
- Bao, W.; O’malley, D.; Whetten, R.; Sederoff, R. A laccase associated with lignification in loblolly pine xylem. Science 1993, 260, 672–674. [Google Scholar] [CrossRef]
- Mayer, A.; Staples, R. Laccase: New functions for an old enzyme. Phytochemistry 2002, 60, 551–565. [Google Scholar] [CrossRef]
- Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef] [Green Version]
- Hu, Q.; Min, L.; Yang, X.; Jin, S.; Zhang, L.; Li, Y.; Ma, Y.; Qi, X.; Li, D.; Liu, H.; et al. Laccase GhLac1 modulates broad-spectrum biotic stress tolerance via manipulating phenylpropanoid pathway and jasmonic acid synthesis. Plant Physiol. 2018, 176, 1808–1823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Zhuo, C.; Xiao, X.; Wang, X.; Docampo-Palacios, M.; Chen, F.; Dixon, R.A. Substrate specificity of LACCASE8 facilitates polymerization of caffeyl alcohol for C-lignin biosynthesis in the seed coat of Cleome hassleriana. Plant Cell 2020, 32, 3825–3845. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Chen, X.; Chen, Y.; Zhang, Q.; Su, L.; Chen, X.; Chen, Y.; Zhang, Z.; Lin, Y.; Lai, Z. Genome-wide identification of miRNAs and their targets during early somatic embryogenesis in Dimocarpus longan Lour. Sci. Rep. 2020, 10, 4626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, C.; Li, D.; Zhou, H.; Li, J.; Lu, S. Analysis of the laccase gene family and miR397-/miR408-mediated posttranscriptional regulation in Salvia miltiorrhiza. PeerJ 2019, 7, e7605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, Y.; Wang, Z. Genetic transformation of the medicinal plant Salvia miltiorrhiza by Agrobacterium tumefaciens-mediated method. Plant Cell Tissue Organ Cult. 2007, 88, 175–184. [Google Scholar] [CrossRef]
- Carbonell, A.; Takeda, A.; Fahlgren, N.; Johnson, S.; Cuperus, J.; Carrington, J. New generation of artificial MicroRNA and synthetic trans-acting small interfering RNA vectors for efficient gene silencing in Arabidopsis. Plant Physiol. 2014, 165, 15–29. [Google Scholar] [CrossRef] [Green Version]
- Yang, N.; Zhou, W.; Su, J.; Wang, X.; Li, L.; Wang, L.; Cao, X.; Wang, Z. Overexpression of SmMYC2 increases the production of phenolic acids in Salvia miltiorrhiza. Front. Plant Sci. 2017, 8, 1804. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Yan, Y.; Wang, Z. The Arabidopsis PAP1 transcription factor plays an important role in the enrichment of phenolic acids in Salvia miltiorrhiza. J. Agric. Food Chem. 2010, 58, 12168–12175. [Google Scholar] [CrossRef] [PubMed]
- Du, T.; Niu, J.; Su, J.; Li, S.; Guo, X.; Li, L.; Cao, X.; Kang, J. SmbHLH37 functions antagonistically with SmMYC2 in regulating jasmonate-mediated biosynthesis of phenolic acids in Salvia miltiorrhiza. Front. Plant Sci. 2018, 9, 1720. [Google Scholar] [CrossRef] [PubMed]
Line | Lignin (mg/g DW) | |
---|---|---|
Klason Lignin | Acid-Soluble Lignin | |
Control | 72.13 ± 2.31 | 0.53 ± 0.01 |
OE-2 | 63.99 ± 3.26 | 0.47 ± 0.02 |
OE-10 | 59.62 ± 3.05 | 0.45 ± 0.02 |
OE-15 | 50.96 ± 1.71 * | 0.38 ± 0.01 * |
OE-17 | 52.48 ± 2.14 * | 0.41 ± 0.03 * |
Primer | Oligo Sequence 5′ to 3′ |
---|---|
amiR-MIR408-F | TGTATCTGTCTCGTCCCCGTCTCCAATGATGATCACATTCGTTATCTATTTTTTTGGAGACGGGTACGAGACAGA |
amiR-MIR408-R | AATGTCTGTCTCGTACCCGTCTCCAAAAAAATAGATAACGAATGTGATCATTGGAGACGGGGACGAGACAGA |
RT-SmUbiquitin-F | ACCCTCACGGGGAAGACCATC |
RT-SmUbiquitin-R | ACCACGGAGACGGAGGACAAG |
RT-MIR408-F | ACAGAAAATGGAGGCGAAGAAG |
RT-MIR408-R | GTCCCTAATCAGTGAGAGACACAGTAA |
RT-SmLAC3-F | TGTTGCTCCTTTGGATGCCT |
RT-SmLAC3-R | CCGTGATCGTGTTGTGGGTT |
RT-SmCYP72A327-F | GCTACCAACAAGGCAGAAGGAT |
RT-SmCYP72A327-R | CCTCTCTTCCCATCGCTTCC |
RT-SmBRI-like3-F | GAAGCAGTTCGCATTCGTGA |
RT-SmBRI-like3-R | GACCCGAGAGTTGATTGTAGGA |
SmLAC3-101 | GGATACATCCCATTCACCGTGATC |
SmLAC3-152 | ATAACCTTCACCACCAGAGTGTCG |
SmLAC3-217 | CCCATGCACTTCTCATTTGCCT |
SmLAC3-F | ATGGAGAAGAAGATGAGCTCTTTG |
SmLAC3-R | TCAACAAAGGGGAAGATCTGG |
RT-TAT1-F | CGAGCAGGGATGGGAGGTTG |
RT-TAT1-R | GCCTCTTGGCTGTCTCAGCA |
RT-PAL1-F | GATAGCGGAGTGCAGGTCGTAC |
RT-PAL1-F | CGAACTAGCAGATTGGCAGAGG |
RT-PAL2-F | GGCGGCGATTGAGAGCAGGA |
RT-PAL2-R | ATCAGCAGATAGGAAGAGGAGCACC |
RT-HPPR1-F | TGACTCCAGAAACAACCCACATT |
RT-HPPR1-R | CCCAGACGACCCTCCACAAG |
RT-C4H1-F | CCAGGAGTCCAAATAACAGAGCCG |
RT-C4H1-R | GCCACCAAGCGTTCACCAAGAT |
RT-4CL1-F | TCACCCATGCCGGATTCGAG |
RT-4CL1-R | AGATCGCGCCGATGAAGGAG |
RT-4CL2-F | TCGCCAAATACGACCTTTCC |
RT-4CL2-R | TGCTTCAGTCATCCCATACCC |
RT-RAS1-F | CCAAAGTCAATTATGCCAAGGG |
RT-RAS1-R | GTCGGATAGGTGGTGCTCGT |
RT-RAS2-F | ACTCGGTTCAAATGCGGTAG |
RT-RAS2-R | GGGCTGGTATTCGTCGTG |
RT-CYP98A14-F | CCAATCCTACGGCCCGATCC |
RT-CYP98A14-R | GCCGTCTCTGCTGAGCTTGA |
RT-CCR-F | CTGATGTTGCTTCGCCTTCT |
RT-CCR-R | CATACGTGCCTTCCCCTTG |
RT-COMT-F | GCCACTAAGAATGTTGTCC |
RT-COMT-R | TCTGTCCTTTCCTTACCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, H.; Guo, X.; Yang, R.; Wang, S.; Li, L.; Niu, J.; Wang, D.; Cao, X. MiR408-SmLAC3 Module Participates in Salvianolic Acid B Synthesis in Salvia miltiorrhiza. Int. J. Mol. Sci. 2021, 22, 7541. https://doi.org/10.3390/ijms22147541
Zou H, Guo X, Yang R, Wang S, Li L, Niu J, Wang D, Cao X. MiR408-SmLAC3 Module Participates in Salvianolic Acid B Synthesis in Salvia miltiorrhiza. International Journal of Molecular Sciences. 2021; 22(14):7541. https://doi.org/10.3390/ijms22147541
Chicago/Turabian StyleZou, Haolan, Xiaorong Guo, Rao Yang, Shengsong Wang, Lin Li, Junfeng Niu, Donghao Wang, and Xiaoyan Cao. 2021. "MiR408-SmLAC3 Module Participates in Salvianolic Acid B Synthesis in Salvia miltiorrhiza" International Journal of Molecular Sciences 22, no. 14: 7541. https://doi.org/10.3390/ijms22147541
APA StyleZou, H., Guo, X., Yang, R., Wang, S., Li, L., Niu, J., Wang, D., & Cao, X. (2021). MiR408-SmLAC3 Module Participates in Salvianolic Acid B Synthesis in Salvia miltiorrhiza. International Journal of Molecular Sciences, 22(14), 7541. https://doi.org/10.3390/ijms22147541