The Consequences of Soluble Epoxide Hydrolase Deletion on Tumorigenesis and Metastasis in a Mouse Model of Breast Cancer
Abstract
1. Introduction
2. Results
2.1. Tumor Development and Metastases in PyMT and PyMTΔsEH Mice
2.2. Cellular Composition of Primary Tumors from PyMT, PyMT2c44, and PyMTsEH Mice
2.3. PUFA-Derived Lipid Metabolite Profiles in Primary Tumors from PyMT and PyMTsEH Mice
2.4. Consequences of sEH Deletion on the PyMT Tumor Proteome
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals
4.3. Animal Monitoring and Tumor Biometrics
4.4. Immunohistochemistry
4.5. Tumor Digestion and FACS Analysis
4.6. RNA Isolation and Quantitative Real-Time PCR (RT-qPCR)
4.7. Immunoblotting
4.8. UPLC–MS/MS-Based Fatty Acid Metabolite Profiling
4.9. Proteomics: Sample Preparation
4.10. Proteomics: Mass Spectrometry
4.11. Data Processing
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A

References
- Fleming, I.; Fisslthaler, B.; Michaelis, U.R.; Kiss, L.; Popp, R.; Busse, R. The coronary endothelium-derived hyperpolarizing factor (EDHF) stimulates multiple signalling pathways and proliferation in vascular cells. Pflugers Archiv. Eur. J. Physiol. 2001, 442, 511–518. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Harder, D.R. Cerebral capillary endothelial cell mitogenesis and morphogenesis induced by astrocytic epoxyeicosatrienoic Acid. Stroke 2002, 33, 2957–2964. [Google Scholar] [CrossRef] [PubMed]
- Fleming, I. The pharmacology of the cytochrome P450 epoxygenase/soluble epoxide hydrolase axis in the vasculature and cardiovascular disease. Pharmacol. Rev. 2014, 66, 1106–1140. [Google Scholar] [CrossRef] [PubMed]
- Enayetallah, A.E.; French, R.A.; Grant, D.F. Distribution of soluble epoxide hydrolase, cytochrome P450 2C8, 2C9 and 2J2 in human malignant neoplasms. J. Mol. Histol. 2006, 37, 133–141. [Google Scholar] [CrossRef]
- Schmelzle, M.; Dizdar, L.; Matthaei, H.; Baldus, S.E.; Wolters, J.; Lindenlauf, N.; Bruns, I.; Cadeddu, R.-P.; Kröpil, F.; Topp, S.A.; et al. Esophageal cancer proliferation is mediated by cytochrome P450 2C9 (CYP2C9). Prostaglandins Other Lipid Mediat. 2011, 94, 25–33. [Google Scholar] [CrossRef]
- Jiang, J.-G.; Chen, C.-L.; Card, J.W.; Yang, S.; Chen, J.-X.; Fu, X.-N.; Ning, Y.-G.; Xiao, X.; Zeldin, D.C.; Wang, D.W. Cytochrome P450 2J2 promotes the neoplastic phenotype of carcinoma cells and is up-regulated in human tumors. Cancer Res. 2005, 65, 4707–4715. [Google Scholar] [CrossRef]
- Chen, C.; Wei, X.; Rao, X.; Wu, J.; Yang, S.; Chen, F.; Ma, D.; Zhou, J.; Dackor, R.T.; Zeldin, D.C.; et al. Cytochrome P450 2J2 is highly expressed in hematologic malignant diseases and promotes tumor cell growth. J. Pharmacol. Exp. Ther. 2011, 336, 344–355. [Google Scholar] [CrossRef]
- El-Serafi, I.; Fares, M.; Abedi-Valugerdi, M.; Afsharian, P.; Moshfegh, A.; Terelius, Y.; Potácová, Z.; Hassan, M. Cytochrome P450 2J2, a new key enzyme in cyclophosphamide bioactivation and a potential biomarker for hematological malignancies. Pharm. J. 2015, 15, 405–413. [Google Scholar] [CrossRef]
- Chen, C.; Li, G.; Liao, W.; Wu, J.; Liu, L.; Ma, D.; Zhou, J.; Elbekai, R.H.; Edin, M.L.; Zeldin, D.C.; et al. Selective inhibitors of CYP2J2 related to terfenadine exhibit strong activity against human cancers in vitro and in vivo. J. Pharmacol. Exp. Ther. 2009, 329, 908–918. [Google Scholar] [CrossRef]
- Xia, R.; Sun, L.; Liao, J.; Li, H.; You, X.; Xu, D.; Yang, J.; Hwang, S.H.; Jones, R.D.; Hammock, B.; et al. Inhibition of pancreatic carcinoma growth through enhancing ω-3 epoxy polyunsaturated fatty acid profile by inhibition of soluble epoxide hydrolase. Anticancer. Res. 2019, 39, 3651–3660. [Google Scholar] [CrossRef]
- Leineweber, C.G.; Pietzner, A.; Zhang, I.W.; Blessin, U.B.; Rothe, M.; Schott, E.; Schebb, N.H.; Weylandt, K.H. Assessment of the effect of Sorafenib on omega-6 and omega-3 epoxyeicosanoid formation in patients with hepatocellular carcinoma. Int. J. Mol. Sci. 2020, 21, 1875. [Google Scholar] [CrossRef]
- Wei, X.; Zhang, D.; Dou, X.; Niu, N.; Huang, W.; Bai, J.; Zhang, G. Elevated 14,15- epoxyeicosatrienoic acid by increasing of cytochrome P450 2C8, 2C9 and 2J2 and decreasing of soluble epoxide hydrolase associated with aggressiveness of human breast cancer. BMC Cancer 2014, 14, 841. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Panigrahy, D.; Edin, M.L.; Lee, C.R.; Huang, S.; Bielenberg, D.R.; Butterfield, C.E.; Barnés, C.M.; Mammoto, A.; Mammoto, T.; Luria, A.; et al. Epoxyeicosanoids stimulate multiorgan metastasis and tumor dormancy escape in mice. J. Clin. Investig. 2012, 122, 178–191. [Google Scholar] [CrossRef] [PubMed]
- Lin, E.Y.; Jones, J.G.; Li, P.; Zhu, L.; Whitney, K.D.; Muller, W.J.; Pollard, J.W. Progression to malignancy in the polyoma middle T oncoprotein mouse breast cancer model provides a reliable model for human diseases. Am. J. Pathol. 2003, 163, 2113–2126. [Google Scholar] [CrossRef]
- Hu, J.; Frömel, T.; Fleming, I. Angiogenesis and vascular stability in eicosanoids and cancer. Cancer Metastasis Rev. 2018, 37, 425–438. [Google Scholar] [CrossRef] [PubMed]
- Kesavan, R.; Frömel, T.; Zukunft, S.; Laban, H.; Geyer, A.; Naeem, Z.; Heidler, J.; Wittig, I.; Elwakeel, E.; Brüne, B.; et al. Cyp2c44 regulates prostaglandin synthesis, lymphangiogenesis, and metastasis in a mouse model of breast cancer. Proc. Natl. Acad. Sci. USA 2020, 117, 5923–5930. [Google Scholar] [CrossRef] [PubMed]
- Imig, J.D.; Hammock, B.D. Soluble epoxide hydrolase as a therapeutic target for cardiovascular diseases. Nat. Rev. Drug Discov. 2009, 8, 794–805. [Google Scholar] [CrossRef] [PubMed]
- Imig, J.D. Epoxides and soluble epoxide hydrolase in cardiovascular physiology. Physiol. Rev. 2012, 92, 101–130. [Google Scholar] [CrossRef]
- McReynolds, C.; Morisseau, C.; Wagner, K.; Hammock, B. Epoxy fatty acids are promising targets for treatment of pain, cardiovascular disease and other indications characterized by mitochondrial dysfunction, endoplasmic stress and inflammation. Adv. Exp. Med. Biol. 2020, 1274, 71–99. [Google Scholar] [CrossRef] [PubMed]
- Yokose, T.; Doy, M.; Taniguchi, T.; Shimada, T.; Kakiki, M.; Horie, T.; Matsuzaki, Y.; Mukai, K. Immunohistochemical study of cytochrome P450 2C and 3A in human non-neoplastic and neoplastic tissues. Virchows Arch. 1999, 434, 401–411. [Google Scholar] [CrossRef]
- Jiang, J.-G.; Ning, Y.-G.; Chen, C.; Ma, D.; Liu, Z.-J.; Yang, S.; Zhou, J.; Xiao, X.; Zhang, X.A.; Edin, M.L.; et al. Cytochrome p450 epoxygenase promotes human cancer metastasis. Cancer Res. 2007, 67, 6665–6674. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, H.; Dong, H.; Liao, J.; Hammock, B.D.; Yang, G.-Y. Soluble epoxide hydrolase deficiency inhibits dextran sulfate sodium-induced colitis and carcinogenesis in mice. Anticancer Res. 2013, 33, 5261–5271. [Google Scholar] [PubMed]
- Liu, J.-Y.; Park, S.-H.; Morisseau, C.; Hwang, S.H.; Hammock, B.D.; Weiss, R.H. Sorafenib has soluble epoxide hydrolase inhibitory activity, which contributes to its effect profile in vivo. Mol. Cancer Ther. 2009, 8, 2193–2203. [Google Scholar] [CrossRef]
- Michaelis, U.R.; Fleming, I. From endothelium-derived hyperpolarizing factor (EDHF) to angiogenesis: Epoxyeicosatrienoic acids (EETs) and cell signaling. Pharmacol. Ther. 2006, 111, 584–595. [Google Scholar] [CrossRef]
- Weichand, B.; Popp, R.; Dziumbla, S.; Mora, J.; Strack, E.; Elwakeel, E.; Frank, A.-C.; Scholich, K.; Pierre, S.; Syed, S.N.; et al. S1PR1 on tumor-associated macrophages promotes lymphangiogenesis and metastasis via NLRP3/IL-1β. J. Exp. Med. 2017, 214, 2695–2713. [Google Scholar] [CrossRef] [PubMed]
- Yan, B.; Ai, Y.; Sun, Q.; Ma, Y.; Cao, Y.; Wang, J.; Zhang, Z.; Wang, X. Membrane damage during ferroptosis is caused by oxidation of phospholipids catalyzed by the oxidoreductases POR and CYB5R1. Mol. Cell 2021, 81, 355–369. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.; Li, H.; Graham, E.T.; Deik, A.A.; Eaton, J.K.; Wang, W.; Sandoval-Gomez, G.; Clish, C.B.; Doench, J.G.; Schreiber, S.L. Cytochrome P450 oxidoreductase contributes to phospholipid peroxidation in ferroptosis. Nat. Chem. Biol. 2020, 16, 302–309. [Google Scholar] [CrossRef]
- Du, E.; Li, X.; He, S.; Li, X.; He, S. The critical role of the interplays of EphrinB2/EphB4 and VEGF in the induction of angiogenesis. Mol. Biol. Rep. 2020, 47, 4681–4690. [Google Scholar] [CrossRef]
- Webler, A.C.; Popp, R.; Korff, T.; Michaelis, U.R.; Urbich, C.; Busse, R.; Fleming, I. Cytochrome P450 2C9-induced angiogenesis is dependent on EphB4. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 1123–1129. [Google Scholar] [CrossRef]
- Benz, P.M.; Ding, Y.; Stingl, H.; Loot, A.E.; Zink, J.; Wittig, I.; Popp, R.; Fleming, I. AKAP12 deficiency impairs VEGF-induced endothelial cell migration and sprouting. Acta Physiol. 2020, 228, e13325. [Google Scholar] [CrossRef]
- Kumar, N.; Gupta, S.; Dabral, S.; Singh, S.; Sehrawat, S. Role of exchange protein directly activated by cAMP (EPAC1) in breast cancer cell migration and apoptosis. Mol. Cell. Biochem. 2017, 430, 115–125. [Google Scholar] [CrossRef]
- Milne, R.L.; Lorenzo-Bermejo, J.; Burwinkel, B.; Malats, N.; Arias, J.I.; Zamora, M.P.; Benítez, J.; Humphreys, M.K.; García-Closas, M.; Chanock, S.J.; et al. 7q21-rs6964587 and breast cancer risk: An extended case-control study by the Breast Cancer Association Consortium. J. Med. Genet. 2011, 48, 698–702. [Google Scholar] [CrossRef]
- Frank, B.; Wiestler, M.; Kropp, S.; Hemminki, K.; Spurdle, A.B.; Sutter, C.; Wappenschmidt, B.; Chen, X.; Beesley, J.; Hopper, J.L.; et al. Association of a common AKAP9 variant with breast cancer risk: A collaborative analysis. J. Natl. Cancer Inst. 2008, 100, 437–442. [Google Scholar] [CrossRef]
- Ding, J.; Kuo, M.-L.; Su, L.; Xue, L.; Luh, F.; Zhang, H.; Wang, J.; Lin, T.G.; Zhang, K.; Chu, P.; et al. Human mitochondrial pyrroline-5-carboxylate reductase 1 promotes invasiveness and impacts survival in breast cancers. Carcinogenesis 2017, 38, 519–531. [Google Scholar] [CrossRef] [PubMed]
- De Ritis, F.; Coltorti, M.; Giusti, G. An enzymic test for the diagnosis of viral hepatitis: The transaminase serum activities. Clin. Chim. Acta 1957, 2, 70–74. [Google Scholar] [CrossRef]
- Ha, Y.-S.; Kim, S.W.; Chun, S.Y.; Chung, J.-W.; Choi, S.H.; Lee, J.N.; Kim, B.S.; Kim, H.T.; Yoo, E.S.; Kwon, T.G.; et al. Association between De Ritis ratio (aspartate aminotransferase/alanine aminotransferase) and oncological outcomes in bladder cancer patients after radical cystectomy. BMC Urol. 2019, 19, 10. [Google Scholar] [CrossRef]
- Wong, B.W.; Wang, X.; Zecchin, A.; Thienpont, B.; Cornelissen, I.; Kalucka, J.; García-Caballero, M.; Missiaen, R.; Huang, H.; Brüning, U.; et al. The role of fatty acid β-oxidation in lymphangiogenesis. Nature 2017, 542, 49–54. [Google Scholar] [CrossRef]
- Zhao, Q.; Huang, J.; Wang, D.; Chen, L.; Sun, D.; Zhao, C. Endothelium-specific CYP2J2 overexpression improves cardiac dysfunction by promoting angiogenesis via Jagged1/Notch1 signaling. J. Mol. Cell Cardiol. 2018, 123, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Popp, R.; Frömel, T.; Ehling, M.; Awwad, K.; Adams, R.H.; Hammes, H.P.; Fleming, I. Müller glia cells regulate Notch signaling and retinal angiogenesis via the generation of 19,20-dihydroxydocosapentaenoic acid. J. Exp. Med. 2014, 211, 281–295. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Panigrahy, D.; Mahakian, L.M.; Yang, J.; Liu, J.-Y.; Stephen Lee, K.S.; Wettersten, H.I.; Ulu, A.; Hu, X.; Tam, S.; et al. Epoxy metabolites of docosahexaenoic acid (DHA) inhibit angiogenesis, tumor growth, and metastasis. Proc. Natl. Acad. Sci. USA 2013, 110, 6530–6535. [Google Scholar] [CrossRef]
- Rand, A.A.; Rajamani, A.; Kodani, S.D.; Harris, T.R.; Schlatt, L.; Barnych, B.; Passerini, A.G.; Hammock, B.D. Epoxyeicosatrienoic acid (EET)-stimulated angiogenesis is mediated by epoxy hydroxyeicosatrienoic acids (EHETs) formed from COX-2. J. Lipid Res. 2019, 60, 1996–2005. [Google Scholar] [CrossRef]
- Franses, J.W.; Drosu, N.C.; Gibson, W.J.; Chitalia, V.C.; Edelman, E.R. Dysfunctional endothelial cells directly stimulate cancer inflammation and metastasis. Int. J. Cancer 2013, 133, 1334–1344. [Google Scholar] [CrossRef] [PubMed]
- Basu, S.; Nachat-Kappes, R.; Caldefie-Chézet, F.; Vasson, M.-P. Eicosanoids and adipokines in breast cancer: From molecular mechanisms to clinical considerations. Antioxid. Redox Signal. 2013, 18, 323–360. [Google Scholar] [CrossRef] [PubMed]
- Araki, R.; Jincho, Y.; Hoki, Y.; Nakamura, M.; Tamura, C.; Ando, S.; Kasama, Y.; Abe, M. Conversion of ancestral fibroblasts to induced pluripotent stem cells. Stem Cells 2010, 28, 213–220. [Google Scholar] [CrossRef]
- Xu, C.; Liu, W.; You, X.; Leimert, K.; Popowycz, K.; Fang, X.; Wood, S.L.; Slater, D.M.; Sun, Q.; Gu, H.; et al. PGF2α modulates the output of chemokines and pro-inflammatory cytokines in myometrial cells from term pregnant women through divergent signaling pathways. Mol. Human Reprod. 2015, 21, 603–614. [Google Scholar] [CrossRef]
- Zhang, G.; Panigrahy, D.; Hwang, S.H.; Yang, J.; Mahakian, L.M.; Wettersten, H.I.; Liu, J.-Y.; Wang, Y.; Ingham, E.S.; Tam, S.; et al. Dual inhibition of cyclooxygenase-2 and soluble epoxide hydrolase synergistically suppresses primary tumor growth and metastasis. Proc. Natl. Acad. Sci. USA 2014, 111, 11127–11132. [Google Scholar] [CrossRef]
- Fleming, I.; Fisslthaler, B.; Dixit, M.; Busse, R. Role of PECAM-1 in the shear-stress-induced activation of Akt and the endothelial nitric oxide synthase (eNOS) in endothelial cells. J. Cell Sci. 2005, 118, 4103–4111. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Armando, A.M.; Quehenberger, O.; Yan, C.; Dennis, E.A. Comprehensive ultra-performance liquid chromatographic separation and mass spectrometric analysis of eicosanoid metabolites in human samples. J. Chromatogr. A 2014, 1359, 60–69. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef] [PubMed]
- Kulak, N.A.; Pichler, G.; Paron, I.; Nagaraj, N.; Mann, M. Minimal, encapsulated proteomic-sample processing applied to copy-number estimation in eukaryotic cells. Nat. Methods 2014, 11, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Olsen, J.V.; de Godoy, L.M.F.; Li, G.; Macek, B.; Mortensen, P.; Pesch, R.; Makarov, A.; Lange, O.; Horning, S.; Mann, M. Parts per million mass accuracy on an Orbitrap mass spectrometer via lock mass injection into a C-trap. Mol. Cell. Proteom. 2005, 4, 2010–2021. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef]
- Perez-Riverol, Y.; Csordas, A.; Bai, J.; Bernal-Llinares, M.; Hewapathirana, S.; Kundu, D.J.; Inuganti, A.; Griss, J.; Mayer, G.; Eisenacher, M.; et al. The PRIDE database and related tools and resources in 2019: Improving support for quantification data. Nucleic Acids Res. 2019, 47, D442–D450. [Google Scholar] [CrossRef]








| Gene Name (Mouse) | Accession Number | Forward Primer | Reverse Primer |
|---|---|---|---|
| 18S | NR_003278.3 | CTTTGGTCGCTCGCTCCTC | CTGACCGGGTTGGTTTTGAT |
| Prox1 | NM_008937.3 | CCAGTAAGACATCACCGCGT | TGGGCACAGCTCAAGAATCC |
| Sox7 | NM_011446.1 | AAACCCCACTCTGGCTTGAC | GGTCCTTGGGCAGTCATTCA |
| Vegfr1 | NM_010228.4 | GAGGAGGATGAGGGTGTCTATAGGT | GTGATCAGCTCCAGGTTTGACTT |
| Vegfr2 | NM_010612.3 | GCCCTGCTGTGGTCTCACTAC | CAAAGCATTGCCCATTCGAT |
| Vegfr3 | NM_008029.3 | ATGTGTGGTCCTTCGGCGTGC | TTCAGCCGCTGGCAGAACTCC |
| Vegfa | NM_001287056.1 | GCACTGGACCCTGGCTTTACT GCTGTA | GAACTTGATCACTTCATGGGACTTCTGCTC |
| Vegfc | NM_009506.2 | GTGCTTCTTGTCTCTGGCGT | TTCAAAAGCCTTGACCTCGC |
| EphB4 | NM_001159571.1 | GGCGCATTGGGTTTCTTTCT | CTGGGGATAGCCCATGACAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kesavan, R.; Frömel, T.; Zukunft, S.; Brüne, B.; Weigert, A.; Wittig, I.; Popp, R.; Fleming, I. The Consequences of Soluble Epoxide Hydrolase Deletion on Tumorigenesis and Metastasis in a Mouse Model of Breast Cancer. Int. J. Mol. Sci. 2021, 22, 7120. https://doi.org/10.3390/ijms22137120
Kesavan R, Frömel T, Zukunft S, Brüne B, Weigert A, Wittig I, Popp R, Fleming I. The Consequences of Soluble Epoxide Hydrolase Deletion on Tumorigenesis and Metastasis in a Mouse Model of Breast Cancer. International Journal of Molecular Sciences. 2021; 22(13):7120. https://doi.org/10.3390/ijms22137120
Chicago/Turabian StyleKesavan, Rushendhiran, Timo Frömel, Sven Zukunft, Bernhard Brüne, Andreas Weigert, Ilka Wittig, Rüdiger Popp, and Ingrid Fleming. 2021. "The Consequences of Soluble Epoxide Hydrolase Deletion on Tumorigenesis and Metastasis in a Mouse Model of Breast Cancer" International Journal of Molecular Sciences 22, no. 13: 7120. https://doi.org/10.3390/ijms22137120
APA StyleKesavan, R., Frömel, T., Zukunft, S., Brüne, B., Weigert, A., Wittig, I., Popp, R., & Fleming, I. (2021). The Consequences of Soluble Epoxide Hydrolase Deletion on Tumorigenesis and Metastasis in a Mouse Model of Breast Cancer. International Journal of Molecular Sciences, 22(13), 7120. https://doi.org/10.3390/ijms22137120

