Hsp40 Protein DNAJB6 Interacts with Viral NS3 and Inhibits the Replication of the Japanese Encephalitis Virus
Abstract
1. Introduction
2. Results
2.1. Screening for Cellular Factors That Interact with JEV NS3
2.2. DNAJB6 Co-Precipitates and Co-Localizes with JEV NS3
2.3. Overexpression of DNAJB6 Inhibits JEV Infection
2.4. Loss of DNAJB6 Function Affects the Propagation of JEV
2.5. DNAJB6 Inhibits the Replication of JEV, but Does not Affect Viral Entry
2.6. JEV Infection Downregulates the Expression of DNAJB6
3. Discussion
4. Materials and Methods
4.1. Cells, Virus and Replicons
4.2. Plasmids and Antibodies
4.3. Yeast Two-Hybrid Screening
4.4. Transfections
4.5. Co-immunoprecipitation Assays
4.6. Virus Infection Assays
4.7. Confocal Immunofluorescence Microscopy
4.8. Generation of DNAJB6 Knock-Out Cell Lines and DNAJB6 Complementation with Exogenous Plasmid
4.9. Quantitative RT-PCR
4.10. Immunoblotting
4.11. Plaque Assay
4.12. Cell Viability Assays
4.13. Viral Binding and Internalization Assays
4.14. In Vitro RNA Transcription, Transfection, and Luciferase Assays
4.15. Quantification and Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Daep, C.A.; Munoz-Jordan, J.L.; Eugenin, E.A. Flaviviruses, an expanding threat in public health: Focus on dengue, West Nile, and Japanese encephalitis virus. J. Neurovirol. 2014, 20, 539–560. [Google Scholar] [CrossRef] [PubMed]
- Geiss, B.J.; Stahla, H.; Hannah, A.M.; Gari, A.M.; Keenan, S.M. Focus on flaviviruses: Current and future drug targets. Future Med. Chem. 2009, 1, 327–344. [Google Scholar] [CrossRef] [PubMed]
- Solomon, T.; Ni, H.; Beasley, D.W.; Ekkelenkamp, M.; Cardosa, M.J.; Barrett, A.D. Origin and evolution of Japanese encephalitis virus in southeast Asia. J. Virol. 2003, 77, 3091–3098. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.H.; Lien, J.C.; Chen, C.J.; Liu, Y.C.; Wang, C.Y.; Ping, C.F.; Lin, Y.F.; Huang, A.C.; Lin, C.W. Antiviral Activity of a Novel Compound CW-33 against Japanese Encephalitis Virus through Inhibiting Intracellular Calcium Overload. Int. J. Mol. Sci. 2016, 17, 1386. [Google Scholar] [CrossRef] [PubMed]
- Misra, U.K.; Kalita, J. Overview: Japanese encephalitis. Prog. Neurobiol. 2010, 91, 108–120. [Google Scholar] [CrossRef]
- Wang, H.; Liang, G. Epidemiology of Japanese encephalitis: Past, present, and future prospects. Ther. Clin. Risk Manag. 2015, 11, 435–448. [Google Scholar] [CrossRef]
- Gould, E.A.; Solomon, T. Pathogenic flaviviruses. Lancet 2008, 371, 500–509. [Google Scholar] [CrossRef]
- Marsh, M.; Helenius, A. Virus entry: Open sesame. Cell 2006, 124, 729–740. [Google Scholar] [CrossRef]
- Ye, J.; Chen, Z.; Li, Y.; Zhao, Z.; He, W.; Zohaib, A.; Song, Y.; Deng, C.; Zhang, B.; Chen, H. Japanese Encephalitis Virus NS5 Inhibits Type I Interferon (IFN) Production by Blocking the Nuclear Translocation of IFN Regulatory Factor 3 and NF-κB. J. Virol. 2017, 91, e00039-17. [Google Scholar] [CrossRef]
- Shi, P.Y. Flavivirus NS5 Prevents the InSTATement of IFN. Cell Host Microbe 2014, 16, 269–271. [Google Scholar] [CrossRef][Green Version]
- Le Breton, M.; Meyniel-Schicklin, L.; Deloire, A.; Coutard, B.; Canard, B.; de Lamballerie, X.; Andre, P.; Rabourdin-Combe, C.; Lotteau, V.; Davoust, N. Flavivirus NS3 and NS5 proteins interaction network: A high-throughput yeast two-hybrid screen. BMC Microbiol. 2011, 11, 234. [Google Scholar] [CrossRef] [PubMed]
- Walsh, D.; Mohr, I. Viral subversion of the host protein synthesis machinery. Nat. Rev. Microbiol. 2011, 9, 860–875. [Google Scholar] [CrossRef] [PubMed]
- Roth, H.; Magg, V.; Uch, F.; Mutz, P.; Klein, P.; Haneke, K.; Lohmann, V.; Bartenschlager, R.; Fackler, O.T.; Locker, N. Flavivirus Infection Uncouples Translation Suppression from Cellular Stress Responses. MBio 2017, 8, e02150-16. [Google Scholar] [CrossRef] [PubMed]
- Sengupta, N.; Ghosh, S.; Vasaikar, S.V.; Gomes, J.; Basu, A. Modulation of neuronal proteome profile in response to Japanese encephalitis virus infection. PLoS ONE 2014, 9, e90211. [Google Scholar] [CrossRef]
- Thongtan, T.; Wikan, N.; Wintachai, P.; Rattanarungsan, C.; Srisomsap, C.; Cheepsunthorn, P.; Smith, D.R. Characterization of putative Japanese encephalitis virus receptor molecules on microglial cells. J. Med. Virol. 2012, 84, 615–623. [Google Scholar] [CrossRef]
- Nain, M.; Mukherjee, S.; Karmakar, S.P.; Paton, A.W.; Paton, J.C.; Abdin, M.Z.; Basu, A.; Kalia, M.; Vrati, S. GRP78 Is an Important Host Factor for Japanese Encephalitis Virus Entry and Replication in Mammalian Cells. J. Virol. 2017, 91, e02274-16. [Google Scholar] [CrossRef]
- Chiu, H.P.; Chiu, H.; Yang, C.F.; Lee, Y.L.; Chiu, F.L.; Kuo, H.C.; Lin, R.J.; Lin, Y.L. Inhibition of Japanese encephalitis virus infection by the host zinc-finger antiviral protein. PLoS Pathog. 2018, 14, e1007166. [Google Scholar] [CrossRef]
- Ma, L.; Li, F.; Zhang, J.W.; Li, W.; Zhao, D.M.; Wang, H.; Hua, R.H.; Bu, Z.G. Host Factor SPCS1 Regulates the Replication of Japanese Encephalitis Virus through Interactions with Transmembrane Domains of NS2B. J. Virol. 2018, 92, e00197-18. [Google Scholar] [CrossRef]
- Niu, J.; Jiang, Y.; Xu, H.; Zhao, C.; Zhou, G.; Chen, P.; Cao, R. TIM-1 Promotes Japanese Encephalitis Virus Entry and Infection. Viruses 2018, 10, 630. [Google Scholar] [CrossRef]
- Hazra, B.; Kumawat, K.L.; Basu, A. The host microRNA miR-301a blocks the IRF1-mediated neuronal innate immune response to Japanese encephalitis virus infection. Sci. Signal. 2017, 10, eaaf5185. [Google Scholar] [CrossRef]
- Ashraf, U.; Zhu, B.; Ye, J.; Wan, S.; Nie, Y.; Chen, Z.; Cui, M.; Wang, C.; Duan, X.; Zhang, H.; et al. MicroRNA-19b-3p Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF11. J. Virol. 2016, 90, 4780–4795. [Google Scholar] [CrossRef] [PubMed]
- Sampath, A.; Padmanabhan, R. Molecular targets for flavivirus drug discovery. Antiviral Res. 2009, 81, 6–15. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.C.; Huang, Z.S.; Chiang, P.L.; Chen, C.T.; Wu, H.N. Analysis of the nucleoside triphosphatase, RNA triphosphatase, and unwinding activities of the helicase domain of dengue virus NS3 protein. FEBS Lett. 2009, 583, 691–696. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.; Vasudevan, S.G.; Lescar, J. The flavivirus NS2B-NS3 protease-helicase as a target for antiviral drug development. Antiviral Res. 2015, 118, 148–158. [Google Scholar] [CrossRef] [PubMed]
- Murray, C.L.; Jones, C.T.; Rice, C.M. Architects of assembly: Roles of Flaviviridae non-structural proteins in virion morphogenesis. Nat. Rev. Microbiol. 2008, 6, 699–708. [Google Scholar] [CrossRef] [PubMed]
- Chiou, C.T.; Hu, C.C.; Chen, P.H.; Liao, C.L.; Lin, Y.L.; Wang, J.J. Association of Japanese encephalitis virus NS3 protein with microtubules and tumour susceptibility gene 101 (TSG101) protein. J. Gen. Virol. 2003, 84, 2795–2805. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Chen, Z.; Zhang, B.; Miao, H.; Zohaib, A.; Xu, Q.; Chen, H.; Cao, S. Heat shock protein 70 is associated with replicase complex of Japanese encephalitis virus and positively regulates viral genome replication. PLoS ONE 2013, 8, e75188. [Google Scholar] [CrossRef]
- Chen, Z.; Ye, J.; Ashraf, U.; Li, Y.; Wei, S.; Wan, S.; Zohaib, A.; Song, Y.; Chen, H.; Cao, S. MicroRNA-33a-5p Modulates Japanese Encephalitis Virus Replication by Targeting Eukaryotic Translation Elongation Factor 1A1. J. Virol. 2016, 90, 3722–3734. [Google Scholar] [CrossRef]
- Emiko, U.; Morikawa, Y.; Komano, J. Novel Role of HSP40/DNAJ in the Regulation of HIV-1 Replication. J. Acquir. Immune Defic. Syndr. 2013, 64, 154–162. [Google Scholar] [CrossRef]
- Ko, S.-H.; Liau, Y.-J.; Chi, Y.-H.; Lai, M.-J.; Chiang, Y.-P.; Lu, C.-Y.; Chang, L.-Y.; Tarn, W.-Y.; Huang, L.-M. Interference of DNAJB6/MRJ Isoform Switch by Morpholino Inhibits Replication of HIV-1 and RSV. Mol. Ther. Nucleic Acids 2019, 14, 251–261. [Google Scholar] [CrossRef]
- Kumar, M.; Mitra, D. Heat shock protein 40 is necessary for human immunodeficiency virus-1 Nef-mediated enhancement of viral gene expression and replication. J. Biol. Chem. 2005, 280, 40041–40050. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Rawat, P.; Khan, S.Z.; Dhamija, N.; Chaudhary, P.; Ravi, D.S.; Mitra, D. Reciprocal regulation of human immunodeficiency virus-1 gene expression and replication by heat shock proteins 40 and 70. J. Mol. Biol. 2011, 410, 944–958. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Belshan, M.; Ratner, L. Hsp40 facilitates nuclear import of the human immunodeficiency virus type 2 Vpx-mediated preintegration complex. J. Virol. 2008, 82, 1229–1237. [Google Scholar] [CrossRef] [PubMed]
- Pei, Y.; Fu, W.; Yang, E.; Shen, A.; Chen, Y.C.; Gong, H.; Chen, J.; Huang, J.; Xiao, G.; Liu, F. A Hsp40 chaperone protein interacts with and modulates the cellular distribution of the primase protein of human cytomegalovirus. PLoS Pathog. 2012, 8, e1002968. [Google Scholar] [CrossRef] [PubMed]
- Taguwa, S.; Maringer, K.; Li, X.; Bernal-Rubio, D.; Rauch, J.N.; Gestwicki, J.E.; Andino, R.; Fernandez-Sesma, A.; Frydman, J. Defining Hsp70 Subnetworks in Dengue Virus Replication Reveals Key Vulnerability in Flavivirus Infection. Cell 2015, 163, 1108–1123. [Google Scholar] [CrossRef]
- Das, S.; Laxminarayana, S.V.; Chandra, N.; Ravi, V.; Desai, A. Heat shock protein 70 on Neuro2a cells is a putative receptor for Japanese encephalitis virus. Virology 2009, 385, 47–57. [Google Scholar] [CrossRef]
- Nain, M.; Abdin, M.Z.; Kalia, M.; Vrati, S. Japanese encephalitis virus invasion of cell: Allies and alleys. Rev. Med. Virol. 2016, 26, 129–141. [Google Scholar] [CrossRef]
- Zhu, Y.Z.; Cao, M.M.; Wang, W.B.; Wang, W.; Ren, H.; Zhao, P.; Qi, Z.T. Association of heat-shock protein 70 with lipid rafts is required for Japanese encephalitis virus infection in Huh7 cells. J. Gen. Virol. 2012, 93, 61–71. [Google Scholar] [CrossRef]
- Ren, J.; Ding, T.; Zhang, W.; Song, J.; Ma, W. Does Japanese encephalitis virus share the same cellular receptor with other mosquito-borne flaviviruses on the C6/36 mosquito cells? Virol. J. 2007, 4, 83. [Google Scholar] [CrossRef]
- Chuang, C.K.; Yang, T.H.; Chen, T.H.; Yang, C.F.; Chen, W.J. Heat shock cognate protein 70 isoform D is required for clathrin-dependent endocytosis of Japanese encephalitis virus in C6/36 cells. J. Gen. Virol. 2015, 96, 793–803. [Google Scholar] [CrossRef]
- Qiu, X.B.; Shao, Y.M.; Miao, S.; Wang, L. The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cell Mol. Life Sci. 2006, 63, 2560–2570. [Google Scholar] [CrossRef] [PubMed]
- Kampinga, H.H.; Craig, E.A. The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat. Rev. Mol. Cell Biol. 2010, 11, 579–592. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, S.; Gething, P.W.; Brady, O.J.; Messina, J.P.; Farlow, A.W.; Moyes, C.L.; Drake, J.M.; Brownstein, J.S.; Hoen, A.G.; Sankoh, O.; et al. The global distribution and burden of dengue. Nature 2013, 496, 504–507. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, E.; Kose, N.; Edeling, M.A.; Adhikari, J.; Sapparapu, G.; Lazarte, S.M.; Nelson, C.A.; Govero, J.; Gross, M.L.; Fremont, D.H.; et al. Mouse and Human Monoclonal Antibodies Protect against Infection by Multiple Genotypes of Japanese Encephalitis Virus. MBio 2018, 9. [Google Scholar] [CrossRef]
- Boldescu, V.; Behnam, M.A.M.; Vasilakis, N.; Klein, C.D. Broad-spectrum agents for flaviviral infections: Dengue, Zika and beyond. Nat. Rev. Drug Discov. 2017, 16, 565–586. [Google Scholar] [CrossRef]
- Craig, E.A.; Huang, P.; Aron, R.; Andrew, A. The diverse roles of J-proteins, the obligate Hsp70 co-chaperone. Rev. Physiol. Biochem. Pharm. 2006, 1–21. [Google Scholar] [CrossRef]
- Knox, C.; Luke, G.A.; Blatch, G.L.; Pesce, E.R. Heat shock protein 40 (Hsp40) plays a key role in the virus life cycle. Virus Res. 2011, 160, 15–24. [Google Scholar] [CrossRef]
- Wang, R.Y.; Huang, Y.R.; Chong, K.M.; Hung, C.Y.; Ke, Z.L.; Chang, R.Y. DnaJ homolog Hdj2 facilitates Japanese encephalitis virus replication. Virol. J. 2011, 8, 471. [Google Scholar] [CrossRef]
- Bozzacco, L.; Yi, Z.; Andreo, U.; Conklin, C.R.; Li, M.M.; Rice, C.M.; MacDonald, M.R. Chaperone-Assisted Protein Folding Is Critical for Yellow Fever Virus NS3/4A Cleavage and Replication. J. Virol. 2016, 90, 3212–3228. [Google Scholar] [CrossRef]
- Yi, Z.; Sperzel, L.; Nurnberger, C.; Bredenbeek, P.J.; Lubick, K.J.; Best, S.M.; Stoyanov, C.T.; Law, L.M.; Yuan, Z.; Rice, C.M.; et al. Identification and characterization of the host protein DNAJC14 as a broadly active flavivirus replication modulator. PLoS Pathog. 2011, 7, e1001255. [Google Scholar] [CrossRef]
- Yuan, L.; Wu, R.; Liu, H.; Wen, X.; Huang, X.; Wen, Y.; Ma, X.; Yan, Q.; Huang, Y.; Zhao, Q.; et al. Tissue tropism and molecular characterization of a Japanese encephalitis virus strain isolated from pigs in southwest China. Virus Res. 2016, 215, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Li, X.D.; Li, X.F.; Ye, H.Q.; Deng, C.L.; Ye, Q.; Shan, C.; Shang, B.D.; Xu, L.L.; Li, S.H.; Cao, S.B.; et al. Recovery of a chemically synthesized Japanese encephalitis virus reveals two critical adaptive mutations in NS2B and NS4A. J. Gen. Virol. 2014, 95, 806–815. [Google Scholar] [CrossRef] [PubMed]
Protein No. | Protein Name | Gene | NCBI Protein Accession Number | Max Identity (%) | Number of Clones |
---|---|---|---|---|---|
1 | COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) [Homo sapiens] | COPS5 | AAH01859.1 | 99% | 6 |
2 | fibulin-5 precursor [Homo sapiens] | FBLN5 | NP_006320.2 | 100% | 1 |
3 | serine/threonine-protein phosphatase 2A catalytic subunit beta isoform [Homo sapiens] | PPP2CB | NP_001009552.1 | 100% | 1 |
4 | Cereblon [Homo sapiens] | CRBN | AAH17419.1 | 99% | 1 |
5 | dnaJ homolog subfamily B member 6 isoform b [Homo sapiens] | DNAJB6 | NP_005485.1 | 100% | 4 |
6 | ubiquitin-conjugating enzyme E2 N [Homo sapiens] | UBE2N | NP_003339.1 | 99% | 1 |
7 | zinc finger protein 350 [Homo sapiens] | ZNF350 | NP_067645.3 | 100% | 1 |
8 | integral membrane protein GPR137B [Homo sapiens] | GPR137B | NP_003263.1 | 100% | 1 |
Plasmid and Antibody | Source | Identifier |
---|---|---|
pGBKT7-NS3 | Research Center of Swine Disease | N/A |
pCMV-HA-DNAJB6 | Research Center of Swine Disease | N/A |
pEGFP-NS3 | Research Center of Swine Disease | N/A |
SA14/U14163 replicon (Rluc-rep) | [52] | N/A |
Anti-DNAJB6 antibody [EPR17122]-N-terminal | Abcam | Cat#ab198995 |
GAPDH polyclonal antibody | ABclonal Technology | Cat#AC001 |
Monoclonal anti-HA antibody | Sigma Aldrich | Cat#H9658 |
Alexa Fluor 488-conjugated goat anti-rabbit IgG | Beyotime | Cat#A0423 |
Alexa Fluor 555-conjugated donkey anti-mouse IgG | Beyotime | Cat#A0460 |
Mouse and rabbit polyclonal antibodies against JEV Anti-NS3 antibodies | Research Center of Swine Disease | N/A |
Plasmid | Primer Name | Sequence (5′–3′) |
---|---|---|
pGBKT7-NS3 | pGBKT7-NS3-F | CGGGATTCGGGGGCGTGTTCTGGGACACG |
pGBKT7-NS3-R | CGCGTCGACTCTCTTGCCCGCTGCAAAATCC | |
pEGFP-NS3 | pEGFP-NS3-F | CGAGCTCGCCACCATGGGGGGCGTGTTCTGGGACACG |
pEGFP-NS3-R | TCCCCGCGGTCTCTTGCCCGCTGCAAAATCC | |
pCMV-HA-DNAJB6 | HA-DNAJB6-F | CTGAATTCGGATGGTGGATTACTATGAAGTTCTAG |
HA-DNAJB6-R | TGCTCGAGTTACTTGTTATCCAAGCGCAGCA |
Primer Name | Sequence (5′–3′) |
---|---|
JEV-E-F | CAGTGGAGCCACTTGGGTG |
JEV-E-R | TTGTGAGCTTCTCCTGTCG |
DNAJB6-F | ATGCTAAGAAACGGGACA |
DNAJB6-R | ATCTGGGTTACGGAATG |
β-actin-F | GTGGACATCCGCAAAGAC |
β-actin-R | AAAGGGTGTAACGCAACTA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, Y.-Q.; Yuan, L.; Zhao, Q.; Yuan, J.-L.; Miao, C.; Chang, Y.-F.; Wen, X.-T.; Wu, R.; Huang, X.-B.; Wen, Y.-P.; et al. Hsp40 Protein DNAJB6 Interacts with Viral NS3 and Inhibits the Replication of the Japanese Encephalitis Virus. Int. J. Mol. Sci. 2019, 20, 5719. https://doi.org/10.3390/ijms20225719
Cao Y-Q, Yuan L, Zhao Q, Yuan J-L, Miao C, Chang Y-F, Wen X-T, Wu R, Huang X-B, Wen Y-P, et al. Hsp40 Protein DNAJB6 Interacts with Viral NS3 and Inhibits the Replication of the Japanese Encephalitis Virus. International Journal of Molecular Sciences. 2019; 20(22):5719. https://doi.org/10.3390/ijms20225719
Chicago/Turabian StyleCao, Yu-Qin, Lei Yuan, Qin Zhao, Jian-Lin Yuan, Chang Miao, Yung-Fu Chang, Xin-Tian Wen, Rui Wu, Xiao-Bo Huang, Yi-Ping Wen, and et al. 2019. "Hsp40 Protein DNAJB6 Interacts with Viral NS3 and Inhibits the Replication of the Japanese Encephalitis Virus" International Journal of Molecular Sciences 20, no. 22: 5719. https://doi.org/10.3390/ijms20225719
APA StyleCao, Y.-Q., Yuan, L., Zhao, Q., Yuan, J.-L., Miao, C., Chang, Y.-F., Wen, X.-T., Wu, R., Huang, X.-B., Wen, Y.-P., Yan, Q.-G., Huang, Y., Han, X.-F., Ma, X.-P., & Cao, S.-J. (2019). Hsp40 Protein DNAJB6 Interacts with Viral NS3 and Inhibits the Replication of the Japanese Encephalitis Virus. International Journal of Molecular Sciences, 20(22), 5719. https://doi.org/10.3390/ijms20225719