Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners
Abstract
1. Introduction
2. Results
2.1. Effects of Various Concentrations of Metformin on Differentiation and Lipid Accumulation in 3T3-L1 Preadipocytes
2.2. Effects of Metformin on Expression of Adipogenic and Lipogenic Genes in 3T3-L1 Cells
2.3. Effects of Metformin on FASN, C/EBPα, and PPARγ Protein Expression in 3T3-L1 Cells
2.4. Effects of Metformin on Signaling Transduction Pathways in 3T3-L1 Cells
2.5. High Concentration of Metformin Induced Inhibition of Adipogenesis Is Dependent on AMPK Activation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture and 3T3-L1 Cell Differentiation
4.3. Cell Viability Assay
4.4. Oil Red O Staining
4.5. Triglyceride (TG) Measurement
4.6. RNA Exaction and Quantitative Real-Time PCR
4.7. Western Blot
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
Abbreviations
| Met | Metformin |
| Rosi | Rosiglitazone |
| DMI | Differentiation medium I |
| DMII | Differentiation medium II |
| PPARγ | Peroxisome proliferator-activated receptor |
| FASN | fatty acid synthase |
| C/EBPs | CCAAT/enhancer binding proteins |
| C/EBPα | CCAAT/enhancer binding protein α |
| C/EBPβ | CCAAT/enhancer binding protein β |
| FAT | fatty acid translocase |
| CHOP | C/EBP homologous protein |
| SREBP1c | sterol regulatory element-binding protein 1c |
| KLF2 | Krüppel-like Factor 2 |
| KLF5 | Krüppel-like Factor 5 |
| KLF7 | Krüppel-like Factor 7 |
| TGFβ | transforming growth factor β |
| BMP | bone morphogenetic protein |
| IGF | Insulin-like growth factor |
| PI3K | phosphatidylinositide 3-kinases |
| UCP-1 | uncoupling protein 1 |
| BMI | Body Mass Index |
| AMPK | AMP-activated protein kinase |
| JNK | C-Jun N-terminal kinase |
| ERK | Extracellular regulated protein kinases |
References
- Chrysovergis, K.; Wang, X.; Kosak, J.; Lee, S.H.; Kim, J.S.; Foley, J.F.; Travlos, G.; Singh, S.; Baek, S.J.; Eling, T.E. NAG-1/GDF-15 prevents obesity by increasing thermogenesis, lipolysis and oxidative metabolism. Int. J. Obes. (Lond.) 2014, 38, 1555–1564. [Google Scholar] [CrossRef] [PubMed]
- Cristancho, A.G.; Lazar, M.A. Forming functional fat: A growing understanding of adipocyte differentiation. Nat. Rev. Mol. Cell Biol. 2011, 12, 722–734. [Google Scholar] [CrossRef] [PubMed]
- Guariguata, L.; Whiting, D.R.; Hambleton, I.; Beagley, J.; Linnenkamp, U.; Shaw, J.E. Global estimates of diabetes prevalence for 2013 and projections for 2035. Diabetes Res. Clin. Pract. 2014, 103, 137–149. [Google Scholar] [CrossRef] [PubMed]
- Eckel, R.H.; Kahn, S.E.; Ferrannini, E.; Goldfine, A.B.; Nathan, D.M.; Schwartz, M.W.; Smith, R.J.; Smith, S.R. Obesity and type 2 diabetes: What can be unified and what needs to be individualized? J. Clin. Endocrinol. Metab. 2011, 96, 1654–1663. [Google Scholar] [CrossRef] [PubMed]
- Pernicova, I.; Korbonits, M. Metformin-mode of action and clinical implications for diabetes and cancer. Nat. Rev. Endocrinol. 2014, 10, 143–156. [Google Scholar] [CrossRef] [PubMed]
- Desilets, A.R.; Dhakal-Karki, S.; Dunican, K.C. Role of metformin for weight management in patients without type 2 diabetes. Ann. Pharmacother. 2008, 42, 817–826. [Google Scholar] [CrossRef] [PubMed]
- Malin, S.K.; Kashyap, S.R. Effects of metformin on weight loss: Potential mechanisms. Curr. Opin. Endocrinol. Diabetes Obes. 2014, 21, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Rojas, L.B.; Gomes, M.B. Metformin: An old but still the best treatment for type 2 diabetes. Diabetol. Metab. Syndr. 2013, 5, 6. [Google Scholar] [CrossRef] [PubMed]
- Kanto, K.; Ito, H.; Noso, S.; Babaya, N.; Hiromine, Y.; Taketomo, Y.; Toma, J.; Niwano, F.; Yasutake, S.; Kawabata, Y.; et al. Effects of dosage and dosing frequency on the efficacy and safety of high-dose metformin in Japanese patients with type 2 diabetes mellitus. J. Diabetes Investig. 2018, 9, 587–593. [Google Scholar] [CrossRef] [PubMed]
- Alexandre, K.B.; Smit, A.M.; Gray, I.P.; Crowther, N.J. Metformin inhibits intracellular lipid accumulation in the murine pre-adipocyte cell line, 3T3-L1. Diabetes Obes. Metab. 2008, 10, 688–690. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.K.; Lee, S.H.; Jhun, J.Y.; Byun, J.K.; Jeong, J.H.; Lee, S.Y.; Kim, J.K.; Choi, J.Y.; Cho, M.L. Metformin Prevents Fatty Liver and Improves Balance of White/Brown Adipose in an Obesity Mouse Model by Inducing FGF21. Mediat. Inflamm. 2016, 2016, 5813030. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Navarrete, J.M.; Ortega, F.J.; Rodriguez-Hermosa, J.I.; Sabater, M.; Pardo, G.; Ricart, W.; Fernandez-Real, J.M. OCT1 Expression in adipocytes could contribute to increased metformin action in obese subjects. Diabetes 2011, 60, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Kinaan, M.; Ding, H.; Triggle, C.R. Metformin: An Old Drug for the Treatment of Diabetes but a New Drug for the Protection of the Endothelium. Med. Princ. Pract. 2015, 24, 401–415. [Google Scholar] [CrossRef] [PubMed]
- Wilcock, C.; Bailey, C.J. Accumulation of metformin by tissues of the normal and diabetic mouse. Xenobiotica 1994, 24, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Frid, A.; Sterner, G.N.; Londahl, M.; Wiklander, C.; Cato, A.; Vinge, E.; Andersson, A. Novel assay of metformin levels in patients with type 2 diabetes and varying levels of renal function: Clinical recommendations. Diabetes Care 2010, 33, 1291–1293. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Anedda, A.; Rial, E.; Gonzalez-Barroso, M.M. Metformin induces oxidative stress in white adipocytes and raises uncoupling protein 2 levels. J. Endocrinol. 2008, 199, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Tebbe, C.; Chhina, J.; Dar, S.A.; Sarigiannis, K.; Giri, S.; Munkarah, A.R.; Rattan, R. Metformin limits the adipocyte tumor-promoting effect on ovarian cancer. Oncotarget 2014, 5, 4746–4764. [Google Scholar] [CrossRef] [PubMed]
- Lenhard, J.M.; Kliewer, S.A.; Paulik, M.A.; Plunket, K.D.; Lehmann, J.M.; Weiel, J.E. Effects of troglitazone and metformin on glucose and lipid metabolism: Alterations of two distinct molecular pathways. Biochem. Pharmacol. 1997, 54, 801–808. [Google Scholar] [CrossRef]
- Chen, S.C.; Brooks, R.; Houskeeper, J.; Bremner, S.K.; Dunlop, J.; Viollet, B.; Logan, P.J.; Salt, I.P.; Ahmed, S.F.; Yarwood, S.J. Metformin suppresses adipogenesis through both AMP-activated protein kinase (AMPK)-dependent and AMPK-independent mechanisms. Mol. Cell. Endocrinol. 2017, 440, 57–68. [Google Scholar] [CrossRef] [PubMed]
- Lv, C.; Jiang, Y.; Wang, H.; Chen, B. Sfrp5 expression and secretion in adipocytes are up-regulated during differentiation and are negatively correlated with insulin resistance. Cell. Biol. Int. 2012, 36, 851–855. [Google Scholar] [CrossRef] [PubMed]
- Jaganjac, M.; Almuraikhy, S.; Al-Khelaifi, F.; Al-Jaber, M.; Bashah, M.; Mazloum, N.A.; Zarkovic, K.; Zarkovic, N.; Waeg, G.; Kafienah, W.; et al. Combined metformin and insulin treatment reverses metabolically impaired omental adipogenesis and accumulation of 4-hydroxynonenal in obese diabetic patients. Redox Biol. 2017, 12, 483–490. [Google Scholar] [CrossRef] [PubMed]
- Dallaglio, K.; Bruno, A.; Cantelmo, A.R.; Esposito, A.I.; Ruggiero, L.; Orecchioni, S.; Calleri, A.; Bertolini, F.; Pfeffer, U.; Noonan, D.M.; et al. Paradoxic effects of metformin on endothelial cells and angiogenesis. Carcinogenesis 2014, 35, 1055–1066. [Google Scholar] [CrossRef] [PubMed]
- Hadad, S.M.; Appleyard, V.; Thompson, A.M. Therapeutic metformin/AMPK activation promotes the angiogenic phenotype in the ERα negative MDA-MB-435 breast cancer model. Breast Cancer Res. Treat. 2009, 114, 391. [Google Scholar] [CrossRef] [PubMed]
- Orecchioni, S.; Reggiani, F.; Talarico, G.; Mancuso, P.; Calleri, A.; Gregato, G.; Labanca, V.; Noonan, D.M.; Dallaglio, K.; Albini, A.; et al. The biguanides metformin and phenformin inhibit angiogenesis, local and metastatic growth of breast cancer by targeting both neoplastic and microenvironment cells. Int. J. Cancer 2015, 136, E534–E544. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.W.; Deng, Y.P.; Han, X.; Ren, G.F.; Cai, J.; Jiang, G.J. Metformin improves the angiogenic functions of endothelial progenitor cells via activating AMPK/eNOS pathway in diabetic mice. Cardiovasc. Diabetol. 2016, 15, 88. [Google Scholar] [CrossRef] [PubMed]
- Suissa, S.; Azoulay, L. Metformin and the risk of cancer: Time-related biases in observational studies. Diabetes Care 2012, 35, 2665–2673. [Google Scholar] [CrossRef] [PubMed]
- Garber, A.J.; Duncan, T.G.; Goodman, A.M.; Mills, D.J.; Rohlf, J.L. Efficacy of metformin in type II diabetes: Results of a double-blind, placebo-controlled, dose-response trial. Am. J. Med. 1997, 103, 491–497. [Google Scholar] [CrossRef]
- Rosen, E.D.; Walkey, C.J.; Puigserver, P.; Spiegelman, B.M. Transcriptional regulation of adipogenesis. Genes Dev. 2000, 14, 1293–1307. [Google Scholar] [PubMed]
- Ayala-Sumuano, J.T.; Velez-Delvalle, C.; Beltran-Langarica, A.; Marsch-Moreno, M.; Cerbon-Solorzano, J.; Kuri-Harcuch, W. Srebf1a is a key regulator of transcriptional control for adipogenesis. Sci. Rep. 2011, 1, 178. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Torrens, J.I.; Anand, A.; Spiegelman, B.M.; Friedman, J.M. Krox20 stimulates adipogenesis via C/EBPbeta-dependent and -independent mechanisms. Cell Metab. 2005, 1, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Oishi, Y.; Manabe, I.; Tobe, K.; Tsushima, K.; Shindo, T.; Fujiu, K.; Nishimura, G.; Maemura, K.; Yamauchi, T.; Kubota, N.; et al. Kruppel-like transcription factor KLF5 is a key regulator of adipocyte differentiation. Cell Metab. 2005, 1, 27–39. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, S.S.; Feinberg, M.W.; Watanabe, M.; Gray, S.; Haspel, R.L.; Denkinger, D.J.; Kawahara, R.; Hauner, H.; Jain, M.K. The Kruppel-like factor KLF2 inhibits peroxisome proliferator-activated receptor-gamma expression and adipogenesis. J. Biol. Chem. 2003, 278, 2581–2584. [Google Scholar] [CrossRef] [PubMed]
- Tokubuchi, I.; Tajiri, Y.; Iwata, S.; Hara, K.; Wada, N.; Hashinaga, T.; Nakayama, H.; Mifune, H.; Yamada, K. Beneficial effects of metformin on energy metabolism and visceral fat volume through a possible mechanism of fatty acid oxidation in human subjects and rats. PLoS ONE 2017, 12, e0171293. [Google Scholar] [CrossRef] [PubMed]
- Engelman, J.A.; Lisanti, M.P.; Scherer, P.E. Specific inhibitors of p38 mitogen-activated protein kinase block 3T3-L1 adipogenesis. J. Biol. Chem. 1998, 273, 32111–32120. [Google Scholar] [CrossRef] [PubMed]
- Aouadi, M.; Laurent, K.; Prot, M.; Le Marchand-Brustel, Y.; Binetruy, B.; Bost, F. Inhibition of p38MAPK increases adipogenesis from embryonic to adult stages. Diabetes 2006, 55, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.; Ma, F.; Li, W.; Ouyang, S.; Liu, Z.; Wu, J. miR-206-3p Inhibits 3T3-L1 Cell Adipogenesis via the c-Met/PI3K/Akt Pathway. Int. J. Mol. Sci. 2017, 18. [Google Scholar] [CrossRef] [PubMed]
- Bae, S.S.; Cho, H.; Mu, J.; Birnbaum, M.J. Isoform-specific regulation of insulin-dependent glucose uptake by Akt/protein kinase B. J. Biol. Chem. 2003, 278, 49530–49536. [Google Scholar] [CrossRef] [PubMed]
- Garofalo, R.S.; Orena, S.J.; Rafidi, K.; Torchia, A.J.; Stock, J.L.; Hildebrandt, A.L.; Coskran, T.; Black, S.C.; Brees, D.J.; Wicks, J.R.; et al. Severe diabetes, age-dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB β. J. Clin. Investig. 2003, 112, 197–208. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.K.; Lee, J.O.; Kim, J.H.; Kim, S.J.; You, G.Y.; Moon, J.W.; Jung, J.H.; Park, S.H.; Uhm, K.O.; Park, J.M.; et al. Metformin sensitizes insulin signaling through AMPK-mediated PTEN down-regulation in preadipocyte 3T3-L1 cells. J. Cell. Biochem. 2011, 112, 1259–1267. [Google Scholar] [CrossRef] [PubMed]
- Barnes, B.R.; Zierath, J.R. Role of AMP-activated protein kinase in the control of glucose homeostasis. Curr. Mol. Med. 2005, 5, 341–348. [Google Scholar] [CrossRef] [PubMed]
- Jessen, N.; Pold, R.; Buhl, E.S.; Jensen, L.S.; Schmitz, O.; Lund, S. Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT-4 content in rat muscles. J. Appl. Physiol. 2003, 94, 1373–1379. [Google Scholar] [CrossRef] [PubMed]
- Longnus, S.L.; Segalen, C.; Giudicelli, J.; Sajan, M.P.; Farese, R.V.; Van Obberghen, E. Insulin signalling downstream of protein kinase B is potentiated by 5′AMP-activated protein kinase in rat hearts in vivo. Diabetologia 2005, 48, 2591–2601. [Google Scholar] [CrossRef] [PubMed]
- Winder, W.W.; Hardie, D.G. AMP-activated protein kinase, a metabolic master switch: Possible roles in type 2 diabetes. Am. J. Physiol. 1999, 277, E1–E10. [Google Scholar] [CrossRef] [PubMed]
- Bijland, S.; Mancini, S.J.; Salt, I.P. Role of AMP-activated protein kinase in adipose tissue metabolism and inflammation. Clin. Sci. (Lond.) 2013, 124, 491–507. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Zhou, Y.; Xu, A.; Wu, D. Effects of an AMP-activated protein kinase inhibitor, compound C, on adipogenic differentiation of 3T3-L1 cells. Biol. Pharm. Bull. 2008, 31, 1716–1722. [Google Scholar] [CrossRef] [PubMed]
- Nam, M.; Lee, W.H.; Bae, E.J.; Kim, S.G. Compound C inhibits clonal expansion of preadipocytes by increasing p21 level irrespectively of AMPK inhibition. Arch. Biochem. Biophys. 2008, 479, 74–81. [Google Scholar] [CrossRef] [PubMed]







| Primers | Forward | Reverse |
|---|---|---|
| β-Actin | CTGGAACGGTGAAGGTGACA | AAGGAACTTCCTTGAACAATGCA |
| PPARγ | TGTCGGTTTCAGAAGTGCCTTG | TTCAGCTGGTCGATATCACTGGAG |
| FASN | GGAGGTGGTGATAGCCGGTAT | TGGGTAATCCATAGAGCCCAG |
| C/EBPα | CAAGAACAGCAACGAGTACCG | GTCACTCGTCAACTCCAGCAC |
| C/EBPβ | CAAGTTCCGCAGGGTGCT | CCAAGAAGACGGTGGACAA |
| aP2 | GATGCCTTTGTGGGAACCTG | TCCTGTCGTCTGCGGTGATT |
| KROX20 | AGAAGGTTGTGATAGGAGGTTCTC | GTTCGGATGTGAGTAGTAAGGTGG |
| KLF2 | GCCTGTGGGTTCGCTATAAA | AAGGAATGGTCAGCCACATC |
| KLF5 | ACCTCCGTCCTATGCCGCTAC | TCCGGGTTACTCCTTCTGTTGT |
| CHOP | GTCCTGTCCTCAGATGAAATTGG | GCAGGGTCAAGAGTAGTGAAGGTT |
| SREBP1c | CGGCTGTTGTCTACCATAAGCTG | CATAGATCTCTGCCAGTGTTGCC |
| UCP-1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG |
| SCD-1 | GGCTAGCTATCTCTGCGCTC | GAACTGCGCTTGGAAACCTG |
| FAT/CD36 | TGGCCTTACTTGGGATTGG | CCAGTGTATATGTAGGCTCATCCA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, D.; Wang, Y.; Wu, K.; Wang, X. Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners. Int. J. Mol. Sci. 2018, 19, 1547. https://doi.org/10.3390/ijms19061547
Chen D, Wang Y, Wu K, Wang X. Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners. International Journal of Molecular Sciences. 2018; 19(6):1547. https://doi.org/10.3390/ijms19061547
Chicago/Turabian StyleChen, Dian, Ying Wang, Kaikai Wu, and Xingya Wang. 2018. "Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners" International Journal of Molecular Sciences 19, no. 6: 1547. https://doi.org/10.3390/ijms19061547
APA StyleChen, D., Wang, Y., Wu, K., & Wang, X. (2018). Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners. International Journal of Molecular Sciences, 19(6), 1547. https://doi.org/10.3390/ijms19061547
