Next Article in Journal
Analysis of Dermal Papilla Cell Interactome Using STRING Database to Profile the ex Vivo Hair Growth Inhibition Effect of a Vinca Alkaloid Drug, Colchicine
Next Article in Special Issue
Metabolite Profiling of Diverse Rice Germplasm and Identification of Conserved Metabolic Markers of Rice Roots in Response to Long-Term Mild Salinity Stress
Previous Article in Journal
Proteomic Challenges: Sample Preparation Techniques for Microgram-Quantity Protein Analysis from Biological Samples
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella

1
Research Center of Chinese Herbal Resource Science and Engineering, Key Laboratory of Chinese Medicinal Resource from Lingnan, Guangzhou University of Chinese Medicine, Guangzhou 510006, China
2
The Key Laboratory of Technology of Breaking Cell Wall and Application in Chinese Medicine Decoction Pieces, Zhongshan Zhongzhi Pharmaceutical Group, Zhongshan 528437, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2015, 16(2), 3564-3578; https://doi.org/10.3390/ijms16023564
Submission received: 2 December 2014 / Accepted: 27 January 2015 / Published: 5 February 2015
(This article belongs to the Special Issue Metabolomics in the Plant Sciences)

Abstract

:
Ilex asprella, a plant widely used as a folk herbal drug in southern China, produces and stores a large amount of triterpenoid saponins, most of which are of the α-amyrin type. In this study, two oxidosqualene cyclase (OSC) cDNAs, IaAS1 and IaAS2, were cloned from the I. asprella root. Functional characterisation was performed by heterologous expression in the yeast Saccharomyces cerevisiae. Analysis of the resulting products by gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) showed that both genes encode a mixed amyrin synthase, producing α-amyrin and β-amyrin at different ratios. IaAS1, which mainly produces α-amyrin, is the second triterpene synthase so far identified in which the level of α-amyrin produced is ≥80% of total amyrin production. By contrast, IaAS2 mainly synthesises β-amyrin, with a yield of 95%. Gene expression patterns of these two amyrin synthases in roots and leaves of I. asprella were found to be consistent with the content patterns of total saponins. Finally, phylogenetic analysis and multiple sequence alignment of the two amyrin synthases against several known OSCs from other plants were conducted to further elucidate their evolutionary relationship.

Graphical Abstract

1. Introduction

In the plant kingdom, many species synthesise and store triterpenoids as a defense against microbes [1], insects [2] and herbivores [3], which is essential for their survival [4]. Triterpenoids are a diverse group of secondary metabolites that display various important medicinal properties [5], including anti-inflammatory [6], anti-tumour [7] and cholesterol-regulating [8] activities. Despite these important properties, drug development of triterpenoids is hampered by insufficient supply, caused by a low yield from herbal extraction. Therefore, a comprehensive understanding of the triterpenoid biosynthetic pathway is beneficial to meet the increasing demand [9]. Triterpenoid biosynthesis (see Figure 1) requires conjugation of two units of C15 to form squalene, the epoxidation of which produces the important substrate 2,3-oxidosqualene [10]. Furthermore, cyclisation of the 2,3-oxidosqualene, catalysed by oxidosqualene cyclases (OSCs), generates phytosterols or triterpenoids depending on the type of OSC involved [11]. In animals and fungi, 2,3-oxidosqualene is cyclised into sterol in the chair-boat-chair conformation, whereas in plants (especially higher plants), 2,3-oxidosqualene is cyclised through the chair-chair-chair conformation to form triterpenoids [12]. Hence, the cyclisation reaction catalysed by OSCs is considered a pivotal branch point for the biosynthesis of phytosterols and triterpenoids. Although information on the cyclisation mechanism remains limited, researchers believe that this process requires at least four steps: (1) Protonation of the 2,3-oxidosqualene; (2) A polyene addition cascade leading to the formation of specific cyclisation; (3) Shifts of hydride and/or methyl groups to prevent interfering side reactions; and (4) Deprotonation [11,13]. OSCs are the only enzymes responsible for the entire process described above.
Dozens of OSCs, which are named after their respective products (e.g., lanosterol synthases [14], lupeol synthases [15] and β-amyrin synthases (BASs) [16]), have been identified in the past decades. In addition, OSCs producing more than one specific compound, known as multifunctional OSCs, have also been identified in many plants. α-Amyrin and β-amyrin, which can be further transferred into ursane and oleanane, respectively, are the most common pentacyclic triterpenoid precursors in plants. Although many β-amyrin synthases (BASs) have been isolated and characterised, no enzyme producing α-amyrin as its sole product has been identified so far [17]. Multifunctional OSCs yielding α-amyrin could simultaneously synthesise one or more byproducts, such as β-amyrin, lupeol, or other triterpenes.
Ilex asprella, an Aquifoliaceae plant, is wide spread in southern China, especially in the Guangdong province. Due to its outstanding anti-inflammatory activity, it is commonly used in the treatment of flu and wounds [18]. The major chemical components of I. asprella are triterpenoid saponins, most of which are of the α-amyrin type. In our previous research, the transcriptome of I. asprella root was investigated, revealing a series of candidate genes (or fragments) likely to be involved in the biosynthesis of triterpenoid saponins, including nine candidate OSC genes [19]. The goal of this study was to clone and characterise two OSC genes from I. asprella. In addition, gene expression patterns of the two OSC genes in different tissues of I. asprella were analysed.
Figure 1. Biosynthesis of triterpenes catalysed by different types of oxidosqualene cyclase (OSC). Catalysed by a specific OSC, either protosteryl cation or dammarenyl cation could be formed according to different folding conformations of 2,3-oxidosqualene, leading to one or more final product(s).
Figure 1. Biosynthesis of triterpenes catalysed by different types of oxidosqualene cyclase (OSC). Catalysed by a specific OSC, either protosteryl cation or dammarenyl cation could be formed according to different folding conformations of 2,3-oxidosqualene, leading to one or more final product(s).
Ijms 16 03564 g001

2. Results and Discussion

2.1. Gene Isolation and Functional Characterisation

2.1.1. Isolation and Sequence Analysis of Two IaAS Genes

Among the nine candidate OSCs identified in our previous study, there were two full-length cDNAs designated IaAS1 and IaAS2. Two sets of primers were designed to amplify these sequences approximately 100 bp beyond the open reading frame (ORF) at either end of the cDNA. Both sequences were successfully isolated from the I. asprella root library and sequenced. The cDNA of IaAS1 and IaAS2 contain ORFs that encoding proteins of 762 and 761 amino acids with masses of 87.6 and 87.9 kDa, respectively. IaAS1 and IaAS2 exhibit 62% identity to each other in protein sequence. In addition, IaAS1 shares 82% sequence similarity with mixed amyrin synthase (Catharanthus roseus, AFJ19235.1), whereas IaAS2 is 86% identical to β-amyrin synthase (Vitis vinifera, XP_002270934.1). As shown in Figure 2, six QW motifs [(K/R)(G/A)XX(F/Y/W)(L/I/V)XXXQXXXGXW] were found in the protein sequences of both IaAS1 and IaAS2, which are believed to be responsible for strengthening the structure of the enzyme and stabilising its carbocation intermediates, as well as a DCTAE motif, which might play an important role in substrate binding [20,21]. Furthermore, a MWCYCR motif was identified that is believed to be related to the product specificity of BAS [22].
Figure 2. Amino acid sequences of IaAS1 and IaAS2. The conserved QW motifs are highlighted by dashed line boxes, the DCTAE motif is emphasised by a solid line box and the MWCYCR motif is marked by asterisks.
Figure 2. Amino acid sequences of IaAS1 and IaAS2. The conserved QW motifs are highlighted by dashed line boxes, the DCTAE motif is emphasised by a solid line box and the MWCYCR motif is marked by asterisks.
Ijms 16 03564 g002

2.1.2. Gene Cloning and Protein Expression

To elucidate the enzymatic activities of IaAS1 and IaAS2, the core sequences of the two genes were cloned into the expression vector pYES-DEST52 under the control of galactose (GAL) promoter with a 6× His-tag modification and transformed into S. cerevisiae INVSc1, which synthesises 2,3-oxidosqualene endogenously. The equivalent of two OD600 of yeast transformants were harvested at six different time points during 32 h of induction by Gal. Western blot analysis of the total protein extracted from the cells showed that IaAS1 was successfully expressed during the 32 h induction, with a maximum band intensity observed at 16 h (see Figure 3). However, no IaAS2 protein was detected (see Figure 3). This indicated that the expression level of IaAS1 was significantly higher than that of IaAS2, which might have been too low to be detected.
Figure 3. Western blot analysis of IaAS1 and IaAS2 expression in yeast transformants. 1: Negative control (pYES-DEST 52), 2: 0 h, 3: 4 h, 4: 8 h, 5: 16 h, 6: 24 h, 7: 32 h after induction, 8: Positive control (pEXPR-gus).
Figure 3. Western blot analysis of IaAS1 and IaAS2 expression in yeast transformants. 1: Negative control (pYES-DEST 52), 2: 0 h, 3: 4 h, 4: 8 h, 5: 16 h, 6: 24 h, 7: 32 h after induction, 8: Positive control (pEXPR-gus).
Ijms 16 03564 g003

2.1.3. Functional Analysis of IaAS1 and IaAS2 in Yeast

Triterpene products were extracted after 72 h of induction and analysed using gas chromatography (GC). Both IaAS1 and IaAS2 extracts contain two compounds that were not present in the control cells carrying empty vector (see Figure 4). To identify the products of IaAS1 and IaAS2, the cell extracts were submitted to gas chromatography-mass spectrometry (GC-MS) analysis. Two compounds found in IaAS1 and IaAS2 extracts were identified as α-amyrin and β-amyrin, respectively, by comparing their retention times and mass fragment patterns with an authentic standard, indicating that both enzymes are mixed ASs (see Figure 5). α-Amyrin was the major product of IaAS1, with a 4:1 ratio to β-amyrin, whereas β-amyrin was the main product of IaAS2, with a ratio of 19:1 to α-amyrin. Compared with other mixed ASs, IaAS1 exhibits a unique product specificity, with α-amyrin accounting for up to 80% of the enzyme product, second only to MdOSC1 in Malus × domestica [23].
Figure 4. Gas chromatography analysis of the products of IaAS1 and IaAS2 over-expressed in yeast. pYES-DEST52 was served as a negative control and α-amyrin and β-amyrin as standards.
Figure 4. Gas chromatography analysis of the products of IaAS1 and IaAS2 over-expressed in yeast. pYES-DEST52 was served as a negative control and α-amyrin and β-amyrin as standards.
Ijms 16 03564 g004
Figure 5. GC-MS (with an Electron Impact source) analysis of transient IaAS1 and IaAS2 expression. Products were monitored on the basis of the intensity of the base peak (m/z 218), with α-amyrin and β-amyrin as standards. Two peaks identified in both IaAS1 and IaAS2 exhibit the same retention time and MS fragments as the standards.
Figure 5. GC-MS (with an Electron Impact source) analysis of transient IaAS1 and IaAS2 expression. Products were monitored on the basis of the intensity of the base peak (m/z 218), with α-amyrin and β-amyrin as standards. Two peaks identified in both IaAS1 and IaAS2 exhibit the same retention time and MS fragments as the standards.
Ijms 16 03564 g005

2.2. Gene Expression and Chemical Content Patterns

2.2.1. Expression Patterns of the IaAS Genes in Different Tissues of I. asprella

To assay the expression patterns of both AS genes, real-time quantitative polymerase chain reaction (RT-qPCR) was performed on eight different tissues of I. asprella, including stem bark, stem xylem, twig, root bark, root xylem, fibrous roots, tender leaves and mature leaves, with β-tubulin as a reference gene. As shown in Figure 6, relatively higher expression levels were detected for both genes in the roots than in the stems and leaves, indicating that roots might be the primary location of triterpenoid synthesis in I. asprella. IaAS2 exhibits a lower expression level than IaAS1 in all tissues except for the twig. In addition, the gene expression levels observed for both AS genes were in agreement with those observed in the I. asprella root transcriptome characterised in our previous study. Of the nine candidate OSCs identified, IaAS1 was expressed at the highest level (with a FPKM value of 163.4450; FPKM represent for Fragments per kilobase of exon model per million mapped fragments), whereas IaAS2 was expressed at an overall low level (with a FPKM value of 1.7797), indicating that IaAS1 might be the most active triterpene synthase in I. asprella.
Figure 6. Expression patterns of IaAS1 and IaAS2. Relative expression levels of both target genes in different tissues were normalised to the reference gene, β-tubulin, and further evaluated relative to the stem bark sample. Error bars represent the standard errors of the means calculated from three technical replicates.
Figure 6. Expression patterns of IaAS1 and IaAS2. Relative expression levels of both target genes in different tissues were normalised to the reference gene, β-tubulin, and further evaluated relative to the stem bark sample. Error bars represent the standard errors of the means calculated from three technical replicates.
Ijms 16 03564 g006

2.2.2. Localisation Patterns of Triterpenoid Saponins

Chemical analysis was carried out by ultraviolet spectrophotometry after coloration of extracts from the plant tissues listed above. Results (see Figure 7) showed that the total saponin content of roots was higher than that of leaves and stems, indicating that roots might be the major site of triterpenoid saponin storage. The pattern of triterpenoid saponin localisation in roots and leaves were similar to the gene expression patterns of the two ASs described in this study, whereas stems exhibited high gene expression levels, but low triterpenoid saponin content. In summary, triterpenoid saponins are synthesised in all tissues of I. asprella but are stored in the roots and leaves.
Figure 7. Localisation patterns of total saponin in different tissues of I. asprella. Absolute content of total saponins in different tissues were calculated according to a standard curve of a gradient concentration of ursolic acid solution. Error bars represent the standard errors of the means calculated from three technical replicates.
Figure 7. Localisation patterns of total saponin in different tissues of I. asprella. Absolute content of total saponins in different tissues were calculated according to a standard curve of a gradient concentration of ursolic acid solution. Error bars represent the standard errors of the means calculated from three technical replicates.
Ijms 16 03564 g007

2.3. Discussion

I. asprella contains mainly ursane-type triterpenoid saponins. Nine candidate OSC genes were identified in the I. asprella root transcriptome. It was necessary to find out which candidate(s) is/are responsible for the biosynthesis of saponins. Our results demonstrated that IaAS1, which was expressed at the highest level of the candidate OSCs and whose major product is α-amyrin, must play an important role in the biosynthetic process. Although the expression of IaAS2 gene was quite low in I. asprella, the gene is fully functional in yeast. Therefore, the biosynthesis of triterpenoid saponins in I. asprella must be regulated at the gene expression level.

2.3.1. Phylogenetic Analysis of the IaAS Proteins and Other Known OSCs

To extend our knowledge of the two ASs identified in this study, a phylogenetic tree was generated on the basis of the deduced amino acid sequences of plant OSCs with known function (as shown in Figure 8). These OSCs were grouped into two main branches, representing two types of functional products (protosteryl derivates and dammarenyl derivates). In the protosteryl group, lupeol synthases and cycloartenol synthases form two distinguished clades, whereas the dammarenyl group, β-amyrin synthases were intercrossed with mixed amyrin synthases. IaAS1 was grouped with the mixed amyrin synthases, which is consistent with our result described above, reporting heterologous expression. Yet, IaAS2 and the mixed amyrin synthase from Pisum sativum (BAA97559.1) exhibit a closer relationship to the β-amyrin synthases rather than to the mixed amyrin synthases, which synthesise multiple products, including β-amyrin. Thus, a more in-depth examination of the sequences of these OSCs would contribute to understanding the relationships between them.
Figure 8. Bootstrapped neighbour-joining tree of known OSCs. The tree was constructed by MEGA 5.1 software using the neighbour-joining method, with an evaluation method of Bootstrap for 1000 times. AeBAS: Aralia elata (GenBank accession number: ADK12003.1), AtCAS: Arabidopsis thaliana (NP_178722.1), BgBAS: Bruguiera gymnorhiza (BAF80443.1), BpLUS: Betula platyphylla (BAB83087.1), CaCAS: Centella asiatica (AAS01524.1), CrMAS: Catharanthus roseus (AFJ19235.1), DzCAS: Dioscorea zingiberensis (CAM91422.1), EjMAS: Eriobotrya japonica (AFP95334.2), EsCAS: Eleutherococcus senticosus (AFC67276.1), GuBAS: Glycyrrhiza uralensis (ACV21067.1), GuLUS: G. uralensis (BAL41371.1), LjLUS: Lotus japonicus (BAE53430.1), MdMAS: Malus domestica (ACM89977.1), OeLUS: Olea europaea (BAA86930.1), OeMAS: O. europaea (BAF63702.1), PqBAS: Panax quinquefolius (AGG09939.1), PsCAS: Pisum sativum (BAA23533.1), PsMAS: P. sativum (BAA97559.1), SlBAS: Solanum lycopersicum (NP_001234604.1), ToLUS: Taraxacum officinale (BAA86932.1). MAS is for mixed amyrin synthase, while BAS is for β-amyrin synthases, LUS is for lupeol synthases and CAS is for cycloartenol synthases.
Figure 8. Bootstrapped neighbour-joining tree of known OSCs. The tree was constructed by MEGA 5.1 software using the neighbour-joining method, with an evaluation method of Bootstrap for 1000 times. AeBAS: Aralia elata (GenBank accession number: ADK12003.1), AtCAS: Arabidopsis thaliana (NP_178722.1), BgBAS: Bruguiera gymnorhiza (BAF80443.1), BpLUS: Betula platyphylla (BAB83087.1), CaCAS: Centella asiatica (AAS01524.1), CrMAS: Catharanthus roseus (AFJ19235.1), DzCAS: Dioscorea zingiberensis (CAM91422.1), EjMAS: Eriobotrya japonica (AFP95334.2), EsCAS: Eleutherococcus senticosus (AFC67276.1), GuBAS: Glycyrrhiza uralensis (ACV21067.1), GuLUS: G. uralensis (BAL41371.1), LjLUS: Lotus japonicus (BAE53430.1), MdMAS: Malus domestica (ACM89977.1), OeLUS: Olea europaea (BAA86930.1), OeMAS: O. europaea (BAF63702.1), PqBAS: Panax quinquefolius (AGG09939.1), PsCAS: Pisum sativum (BAA23533.1), PsMAS: P. sativum (BAA97559.1), SlBAS: Solanum lycopersicum (NP_001234604.1), ToLUS: Taraxacum officinale (BAA86932.1). MAS is for mixed amyrin synthase, while BAS is for β-amyrin synthases, LUS is for lupeol synthases and CAS is for cycloartenol synthases.
Ijms 16 03564 g008

2.3.2. Unique Residues and the Catalytic Specificities of Different OSCs

In addition to creating a phylogenetic tree, the protein sequences of these OSCs were subjected to multiple alignment analysis. Unique residues were distinguished and are listed in Table 1. The aromatic residues Trp257 and Tyr259 (corresponding to Trp259 and Tyr261, respectively, in Panax ginseng BAS [12]) for the MWCYCR motif (aa 256–261) are believed to be crucial for β-amyrin specificity [23]. Substitution of Trp257 with a leucine residue might result in different product specificity for lupeol. Meanwhile, exchange of Tyr259 for a histidine residue might be responsible for the biosynthesis of cycloartenol. MASs, BASs and LUSs all have two important residues (SerPhe) in the MQSFGSQ motif (aa 409–416), which correspond to their catalytic differences; whereas those residues in CASs were altered to three residues (GlyTyrAsn). Moreover, MASs contain several unique residues at various positions not found in the other three synthases, including Ser (or Pro) 137, Thr263, Tyr (or Gln) 354, Ser (or Pro) 373, Gln (or Met) 375, Leu (or Val) 617, Thr677 and Asp715. The sequence characteristics of these OSCs provide possible explanations for their relationships in the phylogenetic tree described above.
Table 1. Comparison of special sites in the amino acid sequences of 22 known OSCs.
Table 1. Comparison of special sites in the amino acid sequences of 22 known OSCs.
OSCs137254256–261263317354373375409–416614617677715
IaAS1SAMWCYCRTTYSQMQSF-GSQILTD
CrMASSAMWCYCRTSYSQMQSF-GSQILTD
EjMASPSMFCYCRTGQPMMQSF-GSQIVTD
MdMASPSMFCYCRTGQPMMQSF-GSQIVTD
OeMASSAMWCYCRTSYSQMQSF-GSQILTD
PsMASTAMLCYCRVPHVCLHSF-GSQITSE
IaAS2TAMWCYCRIPHVCMQSF-GSQVTSE
AeBASTAMWCYCRVPHVCMQSF-GSQVTSE
BgBASTAMWCYCRVPHVCMQSF-GSQVTSE
CuBASTAMWCYCRVPHVCMQSF-GSQVTSE
PgBASTAMWCYCRVPHVCMQSF-GSQVTSE
SlBASTAMWCYCRVPHVCMQSF-GSQVTSE
BpLUSTGILCYSRVPHVCMQSF-GCQVISE
GuLUSTGMLCYCRVPHVCIQSF-GCQITAE
LjLUSTGMLCYCRVPHVYIQSF-GSQITAD
OeLUSTGMLCYCRVPHVCMQSF-GCQITSE
ToLUSTGMLCYCRVPHVCMQSF-GCQITSE
AtCASTGMWCHCRVPHVNMQGYNGSQVTSE
CaCASTGMWCHCRVPHVNMQGYNGSQVTSE
DzCASTGMWCHCRVPHVNMQGYNGSQVTPE
EsCASTGMWCHCRVPHVNMQGYNGSQVTSE
PsCASTGMWCHCRVPHVNMQGYNGSQVTSE
Although the enzymatic mechanism of OSCs remains to be elucidated, it has been hypothesised that their product specificity depends on differential rearrangement and deprotonation of the intermediates, which are guided by residues in the active site [24]. Thus, the distinguishing residues presented above might determine the catalytic specificity of MASs, which remains to be authenticated by experiments such as site-directed mutagenesis or domain swapping. Meanwhile, those specific residues might demonstrate a developing molecular evolution of OSCs, which is supported by the diverse specificities of OSCs in different species and by the coexistence of multiple OSC genes in one species. Researchers have suggested that LUS and BAS evolved from a common ancestor, CAS [25]. It has been hypothesised that an increasing evolution in MAS might arise from BAS. In the nine candidate OSCs identified in I. asprella root, only two were characterised in this study. Characterisation of the other seven candidates will help to more systematically elucidate the evolutionary relationship of OSCs in I. asprella.

3. Experimental Section

3.1. Materials

Three-year-old potted I. asprella were kindly provided by Nanling Pharmaceutical Co. Lit. Escherichia coli DH 5α (Invitrogen, Carlsbad, CA, USA) and S. cerevisiae INVSc1 (Invitrogen) were stored and cultivated in our laboratory. α-Amyrin and β-amyrin of 98.5% purity were purchased from Sigma-Aldrich (Shanghai, China). Ursolic acid of 98.0% purity was obtained from Guangdong Institute for Food and Drug Control (Guangzhou, China). Other enzymes, unless otherwise specified, were purchased from TAKARA (Otsu City, Japan).
3.2. cDNA Preparation and Cloning of AS Genes
Total RNA was extracted from the roots of I. asprella using RNAiso Plus (TAKARA) and Fruit-mate™ (TAKARA) for RNA Purification. Then, polyadenylated RNA was isolated and translated into cDNA using oligo(dT) primers by following the protocol of the PrimeScript™ RT-PCR Kit (TAKARA). The cDNA served as a template for amplifying the core sequences of IaAS1 and IaAS2 using high fidelity DNA polymerase with two sets of gene-specific primers (IaAS1-F and IaAS1-R, and IaAS2-F and IaAS2-R; see Table 2) under the following cycling conditions: 98 °C for 2 min; 30 cycles of 98 °C for 10 s, 50 °C for 15 s, 72 °C for 15 s; and 72 °C for 5 min. The resulting PCR products, following the addition of an A-tail, were ligated into the pGEM-T easy vector (Promega, Madison, WI, USA), transformed into DH 5α E. coli and submitted for sequencing.
Table 2. List of primers used in this study.
Table 2. List of primers used in this study.
Primer IDPrimer Sequence (5'→3')Length (bp)
IaAS1-FTCTCTCTGTGTTTATGGGTA20
IaAS1-RGAACACTGAAGGATACAAAC20
IaAS2-FGCCACAGTTATCTTCGTATT20
IaAS2-RCATACTTCAAGGACCTCAAA20
attB1-IaAS1AAAAAGCAGGCTTCATGTGGAAGCTTAAGATTGC34
attB2-IaAS1AGAAAGCTGGGTCGACATTCTGGGAAGGTGACC33
attB1-IaAS2AAAAAGCAGGCTTCATGTGGAGGCTGAAGATTGC34
attB2-IaAS2AGAAAGCTGGGTCCCACAGGCTTTTTGATGG31
attB1GGGGACAAGTTTGTACAAAAAAGCAGGCT29
attB2GGGGACCACTTTGTACAAGAAAGCTGGGT29
RTIaAS1-FGTACGCTGGACAGGCTGAGAG21
RTIaAS1-RCGCCTACGGTATTCACCAAGT21
RTIaAS2-FGCATGGGAGCCAACAGGAG19
RTIaAS2-RTCTTCGAGGAACCGAACAGC20
TUA-FTATCGCCAGCTTTTCCATCC20
TUA-RCCACCACCAACAGCACTAAAC21

3.3. Construction of Expression Vectors and Yeast Expression

Gateway cloning technology was applied in the construction of expression vectors in this study. pGEM-T easy vectors (Promega) containing the AS core sequences were used as templates for the first round of PCR. PCR amplification using inner primers (attB1-IaAS1, attB2-IaAS1, attB1-IaAS2, attB2-IaAS2; see Table 2) under the following temperature procedure: 98 °C for 2 min; 10 cycles of 98 °C for 10 s, 64 °C for 15 s, 72 °C for 15 s. Next, a set of outer adaptors (attB1 and attB2; see Table 2) were added to the products of the first round of PCR, along with supplementary DNA polymerase. The second round PCR reaction was performed under the following conditions: 98 °C for 2 min; 5 cycles of 98 °C for 10 s, 45 °C for 15 s; 20 cycles of 98 °C for 10 s, 64 °C for 15 s, 72 °C for 15 s; and 72 °C for 5 min.
Next, a BP reaction was carried out by mixing the attB-tailing AS with pDONR vector, catalysed by BP clonase (Invitrogen) to generate pENTR vector containing the target gene in a proper reading frame. The resulting pENTR vectors were transformed into DH 5α E. coli and then submitted to sequencing to select vectors positive for fusion products. pENTR vectors were then used for the LR reaction, together with the pYES-DEST52 vector (Invitrogen), to generate the expression vectors pEXPR-IaAS1 and pEXPR-IaAS2, which could be translated into proteins with a V5 antigen epitope and a 6× His tag. The pEXPR-gus vector, resulting from a pENTR-gus provided with the LR clonase Kit (Invitrogen), served as a positive control. Finally, S. cerevisia strain INVSc1 were transformed with pEXPR-IaAS1 and pEXPR-IaAS2 using a standard lithium acetate protocol [26], with pYES-DEST52 as the negative control and pEXPR-gus as the positive control.

3.4. Protein Expression

After overnight growth in SC-U media containing 2% raffinose, transformant yeast was isolated and resuspended in SC-U media containing 2% galactose for inductive cultivation. An equivalent of two OD600 cells were harvested at different time points over a period of 32 h and extracted for total protein. V5 mouse monoclonal antibody (Invitrogen) was used to identify target proteins with a V5 epitope by Western blotting.

3.5. GC and GC-MS Analysis

Yeast cells incubated in induction media for 72 h were collected and refluxed in 20% KOH/50% EtOH for 30 min, then extracted with hexane. Extracts were evaporated to dryness, resuspended in methanol and submitted to GC and GC-MS analysis directly. GC analysis was performed on an Agilent 7890B GC machine equipped with a flame ionisation detector (FID) and an HP-5MS column (0.25 mm × 30 m × 0.25 μm, Agilent, Santa Clara, CA, USA). The column temperature was set at 80 °C for 1 min, followed by a 20 °C/min ramp to 310 °C, held at 310 °C for 15 min. Injector and detector temperatures were both set at 250 °C. The sample was injected into a splitless injection mode and the carrier gas was helium with a flow rate of 1.2 mL/min. GC-MS was performed on a 6890C GC machine with a HP5973MSD mass spectrometer and a DB-5MS column (0.25 mm × 30 m × 0.25 μm, Agilent). The column temperature was initially held at 80 °C for 1 min then raised to 280 °C at a rate of 10 °C/min, and held at 280 °C for 3 min. The injector was set at a 10:1 split stream mode, with a temperature of 250 °C. The flow rate of helium carrier gas was 0.7 mL/min. Ionisation of samples was performed by electron impact at 70 eV to estimate the chemical structure, with a mass range acquired over m/z 29–500. The ion source temperature was held at 230 °C and the GC transfer line at 280 °C. For quantification, samples were run in selected ion mode, detecting ions 218 and 426.

3.6. RT-qPCR Analysis

Total RNA was isolated from different tissues of I. asprella and was reverse transcribed to cDNA with an equivalent amount of 1 μg total RNA for each sample as described above in three biological replicates. qPCR reactions were carried out on a CFX96 machine (Bio-Rad, Hercules, CA, USA). Reactions were performed in triplicate with 2 μL four-fold diluted cDNA, 10 μL SsoFast Eva Green Supermix (Bio-Rad) and 0.5 μL gene specific primers (RTIaAS1-F and RTIaAS1-R, and RTIaAS2-F and RTIaAS2-R; see Table 2) to a final volume of 20 μL, and run under the following conditions: 94 °C for 30 s; 40 cycles of 94 °C for 5 s, 60 °C for 5 s; and a raise from 65–95 °C at a rate of 5 °C/s. A negative control of distilled water was included in each run.

3.7. Chemical Analysis of Total Saponin Content

One gram of plant tissue was dried, crushed into a fine powder and extracted in 20-fold 70% ethanol for 30 min with ultrasonic treatment, filtered and metered to a volume of 50 mL. One hundred microliters of extract was removed and dried by evaporation. Then, 0.4 mL vanillin-glacial acetic acid and 1.6 mL perchloric acid were added, incubated at 60 °C for 15 min, then cooled at 4 °C for 2 min, and diluted to a volume of 10 mL. An equivalent volume of coloured extracts were detected at an absorbance of 545 nm and quantitated with a standard curve established by detection of a series of concentrations of standard ursolic acid, according to the method described by Uematsu et al. [27] and Zhao et al. [28]. The same procedure was followed for distilled water to establish a blank control.

4. Conclusions

To date, dozens of triterpenoid saponins have been isolated from I. asprella roots and leaves and characterised. Their chemical distribution patterns are supported by the discovery of several OSCs and their product specificities in the organism. Information describing the relationship between gene expression and terpenoid biosynthesis is limited, yet worth exploring. In addition, identification of candidate P450s and UTGs responsible for the downstream biosynthesis of triterpenoid saponins in I. asprella is imperative. Moreover, elicitor-induced expression regulation in vitro or cultivated I. asprella would be beneficial for better understanding the contribution of these biosynthetic enzymes. In our study, a rough picture of chemical and gene expression patterns in I. asprella was presented. A more thorough analysis of the remaining paralogous OSCs and the metabolomics data will help build a clear image of triterpenoid saponin biosynthesis of I. asprella.

Acknowledgments

This study was financially supported by the following sources of funding: (1) The Guangdong Higher Education Subject and Profession Fund for Special Purposes (Trundle Support for Key Laboratory), 2013CXZDA011 and (2) Guangdong Technology Plan Fund for Standardized Cultivation Technology Research of Herbal Medicine in Sanjiuweitai and Ganmaoling, 2012A030100006.

Author Contributions

Xiasheng Zheng contributed to all the research and to the writing of this manuscript; Xiuxiu Luo, Guobing Ye and Ye Chen helped with the gene isolation, gene cloning and functional characterization experiments; Xiaoyu Ji and Lingling Wen carried out the gene expression pattern research; Yaping Xu contributed to the chemical pattern study; Hui Xu was responsible for sequence analysis, phylogenetic analysis and the conserved motif analysis of those OSCs; Ruoting Zhan and Weiwen Chen conceived the study, participated in its design and coordination, and helped to draft the manuscript. All authors read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sawai, S.; Saito, K. Triterpenoid biosynthesis and engineering in plants. Front. Plant Sci. 2011, 2, 25. [Google Scholar] [CrossRef] [PubMed]
  2. Shinoda, T.; Nagao, T.; Nakayama, M.; Serizawa, H.; Koshioka, M.; Okabe, H.; Kawai, A. Identification of a triterpenoid saponin from a crucifer, barbarea vulgaris, as a feeding deterrent to the diamondback moth, Plutella xylostella. J. Chem. Ecol. 2002, 28, 587–599. [Google Scholar] [CrossRef] [PubMed]
  3. Agrelli, J.; Oleszek, W.; Stochmal, A.; Olsen, M.; Anderson, P. Herbivore-induced responses in alfalfa (Medicago sativa). J. Chem. Ecol. 2003, 29, 303–320. [Google Scholar] [CrossRef] [PubMed]
  4. Laurent, P.; Dooms, C.; Braekman, J.C.; Daloze, D.; Habib-Jiwan, J.L.; Rozenberg, R.; Termonia, A.; Pasteels, J.M. Recycling plant wax constituents for chemical defense: Hemi-biosynthesis of triterpene saponins from β-amyrin in a leaf beetle. Naturwissenschaften 2003, 90, 524–527. [Google Scholar] [CrossRef] [PubMed]
  5. Rao, A.V.; Gurfinkel, D.M. The bioactivity of saponins: Triterpenoid and steroidal glycosides. Drug Metab. Drug Interact. 2000, 17, 211–235. [Google Scholar] [CrossRef]
  6. Xu, L.P.; Wang, H.; Yuan, Z. Triterpenoid saponins with anti-inflammatory activity from Codonopsis lanceolata. Planta Med. 2008, 74, 1412–1415. [Google Scholar] [CrossRef] [PubMed]
  7. Yasukawa, K.; Kitanaka, S.; Kawata, K.; Goto, K. Anti-tumor promoters phenolics and triterpenoid from Hippophae rhamnoides. Fitoterapia 2009, 80, 164–167. [Google Scholar] [CrossRef] [PubMed]
  8. Jia, Y.; Bhuiyan, M.J.; Jun, H.J.; Lee, J.H.; Hoang, M.H.; Lee, H.J.; Kim, N.; Lee, D.; Hwang, K.Y.; Hwang, B.Y.; et al. Ursolic acid is a PPAR-α agonist that regulates hepatic lipid metabolism. Bioorg. Med. Chem. Lett. 2011, 21, 5876–5880. [Google Scholar] [CrossRef]
  9. Lee, M.H.; Jeong, J.H.; Seo, J.W.; Shin, C.G.; Kim, Y.S.; In, J.G.; Yang, D.C.; Yi, J.S.; Choi, Y.E. Enhanced triterpene and phytosterol biosynthesis in Panax ginseng overexpressing squalene synthase gene. Plant Cell Physiol. 2004, 45, 976–984. [Google Scholar] [CrossRef] [PubMed]
  10. Haralampidis, K.; Trojanowska, M.; Osbourn, A.E. Biosynthesis of triterpenoid saponins in plants. Adv. Biochem. Eng. Biotechnol. 2002, 75, 31–49. [Google Scholar] [PubMed]
  11. Xu, R.; Fazio, G.C.; Matsuda, S.P. On the origins of triterpenoid skeletal diversity. Phytochemistry 2004, 65, 261–291. [Google Scholar] [CrossRef] [PubMed]
  12. Abe, I. Enzymatic synthesis of cyclic triterpenes. Nat. Prod. Rep. 2007, 24, 1311–1331. [Google Scholar] [CrossRef] [PubMed]
  13. Phillips, D.R.; Rasbery, J.M.; Bartel, B.; Matsuda, S.P. Biosynthetic diversity in plant triterpene cyclization. Curr. Opin. Plant Biol. 2006, 9, 305–314. [Google Scholar] [CrossRef] [PubMed]
  14. Joffrion, T.M.; Collins, M.S.; Sesterhenn, T.; Cushion, M.T. Functional characterization and localization of Pneumocystis carinii lanosterol synthase. Eukaryot. Cell 2010, 9, 107–115. [Google Scholar] [CrossRef] [PubMed]
  15. Hayashi, H.; Huang, P.; Takada, S.; Obinata, M.; Inoue, K.; Shibuya, M.; Ebizuka, Y. Differential expression of three oxidosqualene cyclase mrnas in Glycyrrhiza glabra. Biol. Pharm. Bull. 2004, 27, 1086–1092. [Google Scholar] [CrossRef] [PubMed]
  16. Kajikawa, M.; Yamato, K.T.; Fukuzawa, H.; Sakai, Y.; Uchida, H.; Ohyama, K. Cloning and characterization of a cDNA encoding β-amyrin synthase from petroleum plant Euphorbia tirucalli L. Phytochemistry 2005, 66, 1759–1766. [Google Scholar] [CrossRef] [PubMed]
  17. Huang, L.; Li, J.; Ye, H.; Li, C.; Wang, H.; Liu, B.; Zhang, Y. Molecular characterization of the pentacyclic triterpenoid biosynthetic pathway in Catharanthus roseus. Planta 2012, 236, 1571–1581. [Google Scholar] [CrossRef] [PubMed]
  18. Zheng, X.; Yuan, Y.; Xu, H.; Zhan, R.; Chen, W.; Han, Z. Study on TLC identification and HPLC fingerprint of Ilex asprella. Chin. J. Exp. Tradit. Med. Formula 2013, 21, 123–126. [Google Scholar]
  19. Zheng, X.; Xu, H.; Ma, X.; Zhan, R.; Chen, W. Triterpenoid saponin biosynthetic pathway profiling and candidate gene mining of the Ilex asprella root using RNA-seq. Int. J. Mol. Sci. 2014, 15, 5970–5987. [Google Scholar] [CrossRef] [PubMed]
  20. Poralla, K.; Hewelt, A.; Prestwich, G.D.; Abe, I.; Reipen, I.; Sprenger, G. A specific amino acid repeat in squalene and oxidosqualene cyclases. Trends Biochem. Sci. 1994, 19, 157–158. [Google Scholar] [CrossRef] [PubMed]
  21. Abe, I.; Prestwich, G.D. Molecular cloning, characterization, and functional expression of rat oxidosqualene cyclase cDNA. Proc. Natl. Acad. Sci. USA 1995, 92, 9274–9278. [Google Scholar] [CrossRef] [PubMed]
  22. Kushiro, T.; Shibuya, M.; Masuda, K.; Ebizuka, Y. Mutational studies on triterpene synthases: Engineering lupeol synthase into β-amyrin synthase. J. Am. Chem. Soc. 2000, 122, 6816–6824. [Google Scholar] [CrossRef]
  23. Brendolise, C.; Yauk, Y.K.; Eberhard, E.D.; Wang, M.; Chagne, D.; Andre, C.; Greenwood, D.R.; Beuning, L.L. An unusual plant triterpene synthase with predominant α-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus × domestica. FEBS J. 2011, 278, 2485–2499. [Google Scholar] [CrossRef] [PubMed]
  24. Lodeiro, S.; Xiong, Q.; Wilson, W.K.; Kolesnikova, M.D.; Onak, C.S.; Matsuda, S.P. An oxidosqualene cyclase makes numerous products by diverse mechanisms: A challenge to prevailing concepts of triterpene biosynthesis. J. Am. Chem. Soc. 2007, 129, 11213–11222. [Google Scholar] [CrossRef] [PubMed]
  25. Shibuya, M.; Zhang, H.; Endo, A.; Shishikura, K.; Kushiro, T.; Ebizuka, Y. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases. Eur. J. Biochem. 1999, 266, 302–307. [Google Scholar] [CrossRef] [PubMed]
  26. Gietz, R.D.; Woods, R.A. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 2002, 350, 87–96. [Google Scholar] [PubMed]
  27. Uematsu, Y.; Hirata, K.; Saito, K.; Kudo, I. Spectrophotometric determination of saponin in yucca extract used as food additive. J. AOAC Int. 2000, 83, 1451–1454. [Google Scholar] [PubMed]
  28. Zhao, R.; Peng, M.; Zhang, M.; Wang, H.; Lai, X.; Chen, J.; Li, G. Optimization of extraction process for total saponins from roots of Ilex asprella by response surface methodology. Tradit. Chin. Drug Res. Clin. Pharmacol. 2014, 25, 363–367. [Google Scholar]

Share and Cite

MDPI and ACS Style

Zheng, X.; Luo, X.; Ye, G.; Chen, Y.; Ji, X.; Wen, L.; Xu, Y.; Xu, H.; Zhan, R.; Chen, W. Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. Int. J. Mol. Sci. 2015, 16, 3564-3578. https://doi.org/10.3390/ijms16023564

AMA Style

Zheng X, Luo X, Ye G, Chen Y, Ji X, Wen L, Xu Y, Xu H, Zhan R, Chen W. Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. International Journal of Molecular Sciences. 2015; 16(2):3564-3578. https://doi.org/10.3390/ijms16023564

Chicago/Turabian Style

Zheng, Xiasheng, Xiuxiu Luo, Guobing Ye, Ye Chen, Xiaoyu Ji, Lingling Wen, Yaping Xu, Hui Xu, Ruoting Zhan, and Weiwen Chen. 2015. "Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella" International Journal of Molecular Sciences 16, no. 2: 3564-3578. https://doi.org/10.3390/ijms16023564

APA Style

Zheng, X., Luo, X., Ye, G., Chen, Y., Ji, X., Wen, L., Xu, Y., Xu, H., Zhan, R., & Chen, W. (2015). Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. International Journal of Molecular Sciences, 16(2), 3564-3578. https://doi.org/10.3390/ijms16023564

Article Metrics

Back to TopTop