Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella
Abstract
:1. Introduction
2. Results and Discussion
2.1. Gene Isolation and Functional Characterisation
2.1.1. Isolation and Sequence Analysis of Two IaAS Genes
2.1.2. Gene Cloning and Protein Expression
2.1.3. Functional Analysis of IaAS1 and IaAS2 in Yeast
2.2. Gene Expression and Chemical Content Patterns
2.2.1. Expression Patterns of the IaAS Genes in Different Tissues of I. asprella
2.2.2. Localisation Patterns of Triterpenoid Saponins
2.3. Discussion
2.3.1. Phylogenetic Analysis of the IaAS Proteins and Other Known OSCs
2.3.2. Unique Residues and the Catalytic Specificities of Different OSCs
OSCs | 137 | 254 | 256–261 | 263 | 317 | 354 | 373 | 375 | 409–416 | 614 | 617 | 677 | 715 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IaAS1 | S | A | MWCYCR | T | T | Y | S | Q | MQSF-GSQ | I | L | T | D |
CrMAS | S | A | MWCYCR | T | S | Y | S | Q | MQSF-GSQ | I | L | T | D |
EjMAS | P | S | MFCYCR | T | G | Q | P | M | MQSF-GSQ | I | V | T | D |
MdMAS | P | S | MFCYCR | T | G | Q | P | M | MQSF-GSQ | I | V | T | D |
OeMAS | S | A | MWCYCR | T | S | Y | S | Q | MQSF-GSQ | I | L | T | D |
PsMAS | T | A | MLCYCR | V | P | H | V | C | LHSF-GSQ | I | T | S | E |
IaAS2 | T | A | MWCYCR | I | P | H | V | C | MQSF-GSQ | V | T | S | E |
AeBAS | T | A | MWCYCR | V | P | H | V | C | MQSF-GSQ | V | T | S | E |
BgBAS | T | A | MWCYCR | V | P | H | V | C | MQSF-GSQ | V | T | S | E |
CuBAS | T | A | MWCYCR | V | P | H | V | C | MQSF-GSQ | V | T | S | E |
PgBAS | T | A | MWCYCR | V | P | H | V | C | MQSF-GSQ | V | T | S | E |
SlBAS | T | A | MWCYCR | V | P | H | V | C | MQSF-GSQ | V | T | S | E |
BpLUS | T | G | ILCYSR | V | P | H | V | C | MQSF-GCQ | V | I | S | E |
GuLUS | T | G | MLCYCR | V | P | H | V | C | IQSF-GCQ | I | T | A | E |
LjLUS | T | G | MLCYCR | V | P | H | V | Y | IQSF-GSQ | I | T | A | D |
OeLUS | T | G | MLCYCR | V | P | H | V | C | MQSF-GCQ | I | T | S | E |
ToLUS | T | G | MLCYCR | V | P | H | V | C | MQSF-GCQ | I | T | S | E |
AtCAS | T | G | MWCHCR | V | P | H | V | N | MQGYNGSQ | V | T | S | E |
CaCAS | T | G | MWCHCR | V | P | H | V | N | MQGYNGSQ | V | T | S | E |
DzCAS | T | G | MWCHCR | V | P | H | V | N | MQGYNGSQ | V | T | P | E |
EsCAS | T | G | MWCHCR | V | P | H | V | N | MQGYNGSQ | V | T | S | E |
PsCAS | T | G | MWCHCR | V | P | H | V | N | MQGYNGSQ | V | T | S | E |
3. Experimental Section
3.1. Materials
Primer ID | Primer Sequence (5'→3') | Length (bp) |
---|---|---|
IaAS1-F | TCTCTCTGTGTTTATGGGTA | 20 |
IaAS1-R | GAACACTGAAGGATACAAAC | 20 |
IaAS2-F | GCCACAGTTATCTTCGTATT | 20 |
IaAS2-R | CATACTTCAAGGACCTCAAA | 20 |
attB1-IaAS1 | AAAAAGCAGGCTTCATGTGGAAGCTTAAGATTGC | 34 |
attB2-IaAS1 | AGAAAGCTGGGTCGACATTCTGGGAAGGTGACC | 33 |
attB1-IaAS2 | AAAAAGCAGGCTTCATGTGGAGGCTGAAGATTGC | 34 |
attB2-IaAS2 | AGAAAGCTGGGTCCCACAGGCTTTTTGATGG | 31 |
attB1 | GGGGACAAGTTTGTACAAAAAAGCAGGCT | 29 |
attB2 | GGGGACCACTTTGTACAAGAAAGCTGGGT | 29 |
RTIaAS1-F | GTACGCTGGACAGGCTGAGAG | 21 |
RTIaAS1-R | CGCCTACGGTATTCACCAAGT | 21 |
RTIaAS2-F | GCATGGGAGCCAACAGGAG | 19 |
RTIaAS2-R | TCTTCGAGGAACCGAACAGC | 20 |
TUA-F | TATCGCCAGCTTTTCCATCC | 20 |
TUA-R | CCACCACCAACAGCACTAAAC | 21 |
3.3. Construction of Expression Vectors and Yeast Expression
3.4. Protein Expression
3.5. GC and GC-MS Analysis
3.6. RT-qPCR Analysis
3.7. Chemical Analysis of Total Saponin Content
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Sawai, S.; Saito, K. Triterpenoid biosynthesis and engineering in plants. Front. Plant Sci. 2011, 2, 25. [Google Scholar] [CrossRef] [PubMed]
- Shinoda, T.; Nagao, T.; Nakayama, M.; Serizawa, H.; Koshioka, M.; Okabe, H.; Kawai, A. Identification of a triterpenoid saponin from a crucifer, barbarea vulgaris, as a feeding deterrent to the diamondback moth, Plutella xylostella. J. Chem. Ecol. 2002, 28, 587–599. [Google Scholar] [CrossRef] [PubMed]
- Agrelli, J.; Oleszek, W.; Stochmal, A.; Olsen, M.; Anderson, P. Herbivore-induced responses in alfalfa (Medicago sativa). J. Chem. Ecol. 2003, 29, 303–320. [Google Scholar] [CrossRef] [PubMed]
- Laurent, P.; Dooms, C.; Braekman, J.C.; Daloze, D.; Habib-Jiwan, J.L.; Rozenberg, R.; Termonia, A.; Pasteels, J.M. Recycling plant wax constituents for chemical defense: Hemi-biosynthesis of triterpene saponins from β-amyrin in a leaf beetle. Naturwissenschaften 2003, 90, 524–527. [Google Scholar] [CrossRef] [PubMed]
- Rao, A.V.; Gurfinkel, D.M. The bioactivity of saponins: Triterpenoid and steroidal glycosides. Drug Metab. Drug Interact. 2000, 17, 211–235. [Google Scholar] [CrossRef]
- Xu, L.P.; Wang, H.; Yuan, Z. Triterpenoid saponins with anti-inflammatory activity from Codonopsis lanceolata. Planta Med. 2008, 74, 1412–1415. [Google Scholar] [CrossRef] [PubMed]
- Yasukawa, K.; Kitanaka, S.; Kawata, K.; Goto, K. Anti-tumor promoters phenolics and triterpenoid from Hippophae rhamnoides. Fitoterapia 2009, 80, 164–167. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; Bhuiyan, M.J.; Jun, H.J.; Lee, J.H.; Hoang, M.H.; Lee, H.J.; Kim, N.; Lee, D.; Hwang, K.Y.; Hwang, B.Y.; et al. Ursolic acid is a PPAR-α agonist that regulates hepatic lipid metabolism. Bioorg. Med. Chem. Lett. 2011, 21, 5876–5880. [Google Scholar] [CrossRef]
- Lee, M.H.; Jeong, J.H.; Seo, J.W.; Shin, C.G.; Kim, Y.S.; In, J.G.; Yang, D.C.; Yi, J.S.; Choi, Y.E. Enhanced triterpene and phytosterol biosynthesis in Panax ginseng overexpressing squalene synthase gene. Plant Cell Physiol. 2004, 45, 976–984. [Google Scholar] [CrossRef] [PubMed]
- Haralampidis, K.; Trojanowska, M.; Osbourn, A.E. Biosynthesis of triterpenoid saponins in plants. Adv. Biochem. Eng. Biotechnol. 2002, 75, 31–49. [Google Scholar] [PubMed]
- Xu, R.; Fazio, G.C.; Matsuda, S.P. On the origins of triterpenoid skeletal diversity. Phytochemistry 2004, 65, 261–291. [Google Scholar] [CrossRef] [PubMed]
- Abe, I. Enzymatic synthesis of cyclic triterpenes. Nat. Prod. Rep. 2007, 24, 1311–1331. [Google Scholar] [CrossRef] [PubMed]
- Phillips, D.R.; Rasbery, J.M.; Bartel, B.; Matsuda, S.P. Biosynthetic diversity in plant triterpene cyclization. Curr. Opin. Plant Biol. 2006, 9, 305–314. [Google Scholar] [CrossRef] [PubMed]
- Joffrion, T.M.; Collins, M.S.; Sesterhenn, T.; Cushion, M.T. Functional characterization and localization of Pneumocystis carinii lanosterol synthase. Eukaryot. Cell 2010, 9, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, H.; Huang, P.; Takada, S.; Obinata, M.; Inoue, K.; Shibuya, M.; Ebizuka, Y. Differential expression of three oxidosqualene cyclase mrnas in Glycyrrhiza glabra. Biol. Pharm. Bull. 2004, 27, 1086–1092. [Google Scholar] [CrossRef] [PubMed]
- Kajikawa, M.; Yamato, K.T.; Fukuzawa, H.; Sakai, Y.; Uchida, H.; Ohyama, K. Cloning and characterization of a cDNA encoding β-amyrin synthase from petroleum plant Euphorbia tirucalli L. Phytochemistry 2005, 66, 1759–1766. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Li, J.; Ye, H.; Li, C.; Wang, H.; Liu, B.; Zhang, Y. Molecular characterization of the pentacyclic triterpenoid biosynthetic pathway in Catharanthus roseus. Planta 2012, 236, 1571–1581. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Yuan, Y.; Xu, H.; Zhan, R.; Chen, W.; Han, Z. Study on TLC identification and HPLC fingerprint of Ilex asprella. Chin. J. Exp. Tradit. Med. Formula 2013, 21, 123–126. [Google Scholar]
- Zheng, X.; Xu, H.; Ma, X.; Zhan, R.; Chen, W. Triterpenoid saponin biosynthetic pathway profiling and candidate gene mining of the Ilex asprella root using RNA-seq. Int. J. Mol. Sci. 2014, 15, 5970–5987. [Google Scholar] [CrossRef] [PubMed]
- Poralla, K.; Hewelt, A.; Prestwich, G.D.; Abe, I.; Reipen, I.; Sprenger, G. A specific amino acid repeat in squalene and oxidosqualene cyclases. Trends Biochem. Sci. 1994, 19, 157–158. [Google Scholar] [CrossRef] [PubMed]
- Abe, I.; Prestwich, G.D. Molecular cloning, characterization, and functional expression of rat oxidosqualene cyclase cDNA. Proc. Natl. Acad. Sci. USA 1995, 92, 9274–9278. [Google Scholar] [CrossRef] [PubMed]
- Kushiro, T.; Shibuya, M.; Masuda, K.; Ebizuka, Y. Mutational studies on triterpene synthases: Engineering lupeol synthase into β-amyrin synthase. J. Am. Chem. Soc. 2000, 122, 6816–6824. [Google Scholar] [CrossRef]
- Brendolise, C.; Yauk, Y.K.; Eberhard, E.D.; Wang, M.; Chagne, D.; Andre, C.; Greenwood, D.R.; Beuning, L.L. An unusual plant triterpene synthase with predominant α-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus × domestica. FEBS J. 2011, 278, 2485–2499. [Google Scholar] [CrossRef] [PubMed]
- Lodeiro, S.; Xiong, Q.; Wilson, W.K.; Kolesnikova, M.D.; Onak, C.S.; Matsuda, S.P. An oxidosqualene cyclase makes numerous products by diverse mechanisms: A challenge to prevailing concepts of triterpene biosynthesis. J. Am. Chem. Soc. 2007, 129, 11213–11222. [Google Scholar] [CrossRef] [PubMed]
- Shibuya, M.; Zhang, H.; Endo, A.; Shishikura, K.; Kushiro, T.; Ebizuka, Y. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases. Eur. J. Biochem. 1999, 266, 302–307. [Google Scholar] [CrossRef] [PubMed]
- Gietz, R.D.; Woods, R.A. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 2002, 350, 87–96. [Google Scholar] [PubMed]
- Uematsu, Y.; Hirata, K.; Saito, K.; Kudo, I. Spectrophotometric determination of saponin in yucca extract used as food additive. J. AOAC Int. 2000, 83, 1451–1454. [Google Scholar] [PubMed]
- Zhao, R.; Peng, M.; Zhang, M.; Wang, H.; Lai, X.; Chen, J.; Li, G. Optimization of extraction process for total saponins from roots of Ilex asprella by response surface methodology. Tradit. Chin. Drug Res. Clin. Pharmacol. 2014, 25, 363–367. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, X.; Luo, X.; Ye, G.; Chen, Y.; Ji, X.; Wen, L.; Xu, Y.; Xu, H.; Zhan, R.; Chen, W. Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. Int. J. Mol. Sci. 2015, 16, 3564-3578. https://doi.org/10.3390/ijms16023564
Zheng X, Luo X, Ye G, Chen Y, Ji X, Wen L, Xu Y, Xu H, Zhan R, Chen W. Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. International Journal of Molecular Sciences. 2015; 16(2):3564-3578. https://doi.org/10.3390/ijms16023564
Chicago/Turabian StyleZheng, Xiasheng, Xiuxiu Luo, Guobing Ye, Ye Chen, Xiaoyu Ji, Lingling Wen, Yaping Xu, Hui Xu, Ruoting Zhan, and Weiwen Chen. 2015. "Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella" International Journal of Molecular Sciences 16, no. 2: 3564-3578. https://doi.org/10.3390/ijms16023564
APA StyleZheng, X., Luo, X., Ye, G., Chen, Y., Ji, X., Wen, L., Xu, Y., Xu, H., Zhan, R., & Chen, W. (2015). Characterisation of Two Oxidosqualene Cyclases Responsible for Triterpenoid Biosynthesis in Ilex asprella. International Journal of Molecular Sciences, 16(2), 3564-3578. https://doi.org/10.3390/ijms16023564