Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China
Abstract
:1. Introdution
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Loci
3.2. Detection of Polymorphism
3.3. Data Analysis
4. Conclusions
Acknowledgments
References
- Utzinger, J.; Zhou, X.N.; Chen, M.G.; Berqquist, R. Conquering schistosomiasis in China: The long march. Acta Trop 2005, 96, 69–96. [Google Scholar]
 - Wang, L.D.; Utzinger, J.; Zhou, X.N. Schistosomiasis control: Experiences and lessons from China. Lancet 2008, 372, 1793–1795. [Google Scholar]
 - Wang, L.D.; Chen, H.G.; Guo, J.G.; Zeng, X.L.; Hong, X.L.; Xiong, J.J.; Wu, X.H.; Wang, X.H.; Wang, L.Y.; Xia, G.; et al. A strategy to control transmission of Schistosoma japonicum in China. N. Engl. J. Med 2009, 360, 121–128. [Google Scholar]
 - Li, S.Z.; Luz, A.; Wang, X.H.; Xu, L.L.; Wang, Q.; Qian, Y.J.; Wu, X.H.; Guo, J.G.; Xia, G.; Wang, L.Y.; et al. Schistosomiasis in China: Acute infections during 2005–2008. Chin. Med. J. (Engl.) 2009, 122, 1009–1014. [Google Scholar]
 - Attwood, S.W.; Upatham, E.S.; Zhang, Y.P.; Yang, Z.Q.; Southgate, V.R. A DNA-sequence based phylogeny for triculine snails (Gastropoda: Pomatiopsidae: Triculinae), intermediate hosts for Schistosoma (Trematoda: Digenea): Phylogeography and the origin of Neotricula. J. Zool. Lond 2004, 262, 47–56. [Google Scholar]
 - Davis, G.M.; Wilke, T.; Zhang, Y.; Xu, X.J.; Qiu, C.P.; Spolsky, C.; Qiu, D.C.; Li, S.Z.; Xia, M.Y.; Feng, Z. Snail-schistosoma, paragonimus interactions in China: Population ecology, genetic diversity, coevolution and emerging diseases. Malacologia 1999, 41, 355–377. [Google Scholar]
 - Zhou, Y.B.; Zhao, G.M.; Peng, W.X. Spatial genetic correlation analyses of Schistosome japonicum intermediate hosts within Oncomelania hupensis (Gastropoda: Rissooidea) from mainland China based on amplified fragment length polymorphisms. Fudan Univ. J. Med. Sci 2007, 34, 207–212. [Google Scholar]
 - Li, S.Z.; Wang, Y.X.; Yang, K.; Liu, Q.; Wang, Q.; Zhang, Y.; Wu, X.H.; Guo, J.G.; Bergquist, R.; Zhou, X.N. Landscape genetics: The correlation of spatial and genetic distances of Oncomelania hupensis, the intermediate host snail of Schistosoma japonicum in mainland China. Geospat. Health 2009, 3, 221–231. [Google Scholar]
 - Zhou, X.N.; Guo, J.G.; Wu, X.H.; Jiang, Q.W.; Zheng, J.; Dang, H.; Wang, X.H.; Xu, J.; Zhu, H.Q.; Wu, G.L.; et al. Epidemiology of schistosomiasis in the People’s Republic of China, 2004. Emerg. Infect. Dis 2007, 13, 1470–1476. [Google Scholar]
 - Davis, G.M.; Zhang, Y.; Guo, Y.H. Systematic status of Oncomelania Hupensis (Gastropoda: Pomatiopsidae) throughout China. Stud. Mar. Sin 1997, 39, 89–95. [Google Scholar]
 - Davis, G.M.; Wilke, T.; Zhang, Y.; Xu, X.J.; Qiu, C.P.; Spolsky, C.; Qiu, D.C.; Li, Y.; Xia, M.Y.; Feng, Z. Snail-Schistosoma, paragonimus interactions in China: Population ecology, genetic diversity, coevolution and emerging diseases. Malacologia 1999, 41, 355–377. [Google Scholar]
 - Zhou, X.N.; Yang, G.J.; Yang, K.; Wang, X.H.; Hong, Q.B.; Sun, L.P.; Malone, J.B.; Kristensen, T.K.; Bergquist, N.R.; Utzinger, J. Potential impact of climate change on schistosomiasis transmission in China. Am. J. Trop. Med. Hyg 2008, 78, 188–194. [Google Scholar]
 - Niu, A.O.; Xiong, Y.W. Studies on the genetic variation of Oncomelania hupensis with SSR-PCR. Chin. J. Parasitic. Dis. Control 2002, 15, 230–233. [Google Scholar]
 - Guo, J.T.; Zhou, Y.B.; Wei, J.G. Sequencing on products of Oncomelania hupensis through simple sequence repeat achored polymerase chain reaction amplification. Chin. J. Epidemiol 2008, 29, 1119–1122. [Google Scholar]
 - de Sousa, S.N.; Finkeldey, R.; Gailing, O. Experimental verification of microsatellite null alleles in Norway spruce (Picea abies L. Karst.): Implications for population genetic studies. Plant Mol. Biol. Rep 2005, 23, 113–119. [Google Scholar]
 - Chapuis, M.P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol 2007, 24, 621–631. [Google Scholar]
 - Parayre, S.; Falentin, H.; Madec, M.N. Easy DNA extraction method and optimisation of PCR-temporal temperature gel electrophoresis to identify the predominant high and low GC-content bacteria from dairy products. J. Microbiol. Methods 2007, 69, 431–441. [Google Scholar]
 - Chen, T.; Zhou, R.C.; Ge, X.J.; Shi, S.H. Development and characterization of microsatellite markers for a mangrove tree species Sonneratia caseolaris (L.) Engler (Lythraceae sensu lato). Conserv. Genet 2008, 9, 957–959. [Google Scholar]
 - Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
 - Raymond, M.; Rousset, F. Genepop (version 1.2): Population genetics software for exact test and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
 - Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
 
| Locus | GenBank Accession No. | Primer Sequence (5′→3′) | Repeat Motif | Ta (°C) | Allele Size from Field Snails (bp) | 
|---|---|---|---|---|---|
| P82 | GU204045 | Pf: AAGAACTGCTCATACTGGAAAG Pr: GTGGTGCCCCTACGACCT  | (GGA)4(GAA)12 | 51 | 176–242 | 
| T4-22 | GU204083 | Pf: TATCCAAGAAGCCGAAAC Pr: GAGGAAAGCGAGGTAAGA  | (CA)10CC(CA)4 | 50 | 224–256 | 
| T5-11 | GU204092 | Pf: ACGCCAGTCTTGGTGTCA Pr: TACTTGGGCAGAAGGGTT  | (TG)14TA(TG)4 | 55 | 137–165 | 
| D11 | GU204223 | Pf: AGCTTGGGATCAGAATGTCGTTTGT Pr: TATGTAGATGTTCACTGGTTTGTCC  | (TG)17 | 55 | 172–192 | 
| T6-27 | GU204213 | Pf: AATGACACCCCGAACAAA Pr: CACTTCTCAACTCCAACCT  | (TG)6G(GT)6..(GT)12 | 55 | 178–210 | 
| T6-17 | GU204108 | Pf: GGCCTGCCTTGGTTTTTTCACGTAG Pr: AGCTTGGGATCATCTCCAGGTC  | (AC)8 | 55 | 230–248 | 
| B14 | GU204050 | Pf: CAGTCACAGCGCAGCCTACGA Pr: TCAAGCGACCTGATGTCAAATACC  | (AG)33 | 55 | 151–259 | 
| T4-33 | GU204086 | Pf: GTCAAAACAACGAGGGCTGT Pr: CTGAGTGGAATGGGAGTTGG  | (AC)19 | 60 | 135–173 | 
| C22 | GU204145 | Pf: TGGGATCGGTACATCTGGATAGTGG Pr: GGGATCAATGAAAGTTCTTGCGTTC  | (CA)21 | 62 | 210–263 | 
| T6-47 | GU204215 | Pf: CCGAAGTGATAGAAACCG Pr: AGGCAGAAATGGGCAGAC  | (TG)7...(GT)9 | 55 | 172–202 | 
| T5-21 | GU204196 | Pf: ATAAGTTTAGCCAGTCACCC Pr: ACACGCAGTCCACGCACA  | (GT)16GG(GT)4T T(GT)7TT(GT)4  | 55 | 155–185 | 
| E3 | GU204069 | Pf: GATTTGTGAAAGTGAGGGTA Pr: TAGCAGGCGTCAAGGTAA  | (CA)33 | 55 | 201–229 | 
| E15 | GU204173 | Pf: AAAGAACCGAATCAGGAC Pr: TACCAGCCGATGAATAAA  | (AC)22CC(AC)13 AT(AC)8  | 55 | 123–225 | 
| C23 | GU204058 | Pf: CTGGACCTAAAGCAATAAC Pr: GAGCCAATCACCTAAACTA  | (GT)14 | 55 | 144–188 | 
| T4-36 | GU204088 | Pf: CGGGTTACGGGAAAGGAT Pr: AGGGACGAACTCACGAAG  | (CA)17 | 55 | 192–250 | 
| Population | Index | Microatellite Locus | Total | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P82 | T4-22 | T5-11 | T6-27 | T6-17 | D11 | B14 | T4-33 | C22 | T6-47 | T5-21 | T4-36 | E3 | E15 | C23 | |||
| FJF | Na | 5 | 6 | 6 | 7 | 8 | 3 | 11 | 5 | 4 | 8 | 5 | 5 | 7 | 4 | 8 | 6.13 | 
| HO | 0.563 | 0.733 | 1 | 0.563 | 0.75 | 0.75 | 0.813 | 0.882 | 0.722 | 0.611 * | 0.667 | 0.5 | 0.611 | 0.722 | 0.778 * | 0.727 | |
| HE | 0.752 | 0.779 | 0.845 | 0.802 | 0.821 | 0.605 | 0.895 | 0.791 | 0.751 | 0.889 | 0.765 | 0.818 | 0.737 | 0.751 | 0.8 | 0.711 | |
| SCH | Na | 9 | 4 | 10 | 5 | 10 | 5 | 12 | 5 | 6 | 9 | 4 | 10 | 4 | 6 | 4 | 6.87 | 
| HO | 0.667 | 0.556 | 0.889 | 0.75 | 0.889 | 0.684 | 0.722 | 0.842 | 0.944 | 0.722 * | 0.563 | 0.611 * | 0.556 | 0.5 * | 0.444 | 0.689 | |
| HE | 0.833 | 0.684 | 0.886 | 0.792 | 0.864 | 0.721 | 0.914 | 0.794 | 0.795 | 0.886 | 0.77 | 0.883 | 0.706 | 0.802 | 0.751 | 0.805 | |
| GXY | Na | 8 | 8 | 6 | 6 | 1 | 10 | 3 | 5 | 7 | 7 | 1 | 7 | 4 | 3 | 5.13 | |
| HO | 0.526 | 0.737 | 1 | 0.632 | 0.895 | 0 | 0.737 | 1 * | 0.833 | 0.556 * | 0.5 * | 0 | 0.333 * | 0.444 | 0.4 | 0.506 | |
| HE | 0.743 | 0.741 | 0 | 0.828 | 0.657 | 0 | 0.862 | 0.539 | 0.697 | 0.846 | 0.822 | 0 | 0.718 | 0.614 | 0.481 | 0.57 | |
| AHX | Na | 8 | 0 | 6 | 11 | 9 | 4 | 8 | 8 | 8 | 9 | 8 | 6 | 4 | 9 | 8 | 7.06 | 
| HO | 0.722 | 0.882 * | 0.526 | 0.778 | 0.684 | 0.526 | 0.889 | 0.684 | 0.684 | 0.737 * | 0.611 * | 0.474 | 0.444 | 0.579 | 0.5 * | 0.624 | |
| HE | 0.776 | 0.758 | 0.797 | 0.895 | 0.859 | 0.627 | 0.819 | 0.841 | 0.788 | 0.838 | 0.854 | 0.812 | 0.687 | 0.865 | 0.806 | 0.801 | |
| Total | Na | 18 | 13 | 13 | 23 | 19 | 6 | 29 | 13 | 16 | 16 | 15 | 18 | 10 | 14 | 14 | 15.80 | 
| HO | 0.62 | 0.725 | 0.583 | 0.681 | 0.806 | 0.479 | 0.789 | 0.851 | 0.794 | 0.658 | 0.586 | 0.397 | 0.486 | 0.562 | 0.536 | 0.637 | |
| HE | 0.893 | 0.796 | 0.871 | 0.948 | 0.907 | 0.696 | 0.939 | 0.893 | 0.9 | 0.903 | 0.902 | 0.895 | 0.739 | 0.864 | 0.873 | 0.868 | |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zhang, L.; Li, S.; Wang, Q.; Qian, Y.; Liu, Q.; Yang, P.; Zhou, X. Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China. Int. J. Mol. Sci. 2012, 13, 5844-5850. https://doi.org/10.3390/ijms13055844
Zhang L, Li S, Wang Q, Qian Y, Liu Q, Yang P, Zhou X. Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China. International Journal of Molecular Sciences. 2012; 13(5):5844-5850. https://doi.org/10.3390/ijms13055844
Chicago/Turabian StyleZhang, Li, Shizhu Li, Qiang Wang, Yingjun Qian, Qin Liu, Pin Yang, and Xiaonong Zhou. 2012. "Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China" International Journal of Molecular Sciences 13, no. 5: 5844-5850. https://doi.org/10.3390/ijms13055844
APA StyleZhang, L., Li, S., Wang, Q., Qian, Y., Liu, Q., Yang, P., & Zhou, X. (2012). Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China. International Journal of Molecular Sciences, 13(5), 5844-5850. https://doi.org/10.3390/ijms13055844
        