Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusion
Acknowledgement
References
- Ishikawa, T.; Narita, T.; Urabe, J. Long-term changes in the abundance of Jesogammarus annandalei (Tattersall) in Lake Biwa. Limnol. Oceanogr 2004, 49, 1840–1847. [Google Scholar]
- Shiga Statistics and Information Office, Annual Report of the Agriculture, Forestry and Fisheries Statistics of Shiga; Shiga Statistics and Information Office: Shiga Prefecture, Japan, 1962–2011.
- Nakanishi, M.; Sekino, T. Recent drastic changes in Lake Biwa biocommunities, with attention to exploitation of the littoral zone. GeoJournal 1996, 40, 63–67. [Google Scholar]
- Nakai, K. Recent, Faunal Changes in Lake Biwa, with Particular Reference to the Bass Fishing Boom in Japan. In Ancient Lakes: Their Cultural and Biological Diversity; Kenobi Production: Ghent, Belgium, 1999; pp. 227–241. [Google Scholar]
- Nakazawa, T.; Ishida, N.; Kato, M.; Yamamura, N. Larger body size with higher predation rate. Ecol. Freshw. Fish 2007, 16, 362–372. [Google Scholar]
- Kumagai, M. Lake Biwa in the context of world lake problem. Verh. Internat. Verein. Limnol 2008, 30, 1–15. [Google Scholar]
- Ministory of Environment of Japan, Red Data Book of Japan; Ministry of the Environment of Japan: Tokyo, Japan, 2007.
- Charlesworth, D.; Charlesworth, B. Inbreeding depression and its evolutionary consequences. Annu. Rev. Ecol. Evol. Syst 1987, 18, 237–268. [Google Scholar]
- Falconer, D.S.; Mackay, T.F.C. Introduction to Quantitative Genetics, 3rd ed.; CABI: Wallingford, CT, USA, 1996. [Google Scholar]
- Ogawa, N.O.; Koitabashi, T.; Oda, H.; Nakamura, T.; Ohkouchi, N.; Wada, E. Fluctuations of nitrogen isotope ratio of gobiid fish (Isaza) specimens and sediments in Lake Biwa, Japan, during the 20th century. Limnol. Oceanogr 2001, 46, 1228–1236. [Google Scholar]
- Nakazawa, T.; Sakai, Y.; Hsieh, C.H.; Koitabashi, T.; Tayasu, I.; Yamamura, N.; Okuda, N. Is the relationship between body-size and trophic niche position time-invariant in a predatory fish? First stable isotope evidence. PLoS One 2010, 5. [Google Scholar] [CrossRef]
- Hirase, S.; Kanno, M.; Kijima, A. Isolation and characterization of 15 microsatellite DNA loci for assessing population structure of the intertidal goby Chaenogobius annularis. Mol. Ecol. Resour 2010, 10, 1106–1108. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- National Center for Biotechnology Information. Available online: http://www.ncbi.nlm.nih.gov/guide/ accessed on 20 November 2011.
- Rousset, F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
Locus | Primer Sequence (5′~3prime;) | Repeat | Size Range (bp) | Labeling dye | Ta (°C) | Accession No. |
---|---|---|---|---|---|---|
Isaz1 | F: CTGAAGGTCAGAGGTCAGAGGTCA | (GT)4GAGGGGCGTGGCTAAAGCTA(GT)4 | 225–252 | PET | 58 | AB703105 |
R: GGGAAAGACATGAGGCAAAA | ||||||
Isaz2 | F: GGAGAGGAGAAAGGGTTTGG | (AG)10 | 238–224 | 6-FAM | 58 | AB703106 |
R: CAGGCTCCTTACCTCCAGTG | ||||||
Isaz4 | F: CCATCACTCTCGCTCTGTT | (CT)3TT(CTCTCGTT)2 (CT)3TT(CT)3 | 180 | NED | 58 | AB703107 |
R: AGAGACAACCTGCCTTCAGA | ||||||
Isaz5 | F: ATGAGGATGTCACAAGTGGAGCAG | (GA)18 | 168 | 6-FAM | 58 | AB703108 |
R: CTGGGTGAATGTAGGGCAGT | ||||||
Isaz9 | F: ATGGACAAGTCGGAAACTCG | (AC)13 | 150–165 | VIC | 56 | AB703109 |
R: AAAGTTTCTAAAGACCAACAC | ||||||
Isaz10 | F: GGTTTGTCCCACTTTGCCTGT | (CA)4AA(CA)2TA(CA)2 | 144–151 | NED | 56 | AB703110 |
R: GTGAAAGGTTGTGCATGTGG | ||||||
Isaz12 | F: CTTGGCATGAAATTGGCTTT | (GA)14 | 323–333 | VIC | 56 | AB703111 |
R: CCTGCTTTCTATTCCCAGTTGTAA | ||||||
Isaz14 | F: ATCTGTATCGCCTCCTTTCTCC | (CT)11 | 125–162 | VIC | 58 | AB703112 |
R: GCGGTTCAAAGCCCCGGTCTGT | ||||||
Isaz15 | F: CATAGCACCGCCTAGTGTGA | (CA)8 | 178–198 | NED | 56 | AB703113 |
R: ACTCCCACGGACGAATACTG |
Frozen Current (2010, N = 18) | Formalin-Fixed Historical (1983–2002, N = 32) | |||||
---|---|---|---|---|---|---|
Locus | A | Ho | He | A | Ho | He |
Isaz1 | 8 | 0.56 | 0.75 | 8 | 0.72 | 0.77 |
Isaz2 | 2 | 0.06 | 0.06 | 3 | 0.09 | 0.09 |
Isaz4 | 1 | n.s. | n.s. | 1 | n.s. | n.s. |
Isaz5 | 1 | n.s. | n.s. | 4 | 0.00 | 0.62 |
Isaz9 | 10 | 0.33 | 0.29 | 8 | 0.59 | 0.74 |
Isaz10 | 2 | 0.78 | 0.84 | 4 | 0.22 | 0.47 |
Isaz12 | 6 | 0.72 | 0.76 | 7 | 0.56 | 0.80 |
Isaz14 | 7 | 0.72 | 0.83 | 9 | 0.63 | 0.83 |
Isaz15 | 7 | 0.50 | 0.61 | 12 | 0.22 | 0.56 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Araki, K.S.; Nakazawa, T.; Kawakita, A.; Kudoh, H.; Okuda, N. Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae). Int. J. Mol. Sci. 2012, 13, 5700-5705. https://doi.org/10.3390/ijms13055700
Araki KS, Nakazawa T, Kawakita A, Kudoh H, Okuda N. Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae). International Journal of Molecular Sciences. 2012; 13(5):5700-5705. https://doi.org/10.3390/ijms13055700
Chicago/Turabian StyleAraki, Kiwako S., Takefumi Nakazawa, Atsushi Kawakita, Hiroshi Kudoh, and Noboru Okuda. 2012. "Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae)" International Journal of Molecular Sciences 13, no. 5: 5700-5705. https://doi.org/10.3390/ijms13055700
APA StyleAraki, K. S., Nakazawa, T., Kawakita, A., Kudoh, H., & Okuda, N. (2012). Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae). International Journal of Molecular Sciences, 13(5), 5700-5705. https://doi.org/10.3390/ijms13055700