CARD15/NOD2, CD14 and Toll-like 4 Receptor Gene Polymorphisms in Saudi Patients with Crohn’s Disease
Abstract
:1. Introduction
2. Results and Discussion
2.1. Frequency of CARD15/NOD2 Polymorphisms
2.2. Frequency of TLR4 Thr399Ile and the −159 (C/T) Polymorphism of the CD14 Gene
2.3. Identification of the Most Effective Mutation among CARD15/NOD2 (Leu1007fsinsC, Arg702Trp, Gly908Arg), TLR4 Thr399Ile and CD14 −159C/T
2.4. Comparisons between the Two Groups (Control and Patients) According to Combinations of Mutations
2.5. Analysis of the Crohn’s Disease Susceptibility Haplotype on CARD15/NOD2
2.6. Genotype–Phenotype Analysis of CARD15/NOD2: Univariate Analysis
3. Experimental Section
3.1. Ethical Approval
3.2. Methods
4. Conclusions
Supplementary Information
ijms-13-04268-s001.pdfAcknowledgments
References
- Podolsky, D.K. Inflammatory bowel disease. N. Engl. J. Med 2002, 347, 417–429. [Google Scholar]
- Lesage, S.; Zouali, H.; Cezard, J.P.; Colombel, J.F.; Belaiche, J.; Almer, S.; Tysk, C.; O’Morain, C.; Gassull, M.; Binder, V.; et al. CARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease. Am. J. Hum. Genet 2002, 70, 845–857. [Google Scholar]
- Gutierrez, O.; Pipaon, C.; Inohara, N.; Fontalba, A.; Ogura, Y.; Prosper, F.; Nunez, G.; Fernandez-Luna, J.L. Induction of Nod2 in myelomonocytic and intestinal epithelial cells via nuclear factor-kappa B activation. J. Biol. Chem 2002, 277, 41701–41705. [Google Scholar]
- Hugot, J.P.; Cezard, J.P.; Colombel, J.F.; Belaiche, J.; Almer, S.; Tysk, C.; Montague, S.; Gassull, M.; Christensen, S.; Finkel, Y.; et al. Clustering of Crohn’s disease within affected sibships. Eur. J. Hum. Genet. 2003, 11, 179–184. [Google Scholar]
- Rosenstiel, P.; Fantini, M.; Brautigam, K.; Kuhbacher, T.; Waetzig, G.H.; Seegert, D.; Schreiber, S. TNF-alpha and IFN-gamma regulate the expression of the NOD2 (CARD15) gene in human intestinal epithelial cells. Gastroenterology 2003, 124, 1001–1009. [Google Scholar]
- Bonen, D.K.; Ogura, Y.; Nicolae, D.L.; Inohara, N.; Saab, L.; Tanabe, T.; Chen, F.F.; Foster, S.J.; Duerr, R.H.; Brant, S.R.; et al. Crohn’s disease-associated NOD2 variants share a signaling defect in response to lipopolysaccharide and peptidoglycan. Gastroenterology 2003, 124, 140–146. [Google Scholar]
- Yamazaki, K.; Takazoe, M.; Tanaka, T.; Kazumori, T.; Nakamura, Y. Absence of mutation in the NOD2/CARD15 gene among 483 Japanese patients with Crohn’s disease. J. Hum. Genet 2002, 47, 469–472. [Google Scholar]
- Wang, Z.W.; Ji, F.; Teng, W.J.; Yuan, X.G.; Ye, X.M. Risk factors and gene polymorphisms of inflammatory bowel disease in population of Zhejiang, China. World J. Gastroenterol 2011, 17, 118–122. [Google Scholar]
- Arbour, N.C.; Lorenz, E.; Schutte, B.C.; Zabner, J.; Kline, J.N.; Jones, M.; Frees, K.; Janet, L.; Watt, J.L.; Schwartz, D.A. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat. Genet 2000, 25, 187–191. [Google Scholar]
- Brand, S.; Staudinger, T.; Schnitzler, F.; Pfennig, S.; Hofbauer, K.; Dambacher, J.; Seiderer, J.; Tillack, C.; Konrad, A.; Crispin, A.; et al. The role of Toll-like receptor 4 Asp299Gly and Thr399Ile polymorphisms and CARD15/NOD2 mutations in the susceptibility and phenotype of Crohn’s disease. Inflamm. Bowel. Dis 2005, 11, 645–652. [Google Scholar]
- Gazouli, M.; Mantzaris, G.; Kotsinas, A.; Zacharatos, P.; Papalambros, E.; Archimandritis, A.; Ikonomopoulos, J.; Gorgoulis, V.G. Association between polymorphisms in the Toll-like receptor 4, CD14, and CARD15/NOD2 and inflammatory bowel disease in the Greek population. World J. Gastroenterol 2005, 11, 681–685. [Google Scholar]
- Barton, G.M.; Medzhitov, R. Toll-like receptor signaling pathways. Science 2003, 300, 1524–1525. [Google Scholar]
- Klein, W.; Tromm, A.; Griga, T.; Folwaczny, C.; Hocke, M.; Eitner, K.; Marx, M.; Duerig, N.; Epplen, J.T. Interaction of polymorphisms in the CARD15 and CD14 genes in patients with Crohn disease. Scand. J. Gastroenterol 2003, 38, 834–836. [Google Scholar]
- Rioux, J.D.; Silverberg, M.S.; Daly, M.J.; Steinhart, A.H.; McLeod, R.S.; Griffiths, A.M.; Green, T.; Brettlin, T.S.; Stone, V.; Bull, S.B.; et al. Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci. Am. J. Hum. Genet 2000, 66, 1863–1870. [Google Scholar]
- Grimm, M.C.; Pavli, P.; van de Pol, E.; Doe, W.F. Evidence for a CD14+ population of monocytes in inflammatory bowel disease mucosa—implications for pathogenesis. Clin. Exp. Immunol 1995, 100, 291–297. [Google Scholar]
- Zouiten-Mekki, L.; Zaouali, H.; Boubaker, J.; Karoui, S.; Fekih, M.; Matri, S.; Hamzaoui, S.; Filali, A.; Chaabouni, H.; Hugot, J.P. CARD15/NOD2 in a Tunisian population with Crohn’s disease. Dig. Dis. Sci 2005, 50, 130–135. [Google Scholar]
- Karban, A.; Waterman, M.; Panhuysen, C.I.; Pollak, R.D.; Nesher, S.; Datta, L.; Weiss, B.; Suissa, A.; Shamir, R.; Brant, S.R.; et al. NOD2/CARD15 genotype and phenotype differences between Ashkenazi and Sephardic Jews with Crohn’s disease. Am. J. Gastroenterol 2004, 99, 1134–1140. [Google Scholar]
- Tukel, T.; Shalata, A.; Present, D.; Rachmilewitz, D.; Mayer, L.; Grant, D.; Risch, N.; Desnick, R.J. Crohn disease: Frequency and nature of CARD15 mutations in Ashkenazi and Sephardi/Oriental Jewish families. Am. J. Hum. Genet 2004, 74, 623–636. [Google Scholar]
- Cuthbert, A.P.; Fisher, S.A.; Mirza, M.M.; King, K.; Hampe, J.; Croucher, P.J.; Mascheretti, S.; Sanderson, J.; Forbes, A.; Mansfield, J.; et al. The contribution of NOD2 gene mutations to the risk and site of disease in inflammatory bowel disease. Gastroenterology 2002, 122, 867–874. [Google Scholar]
- Barbujani, G.; Bertorelle, G. Genetics and the population history of Europe. Proc. Natl. Acad. Sci. USA 2001, 98, 22–25. [Google Scholar]
- Mohamed, J.A.; DuPont, H.L.; Flores, J.; Palur, H.; Nair, P.; Jiang, Z.D.; Guo, D.; Belkind-Gerson, J.; Okhuysen, P.C. Single nucleotide polymorphisms in the promoter of the gene encoding the lipopolysaccharide receptor CD14 are associated with bacterial diarrhea in US and Canadian travelers to Mexico. Clin. Infect. Dis 2011, 52, 1332–1341. [Google Scholar]
- Franchimont, D.; Vermeire, S.; El Housni, H.; Pierik, M.; van Steen, K.; Gustot, T.; Quertinmont, E.; Abramowicz, M.; van Gossum, A.; Deviere, J.; et al. Deficient host-bacteria interactions in inflammatory bowel disease? The toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohn’s disease and ulcerative colitis. Gut 2004, 53, 987–992. [Google Scholar]
- Torok, H.P.; Glas, J.; Tonenchi, L.; Mussack, T.; Folwaczny, C. Polymorphisms of the lipopolysaccharide-signaling complex in inflammatory bowel disease: Association of a mutation in the Toll-like receptor 4 gene with ulcerative colitis. Clin. Immunol 2004, 112, 85–91. [Google Scholar]
- Agnese, D.M.; Calvano, J.E.; Hahm, S.J.; Coyle, S.M.; Corbett, S.A.; Calvano, S.E.; Lowry, S.F. Human toll-like receptor 4 mutations but not CD14 polymorphisms are associated with an increased risk of gram-negative infections. J. Infect. Dis 2002, 186, 1522–1525. [Google Scholar]
- Lakatos, P.L.; Lakatos, L.; Szalay, F.; Willheim-Polli, C.; Osterreicher, C.; Tulassay, Z.; Molnar, T.; Reinisch, W.; Papp, J.; Mozsik, G.; et al. Toll-like receptor 4 and NOD2/CARD15 mutations in Hungarian patients with Crohn’s disease: Phenotype-genotype correlations. World J. Gastroenterol 2005, 11, 1489–1495. [Google Scholar]
- Zouiten-Mekki, L.; Kharrat, M.; Karoui, S.; Serghimi, M.; Fekih, M.; Matri, S.; Kallel, L.; Boubaker, J.; Filali, A.; Chaabouni, H. Toll like receptor 4 (TLR4) polymorphisms in Tunisian patients with Crohn’s disease: Genotype-phenotype correlation. BMC Gastroenterol. 2009, 9. [Google Scholar] [CrossRef]
- Arnott, I.D.; Nimmo, E.R.; Drummond, H.E.; Fennell, J.; Smith, B.R.; MacKinlay, E.; Morecroft, J.; Anderson, N.; Kelleher, D.; O’Sullivan, M.; et al. NOD2/CARD15, TLR4 and CD14 mutations in Scottish and Irish Crohn’s disease patients: Evidence for genetic heterogeneity within Europe? Genes Immun 2004, 5, 417–425. [Google Scholar]
- Oostenbrug, L.E.; Drenth, J.P.; de Jong, D.J.; Nolte, I.M.; Oosterom, E.; van Dullemen, H.M.; van der Linde, K.; te Meerman, G.J.; van der Steege, G.; Jan, H; Kleibeuker, J.H.; et al. Association between Toll-like receptor 4 and inflammatory bowel disease. Inflamm. Bowel Dis 2005, 11, 567–575. [Google Scholar]
- Canto, E.; Ricart, E.; Busquets, D.; Monfort, D.; Garcia-Planella, E.; Gonzalez, D.; Balanzo, J.; Rodriguez-Sanchez, J.L.; Vidal, S. Influence of a nucleotide oligomerization domain 1 (NOD1) polymorphism and NOD2 mutant alleles on Crohn’s disease phenotype. World J. Gastroenterol 2007, 13, 5446–5453. [Google Scholar]
- Nunez, C.; Barreiro, M.; Dominguez-Munoz, J.E.; Lorenzo, A.; Zapata, C.; Pena, A.S. CARD15 mutations in patients with Crohn’s disease in a homogeneous Spanish population. Am. J. Gastroenterol 2004, 99, 450–456. [Google Scholar]
No. | % | |
---|---|---|
Sex | ||
Male | 31 | 67.4 |
Female | 15 | 32.6 |
Age | ||
Range | 18.0–70.0 | |
Mean ± SD | 30.43 ± 10.20 | |
Smoking | ||
No | 39 | 84.8 |
Yes | 7 | 15.2 |
Family IBD Hx | ||
No | 37 | 80.4 |
Yes | 9 | 19.6 |
Complication | ||
No not for surgery | 23 | 50.0 |
Yes for surgery | 23 | 50.0 |
Phenotype | ||
Fistulizing | 22 | 47.8 |
Fibrostenotic | 7 | 15.2 |
Inflammatory | 16 | 34.8 |
Fistulizing & Fibrostenotic | 1 | 2.2 |
Presenting symptoms | ||
Abdominal pain | 38 | 86.4 |
Anemia | 7 | 15.9 |
Arthritis | 6 | 13.6 |
Bleeding per rectum | 19 | 43.2 |
Diarrhea | 33 | 75.0 |
Eye disease | 3 | 6.8 |
Fever | 10 | 22.7 |
Perianal Disease | 16 | 36.4 |
Skin lesions | 4 | 9.1 |
Vomiting | 6 | 13.6 |
Weight loss | 24 | 54.5 |
Medications | ||
5-ASA | 23 | 51.1 |
Adalimumab | 3 | 6.7 |
Budesonide | 3 | 6.7 |
Imuran | 35 | 77.8 |
Infliximab | 28 | 62.2 |
Steroid | 12 | 26.7 |
Disease extent | ||
Ileal | 10 | 21.7 |
Ileocolonic | 27 | 58.7 |
Colonic | 9 | 19.6 |
Homozygous wild-type | Homozygous mutant | P | Heterozygous mutant | P | Or (95% ci) mutant | Or (95% ci) hetero | |
---|---|---|---|---|---|---|---|
Leu1007fsinsC | |||||||
Patients | 7 (15.2%) | 3 (6.5%) | 0.012 * | 36 (78.3%) | <0.0001 * | 5.29 (2.71–10.29) | 7.71 (2.87–20.71) |
Controls | 30 (60.0%) | 0 (0.0%) | 20 (20.0%) | ||||
Arg702Trp | |||||||
Patients | 8 (17.4%) | 10 (21.7%) | <0.0001 * | 28 (60.6%) | <0.0001 * | 21.87 (3.99–119.9) | 9.42 (3.43–25.9) |
Controls | 35 (70.0%) | 2 (4.0%) | 13 (26.0%) | ||||
Gly908Arg | |||||||
Patients | 5 (10.9%) | 3 (6.5%) | 0.015 * | 38 (82.6%) | <0.0001 * | 21.0 (1.81–243.2) | 19.0 (6.20–58.21) |
Controls | 35 (70.0%) | 1 (2.0%) | 14 (28.0%) |
Homozygous wild-type | Homozygous mutant | P | Heterozygous | P | Or (95% ci) mutant | Or (95% ci) hetero | |
---|---|---|---|---|---|---|---|
TLR4 Thr399Ile | |||||||
Patients | 24 (52.2%) | 4 (8.7%) | 0.495 | 18 (39.1%) | 0.226 | 1.33 (0.30–5.88) | 1.71 (0.71–4.12) |
Control | 32 (64.0%) | 4 (8.0%) | 14 (28.0) | ||||
CD14 −159C/T gene | |||||||
Patients | 13 (28.3%) | 7 (15.2%) | 0.075 | 26 (56.5%) | 0.002 * | 3.23 (0.86–12.09) | 4.0 (1.61–9.93) |
Control | 30 (60.0%) | 5 (10.0%) | 15 (30.0%) |
Leu1007fsinsC | Arg702Trp | Gly908Arg | TLR4 Thr399Ile | CD14 −159C/T | ||||||
---|---|---|---|---|---|---|---|---|---|---|
No. | % | No. | % | No. | % | No. | % | No. | % | |
Wild | 7 | 15.2 | 8 | 17.4 | 5 | 10.9 | 24 | 52.2 | 13 | 28.3 |
Mutant | 3 | 6.5 | 10 | 21.7 | 3 | 77 | 4 | 8.7 | 7 | 15.2 |
Hetero | 36 | 78.3 | 28 | 60.9 | 38 | 26 | 18 | 39.1 | 26 | 56.5 |
P1 | P = 0.089 | P = 0.824 | P < 0.001* | P = 0.082 | ||||||
P2 | P = 0.0504 | P = 0.002* | P = 0.408 | |||||||
P3 | P = 0.025* | P < 0.001* | ||||||||
P4 | P = 0.063 |
Patients | Control | |||
---|---|---|---|---|
No. | % | No. | % | |
None of the mutant alleles | 0 | 0.0 | 7 | 14.0 |
CARD15/NOD2 | 16 | 34.8 | 20 | 40.0 |
TLR4 Thr399Ile only | 0 | 0.0 | 3 | 6.0 |
CD14 −159C/T gene | 1 | 2.2 | 1 | 2.0 |
CARD15/NOD2/TLR4 Thr399Ile | 4 | 8.7 | 5 | 10.0 |
CARD15/NOD2/CD14 −159C/T | 11 | 23.9 | 8 | 16.0 |
TLR4 Thr399Ile/CD14 −159C/T CARD15/NOD2/TLR4 | 0 | 0.0 | 2 | 4.0 |
Thr399Ile/CD14 −159C/T gene | 14 | 30.4 | 4 | 8.0 |
Leu1007fsinsC | Arg702Trp | Gly908Arg | Number in patients/47 | Number in control/50 | * P-value | * Odds ratio | 95% confidence intervals |
---|---|---|---|---|---|---|---|
1 | 1 | 1 | 28 (59.57%) | 14 (28%) | 0.002 | 3.789 | 1.62–8.86 |
2 | 1 | 1 | 30 (63.82%) | 23 (46%) | 0.078 | 2.072 | 0.92–4.68 |
1 | 1 | 2 | 30 (63.8%) | 36 (72%) | 0.388 | 0.686 | 0.29–1.62 |
1 | 2 | 1 | 30 (63.8%) | 14 (28%) | P < 0.0001 | 4.538 | 1.93–10.69 |
1 | 2 | 2 | 32 (68.08%) | 12 (24%) | P < 0.0001 | 6.756 | 2.77–16.49 |
2 | 1 | 2 | 29 (61.70%) | 17 (34%) | 0.006 | 3.127 | 1.36–7.17 |
2 | 2 | 1 | 32 (68.08%) | 3 (6%) | P < 0.0001 | 33.422 | 8.94–124.92 |
2 | 2 | 2 | 31 (65.95%) | 2 (4%) | P < 0.0001 | 46.50 | 9.99–216.42 |
Gene mutation | Primer name | Primer Sequence 5′-3′ | Cycling | Expected product |
---|---|---|---|---|
CARD15/NOD2 cytosine insertion mutation | Leu1007fsinsCW TF, | CAGAAGCCCTCCTGCAGGCCCT | 35 cycles of: 94 °C for 45 s, 65 °C for 40 s, 72 °C for 30 s | +ve for wild |
Leu1007fsinsCR (common reverse) | TCTTCAACCACATCCCCATT | |||
Leu1007fsinsCMUTF | CAGAAGCCCTCCTGCAGGCCCCT | +ve for mutant | ||
Leu1007fsinsCR(common reverse) | TCTTCAACCACATCCCCATT | |||
CARD15/NOD2 Missense mutation Arg702Trp | R702WWTF | ATCTGAGAAGGCCCTGCTCC | 35 cycles of: 94 °C for 45 s, 53 °C for 40 s, 72 °C for 30 s | +ve for wild |
R702WR, (common reverse) | CCCACACTTAGCCTTGATG | |||
R702WMUTF | ATCTGAGAAGGCCCTGCTCT | +ve for mutant | ||
R702WR,(common reverse) | CCCACACTTAGCCTTGATG | |||
CARD15/NOD2 Gly908Arg | Gly908Arg F | CCCAGCTCCTCCCTCTTC | 35 cycles of: 94 °C for 45 s, 53 °C for 40 s, 72 °C for 30 s | For wild 380 bp fragment with HhaI digest |
Gly908Arg R | AAGTCTGTAATGTAAAGCCAC | |||
TLR4 Thr399Ile | Thr399Ile FW | GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA | 35 cycles of: 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s | For wild 377 bp With HinfI restriction For mutant 223 bp with HinfI restriction |
Thr399Ile R | CCTGAAGACTGGAGAGTGAGTTAAATGCT | |||
CD14 −159C/T | CDP-1 | TTGGTGCCAACAGATGAGGTTCAC | 35 cycles of: 92 °C for 40 s, 62 °C for 35 s, 72 °C for 50 s. | For wild 204, 201 and 156 bp. With HaeIII digest For mutant 360 and 201 bp. With HaeIII digest |
CDP-2 | TTCTTTCCTACACAGCGGCACCC |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Azzam, N.; Nounou, H.; Alharbi, O.; Aljebreen, A.; Shalaby, M. CARD15/NOD2, CD14 and Toll-like 4 Receptor Gene Polymorphisms in Saudi Patients with Crohn’s Disease. Int. J. Mol. Sci. 2012, 13, 4268-4280. https://doi.org/10.3390/ijms13044268
Azzam N, Nounou H, Alharbi O, Aljebreen A, Shalaby M. CARD15/NOD2, CD14 and Toll-like 4 Receptor Gene Polymorphisms in Saudi Patients with Crohn’s Disease. International Journal of Molecular Sciences. 2012; 13(4):4268-4280. https://doi.org/10.3390/ijms13044268
Chicago/Turabian StyleAzzam, Nahla, Howaida Nounou, Othman Alharbi, Abedulrahman Aljebreen, and Manal Shalaby. 2012. "CARD15/NOD2, CD14 and Toll-like 4 Receptor Gene Polymorphisms in Saudi Patients with Crohn’s Disease" International Journal of Molecular Sciences 13, no. 4: 4268-4280. https://doi.org/10.3390/ijms13044268
APA StyleAzzam, N., Nounou, H., Alharbi, O., Aljebreen, A., & Shalaby, M. (2012). CARD15/NOD2, CD14 and Toll-like 4 Receptor Gene Polymorphisms in Saudi Patients with Crohn’s Disease. International Journal of Molecular Sciences, 13(4), 4268-4280. https://doi.org/10.3390/ijms13044268