Development and Characterization of 18 Novel EST-SSRs from the Western Flower Thrips, Frankliniella occidentalis (Pergande)
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characteristics of F. occidentalis EST-SSRs
2.2. Mutations of EST-SSRs
3. Experimental Section
3.1. EST Database Mining
3.2. Sample Collection and DNA Extraction
3.3. Primer Testing
3.4. Allele Sequencing
3.5. Data Analysis
4. Conclusions
Supplementary Materials
ijms-13-02863-s001.pdfAcknowledgments
References
- Mound, L.A.; Morris, D.C. The insect order Thysanoptera: classification versus systematics. Zootaxa 2007, 1668, 395–411. [Google Scholar]
- Reitz, S.R. Biology and ecology of the western flower thrips (Thysanoptera: Thripidae): The making of a pest. Fla. Entomol 2009, 92, 7–13. [Google Scholar]
- Bryan, D.E.; Smith, R.F. The Frankliniella occidentalis (Pergande) complex in California. Univ. Calif. Publ. Entomol 1956, 10, 359–410. [Google Scholar]
- Kirk, W.D.J.; Terry, L.I. The spread of the western flower thrips Frankliniella occidentalis (Pergande). Agric. For. Entomol 2003, 5, 301–310. [Google Scholar]
- Behura, S.K. Molecular marker systems in insects: current trends and future avenues. Mol. Ecol 2006, 15, 3087–3113. [Google Scholar]
- Ascunce, M.S.; Yang, C.C.; Oakey, J.; Calcaterra, L.; Wu, W.J.; Shih, C.J.; Goudet, J.; Ross, K.G.; Shoemaker, D. Global invasion history of the fire ant Solenopsis invicta. Science 2011, 331, 1066–1068. [Google Scholar]
- Toth, G.; Gaspari, Z.; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res 2000, 10, 967–981. [Google Scholar]
- Bhargava, A.; Fuentes, F.F. Mutational dynamics of microsatellites. Mol. Biotechnol 2010, 44, 250–266. [Google Scholar]
- Ellegren, H. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet 2004, 5, 435–445. [Google Scholar]
- Matsuoka, Y.; Mitchell, S.E.; Kresovich, S.; Goodman, M.; Doebley, J. Microsatellites in Zea-variability, patterns of mutations, and use for evolutionary studies. Theor. Appl. Genet 2002, 104, 436–450. [Google Scholar]
- Bruford, M.W.; Wayne, R.K. Microsatellites and their application to population genetic studies. Curr. Opin. Genet. Dev 1993, 3, 939–943. [Google Scholar]
- Brunner, P.C.; Frey, J.E. Isolation and characterization of six polymorphic microsatellite loci in the western flower thrips Frankliniella occidentalis (Insecta, Thysanoptera). Mol. Ecol. Notes 2004, 4, 599–601. [Google Scholar]
- Rotenberg, D.; Whitfield, A.E. Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips. Insect Mol. Biol 2010, 19, 537–551. [Google Scholar]
- Thiel, T. MISA—Microsatellite identification tool. Available online: http://pgrc.ipk-gatersleben.de/misa/misa.html accessed on 15 August 2011.
- Sun, J.T.; Zhang, Y.K.; Ge, C.; Hong, X.Y. Mining and characterization of sequence tagged microsatellites from the brown planthopper Nilaparvata lugens. J. Insect Sci 2011, 11, 134:1–134:11. [Google Scholar]
- Weng, Y.; Azhaguvel, P.; Michels, G.J.; Rudd, J.C. Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol. Biol 2007, 16, 613–622. [Google Scholar]
- Li, B.; Xia, Q.; Lu, C.; Zhou, Z.; Xiang, Z. Analysis on frequency and density of microsatellites in coding sequences of several eukaryotic genomes. Genomics Proteomics Bioinforma 2004, 2, 24–31. [Google Scholar]
- Gao, L.; Tang, J.; Li, H.; Jia, J. Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol. Breed 2003, 12, 245–261. [Google Scholar]
- Jurka, J.; Pethiyagoda, C. Simple repetitive DNA sequences from primates: Compilation and analysis. J. Mol. Evol 1995, 40, 120–126. [Google Scholar]
- van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Messier, W.; Li, S.H.; Stewart, C.B. The birth of microsatellites. Nature 1996, 381, 483. [Google Scholar]
- Zhu, Y.; Queller, D.C.; Strassmann, J.E. A phylogenetic perspective on sequence evolution in microsatellite loci. J. Mol. Evol 2000, 50, 324–338. [Google Scholar]
- Colson, I.; Goldstein, D.B. Evidence for complex mutations at microsatellite loci in Drosophila. Genetics 1999, 152, 617–627. [Google Scholar]
- Lia, V.V.; Bracco, M.; Gottlieb, A.M.; Poggio, L.; Confalonieri, V.A. Complex mutational patterns and size homoplasy at maize microsatellite loci. Theor. Appl. Genet 2007, 115, 981–991. [Google Scholar]
- Primmer, C.R.; Ellegren, H. Patterns of molecular evolution in avian microsatellites. Mol. Biol. Evol 1998, 15, 997–1008. [Google Scholar]
- Zhu, Y.; Strassmann, J.E.; Queller, D.C. Insertions, substitutions, and the origin of microsatellites. Genet. Res 2000, 76, 227–236. [Google Scholar]
- Goodman, S.J. RST CALC: A collection of computer programs for calculating unbiased estimates of genetic differentiation and determining their significance for microsatellite data. Mol. Ecol 1997, 6, 881–885. [Google Scholar]
- Anderson, T.J.C.; Su, X.Z.; Roddam, A.W.; Day, K.P. Complex mutations in a high proportion of microsatellite loci from the protozoan parasite Plasmodium falciparum. Mol. Ecol 2000, 9, 1599–1608. [Google Scholar]
- National Center for Biotechnology Information Expressed Sequence Tags database. Available online: http://www.ncbi.nlm.nih.gov/dbEST/ accessed on 15 August 2011.
- EST trimmer. Available online: http://pgrc.ipk-gatersleben.de/misa/download/est_trimmer.pl accessed on 15 August 2011.
- Thiel, T.; Michalek, W.; Varshney, R.K.; Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet 2003, 106, 411–422. [Google Scholar]
- Lalitha, S. Primer Premier 5.0. Biotech Software Internet Report 2000, 1, 270–272. [Google Scholar]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar]
- Hall, T.A. BioEdit: A user friendly biological sequence alignment editor and analyses program for Windows 95 / 98 / NT. Nucleic Acids Symp. Ser 1999, 41, 95–98. [Google Scholar]
- Rousset, F. GenePop’007: A complete re-implementation of the GenePop software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
- Marshall, T.C.; Slate, J.; Kruuk, L.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol 1998, 7, 639–655. [Google Scholar]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin, ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2005, 1, 47–50. [Google Scholar]
Repeats | Number of repeat motif (n) | |||||
---|---|---|---|---|---|---|
4 | 5 | 6 | 7 | 8 | Total | |
AC/GT | - | 89 | 14 | 4 | 3 | 110 |
AG/CT | - | 67 | 11 | 6 | 84 | |
AT/AT | - | 54 | 4 | 1 | 59 | |
CG/CG | - | 12 | 12 | |||
AAC/GTT | - | 7 | 1 | 8 | ||
AAG/CTT | - | 1 | 1 | |||
AAT/ATT | - | 5 | 1 | 6 | ||
ACC/GGT | - | 4 | 1 | 5 | ||
ACT/AGT | - | 1 | 1 | |||
AGC/CTG | - | 5 | 5 | |||
AGG/CCT | - | 1 | 1 | 2 | ||
ATC/ATG | - | 1 | 1 | |||
AAAC/GTTT | 3 | 3 | ||||
AAAT/ATTT | 3 | 3 | ||||
AACC/GGTT | 2 | 2 | ||||
AATC/ATTG | 2 | 2 | ||||
AATG/ATTC | 3 | 3 | ||||
ACAT/ATGT | 1 | 1 | ||||
ACTG/AGTC | 1 | 1 | ||||
AGAT/ATCT | 3 | 3 | ||||
ATGC/ATGC | 1 | 1 | ||||
ACGGC/CCGTG | 1 | 1 | ||||
NN(DNR) | - | 222 | 29 | 11 | 3 | 265 |
NNN(TNR) | - | 25 | 4 | 29 | ||
NNNN(TTNR) | 19 | 19 | ||||
NNNNN(PNR) | 1 | 1 |
Locus | Genbank number (Sequence length) | Putative gene function a | Repeat motif | Primer sequence (5′-3′) | Size range (bp) | Ta (°C) | HO | HE | N | Na | PIC |
---|---|---|---|---|---|---|---|---|---|---|---|
WFT20 | GT306150 (292bp) | XP_001945214.1|PREDICTED: uncharacterized protein C14orf138-like [Acyrthosiphon pisum] 4e-08 | (AC)6 | F: CGTAGCCGCCCAAACTGTT R: CCTTCCAATTCAAATTCCCT | 144–153 | 52 | 0.654 | 0.657 | 96 | 5 | 0.609 |
WFT24 | GT303793 (745bp) | Unknown | (TG)6 | F: ACGAAGTTTGGTTTGGGTGG R: AAGTTTCCTCCGCTCATTTC | 208–214 | 52 | 0.257 | 0.290 | 96 | 2 | 0.258 |
WFT25 | GT303588 (608bp) | Unknown | (GA)7 | F: CACCAGTCGCGTTCATTGA R: GCCTCCAGCAGCACAAGTA | 96–149 | 52 | 0.707 | 0.851 | 96 | 14 | 0.860 |
WFT28 | GT303349 (784bp) | Unknown | (TA)6 | F: GGGCTTGAAATAATGTTCTG R: GTAAATAAATCAGTGGAGGGT | 91–95 | 52 | 0.241 | 0.224 | 96 | 3 | 0.230 |
WFT37 | GT302424 (759 bp) | Unknown | (TTA)5 | F: GCATACCCTGTGAACGAGTG R: ACAGAAGCAAATGTCTACCTGA | 213–222 | 52 | 0.372 | 0.410 | 94 | 4 | 0.384 |
WFT50 | GT310239 (785 bp) | Unknown | (TG)7 | F: CGGAGTGAGCAGGAGTTGT R: TTGCCCCTACCAAAATATGA | 171–181 | 52 | 0.313 | 0.458 | 95 | 6 | 0.427 |
WFT51 | GT310133 (741bp) | XP_002425957.1| abrupt protein, putative [Pediculus humanus corporis] 7e-76 | (TG)8 | F: GTACGCAGGAGAAGTAAATG R: ACAAATCCAGATGGCAACC | 297–305 | 52 | 0.623 | 0.590 | 96 | 5 | 0.555 |
WFT64 | GT311293 (518 bp) | Unknown | (TCC)6 | F: CTTTTCGGATTCTCCTTCG R: GGAGACCTGATTCACCGTATG | 243–250 | 52 | 0.590 | 0.539 | 95 | 4 | 0.443 |
WFT66 | GT305093 (175 bp) | Unknown | (ACT)5 | F: AACTTAGGAAGAAAGACTGTAGA R: TGTTTACGCACGCACGCAT | 113–116 | 52 | 0.505 | 0.476 | 96 | 3 | 0.432 |
WFT83 | GT304065 (616 bp) | Unknown | (TA)5 | F: GGAGGTACTGACTAAAGCATG R: GGGACAGACAAAACAGGAAA | 172–176 | 52 | 0.462 | 0.451 | 96 | 4 | 0.394 |
WFT87 | GT303951 (830 bp) | Unknown | (TG)5 | F: GGTCTGAACTGTATGGGATG R: CAGGACCCTAGTATGTAAGAAA | 259–277 | 52 | 0.346 | 0.391 | 94 | 7 | 0.394 |
WFT98 | GT299180 (436 bp) | Unknown | (TG)5 | F: GGGGCAGTTTGCTCTTGT R: CTGTTCATGGTCACTTTGG | 145–153 | 52 | 0.645 | 0.636 | 96 | 5 | 0.587 |
WFT104 | GT298583 (602 bp) | XP_002063687.1| GK15779 [Drosophila willistoni] 4e-17 | (GT)5 | F: TCACGCAAGCTAACAGCCCT R: ACAAAGTTGCCTGCCTGAAT | 150–159 | 52 | 0.478 | 0.473 | 96 | 4 | 0.427 |
WFT108 | GT300460 (686 bp) | Unknown | (AT)5 | F: AGGATAGCTTGTTTTGTTGG R: CCATTTGTAACTAGCGTAGGA | 135–140 | 52 | 0.355 | 0.350 | 96 | 4 | 0.328 |
WFT124 | GT311015 (1114 bp) | Unknown | (TG)5 | F: CATTATGTGCCTCACCTCCG R: GCCTCAATTCTTCCTTGCG | 278–281 | 52 | 0.521 | 0.664 | 95 | 4 | 0.626 |
WFT139 | GT301579 (439 bp) | Unknown | (TC)5 | F:CATGGGTCCTTCCAGTGAG R: GCGAAACCTATCCCCTTATC | 138–142 | 52 | 0.072 | 0.089 | 96 | 3 | 0.088 |
WFT141 | GT310355 (612 bp) | Unknown | (GT)5 | F:GCTTTTGCATACCTTGTCTTC R: GGTAAGGGCCGGTTTTGTT | 174–183 | 52 | 0.588 | 0.678 | 96 | 7 | 0.651 |
WFT144 | GT310315 (766 bp) | Unknown | (GT)5 | F:TCGCAGAAGTTTGTGGTGAG R: GAGCCGATAAAAGTAGTGGAG | 94–137 | 52 | 0.598 | 0.844 | 94 | 15 | 0.875 |
Mean | 0.463 | 0.504 | 5.500 | 0.476 |
Location | Nb samples | Coordinates | Sampling dates | Host |
---|---|---|---|---|
Harbin | 31 | 45°44′51.13″N, 126°38′2.54″E | 23 July 2010 | Tagetes erecta L.; Hosta ventricosa (Salisb.) Stearn |
Dali | 35 | 25°36′17.49″N, 100°14′49.75″E | 30 July 2011 | Petunia hybrida Vilm; Nicandra physalodes; Canna indica L. |
Guiyang | 30 | 26°37′40.97″N, 106°49′23.06″E | 26 July 2011 | Solanum melongena L.; Cucurbita pepo L. |
Locus | Harbin | Dali | Guiyang | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
N | Na | HO | HE | r | N | Na | HO | HE | r | N | Na | HO | HE | r | |
WFT20 | 31 | 4 | 0.613 | 0.618 | −0.003 | 35 | 5 | 0.714 | 0.671 | −0.039 | 30 | 5 | 0.633 | 0.684 | 0.035 |
WFT24 | 31 | 2 | 0.452 | 0.437 | −0.017 | 35 | 2 | 0.086 | 0.133 | 0.110 | 30 | 2 | 0.233 | 0.299 | 0.095 |
WFT25 | 31 | 10 | 0.613 | 0.811 | 0.119 | 35 | 11 | 0.743 | 0.871 | 0.069 | 30 | 12 | 0.767 | 0.873 | 0.064 |
WFT28 | 31 | 3 | 0.290 | 0.252 | −0.155 | 35 | 3 | 0.400 | 0.355 | −0.062 | 30 | 3 | 0.033 | 0.065 | 0.149 |
WFT37 | 30 | 3 | 0.200 | 0.238 | 0.062 | 35 | 3 | 0.400 | 0.483 | 0.078 | 29 | 4 | 0.517 | 0.510 | 0.007 |
WFT50 | 31 | 6 | 0.290 | 0.409 | 0.112 | 34 | 5 | 0.382 | 0.476 | 0.076 | 30 | 5 | 0.267 | 0.491 | 0.193 |
WFT51 | 31 | 4 | 0.613 | 0.558 | −0.069 | 35 | 5 | 0.657 | 0.616 | −0.040 | 30 | 5 | 0.600 | 0.596 | −0.012 |
WFT64 | 31 | 3 | 0.548 | 0.529 | −0.019 | 34 | 3 | 0.588 | 0.543 | −0.056 | 30 | 3 | 0.633 | 0.546 | −0.084 |
WFT66 | 31 | 3 | 0.387 | 0.395 | 0.013 | 35 | 3 | 0.629 | 0.568 | −0.049 | 30 | 3 | 0.500 | 0.466 | −0.023 |
WFT83 | 31 | 3 | 0.548 | 0.505 | −0.047 | 35 | 4 | 0.371 | 0.348 | −0.049 | 30 | 3 | 0.467 | 0.499 | 0.036 |
WFT87 | 30 | 5 | 0.200 | 0.187 | −0.102 | 34 | 6 | 0.471 | 0.501 | 0.009 | 30 | 6 | 0.367 | 0.484 | 0.106 |
WFT98 | 31 | 4 | 0.516 | 0.546 | 0.027 | 35 | 4 | 0.686 | 0.644 | −0.043 | 30 | 5 | 0.733 | 0.718 | −0.011 |
WFT104 | 31 | 3 | 0.419 | 0.370 | −0.064 | 35 | 4 | 0.514 | 0.573 | 0.051 | 30 | 4 | 0.500 | 0.474 | −0.027 |
WFT108 | 31 | 3 | 0.355 | 0.297 | −0.193 | 35 | 4 | 0.343 | 0.394 | 0.093 | 30 | 3 | 0.367 | 0.359 | 0.026 |
WFT124 | 31 | 4 | 0.452 | 0.618 | 0.129 | 34 | 4 | 0.412 | 0.654 | 0.176 | 30 | 4 | 0.700 | 0.722 | 0.019 |
WFT139 | 31 | 3 | 0.097 | 0.151 | 0.114 | 35 | 3 | 0.086 | 0.083 | −0.043 | 30 | 2 | 0.033 | 0.033 | −0.017 |
WFT141 | 31 | 5 | 0.516 | 0.668 | 0.103 | 35 | 7 | 0.514 | 0.601 | 0.069 | 30 | 5 | 0.733 | 0.766 | 0.020 |
WFT144 | 31 | 11 | 0.645 | 0.838 | 0.116 | 34 | 13 | 0.529 | 0.881 | 0.196 | 29 | 11 | 0.621 | 0.812 | 0.124 |
Mean | 4.389 | 0.431 | 0.468 | 0.007 | 4.944 | 0.474 | 0.522 | 0.030 | 4.722 | 0.484 | 0.522 | 0.039 |
Number of loci | Populations | Populations | Global FST | Global RST | ||
---|---|---|---|---|---|---|
Harbin | Dali | Guiyang | ||||
7 Loci a | Harbin | 0.025 (0.008–0.074) | 0.006 (−0.006–0.066) | 0.022 (0.007–0.044) | 0.020 (0.011–0.067) | |
Dali | 0.033 (0.007–0.074) | 0.021 (0.007–0.071) | ||||
Guiyang | 0.034 (0.016–0.049) | 0.005 (−0.010–0.026) | ||||
11 Loci b | Harbin | 0.024 (0.013–0.068) | 0.020 (0.010–0.069) | 0.030 (0.011–0.056) | 0.030 (0.023–0.069) | |
Dali | 0.031 (0.008–0.057) | 0.040 (0.026–0.087) | ||||
Guiyang | 0.032 (0.021–0.041) | 0.029 (0.002–0.085) | ||||
14 Loci c | Harbin | 0.023 (0.015–0.061) | 0.008 (0.002–0.051) | 0.025 (0.015–0.036) | 0.016 (0.014–0.051) | |
Dali | 0.031 (0.014–0.055) | 0.011 (0.007–0.052) | ||||
Guiyang | 0.033 (0.019–0.048) | 0.012 (−0.001–0.027) | ||||
18 Loci | Harbin | 0.022 (0.017–0.056) | 0.016 (0.011–0.056) | 0.029 (0.016–0.046) | 0.023 (0.022–0.057) | |
Dali | 0.030 (0.014–0.047) | 0.025 (0.019–0.063) | ||||
Guiyang | 0.032 (0.020–0.045) | 0.026 (0.004–0.062) |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Yang, X.-M.; Sun, J.-T.; Xue, X.-F.; Zhu, W.-C.; Hong, X.-Y. Development and Characterization of 18 Novel EST-SSRs from the Western Flower Thrips, Frankliniella occidentalis (Pergande). Int. J. Mol. Sci. 2012, 13, 2863-2876. https://doi.org/10.3390/ijms13032863
Yang X-M, Sun J-T, Xue X-F, Zhu W-C, Hong X-Y. Development and Characterization of 18 Novel EST-SSRs from the Western Flower Thrips, Frankliniella occidentalis (Pergande). International Journal of Molecular Sciences. 2012; 13(3):2863-2876. https://doi.org/10.3390/ijms13032863
Chicago/Turabian StyleYang, Xian-Ming, Jing-Tao Sun, Xiao-Feng Xue, Wen-Chao Zhu, and Xiao-Yue Hong. 2012. "Development and Characterization of 18 Novel EST-SSRs from the Western Flower Thrips, Frankliniella occidentalis (Pergande)" International Journal of Molecular Sciences 13, no. 3: 2863-2876. https://doi.org/10.3390/ijms13032863